Skip to main content
Molecular Medicine Reports logoLink to Molecular Medicine Reports
. 2016 Oct 27;14(6):5155–5163. doi: 10.3892/mmr.2016.5900

Extracts containing CLPs of Bacillus amyloliquefaciens JN68 isolated from chicken intestines exert antimicrobial effects, particularly on methicillin-resistant Staphylococcus aureus and Listeria monocytogenes

Jen-Ni Chen 1,2,*, Chyou-Wei Wei 1,3,*, Hsiao-Chun Liu 1,4, Shu-Ying Chen 3,5, Chinshuh Chen 2, Yu-Min Juang 6, Chien-Chen Lai 6,7, Giou-Teng Yiang 8,9,
PMCID: PMC5355721  PMID: 27840979

Abstract

Bacillus amyloliquefaciens JN68, which has been discussed with regards to its antimicrobial activities, was successfully isolated from healthy chicken intestines in the present study. Using the spot-on-the-lawn antagonism method, the preliminary study indicated that a suspension culture of the B. amyloliquefaciens JN68 strain can inhibit the growth of Aspergillus niger and Penicillium pinophilum. Furthermore, the cyclic lipopeptides (CLPs) produced by the B. amyloliquefaciens JN68 strain were further purified through acid precipitation and Bond Elut®C18 chromatography, and their structures were identified using the liquid chromatography-electrospray ionization-mass spectrometry (MS)/MS method. Purified CLPs exerted broad spectrum antimicrobial activities on various pathogenic and foodborne bacteria and fungi, as determined using the agar well diffusion method. Listeria monocytogenes can induce listeriosis, which is associated with a high mortality rate. Methicillin-resistant Staphylococcus aureus (MRSA) is a major pathogenic bacteria that causes nosocomial infections. Therefore, L. monocytogenes and MRSA are currently of great concern. The present study aimed to determine whether B. amyloliquefaciens JN68 extracts could inhibit L. monocytogenes and MRSA. The results indicated that extracts of B. amyloliquefaciens JN68 have CLP components, and can successfully inhibit the growth of L. monocytogenes and MRSA.

Keywords: Bacillus amyloliquefaciens JN68, antimicrobial, cyclic lipopeptides, methicillin-resistant Staphylococcus aureus

Introduction

B. amyloliquefaciens is widely present in soil, plants and some animals (16); therefore, up to now, several strains of B. amyloliquefaciens have been isolated. Although different strains of B. amyloliquefaciens have a similar genome sequence, they have marked differences in the variable part of the genome (7); therefore, various strains of B. amyloliquefaciens may possess different abilities. Previous studies have demonstrated that numerous strains of B. amyloliquefaciens exert antifungal (810) and antibacterial activities (6,1113). However, these studies have also indicated that various strains exert different antimicrobial activities. At present, several studies have suggested that B. amyloliquefaciens may be used as a potential therapeutic strategy that targets pathogens.

The major antimicrobial components of B. amyloliquefaciens are cyclic lipopeptides (CLPs) (1416). At present, the three major CLPs that are known to possess antimicrobial activities are surfactin, iturin and fengycin A. Previous studies have demonstrated that surfactin, iturin and fengycin A possess antifungal and antibacterial activities (6,1719). Notably, CLPs have several advantages, including low toxicity, high biodegradability and environmentally positive characteristics (2023). These studies indicated that CLPs may be suitable for the treatment of pathogenic infections. In addition, other non-CLP antimicrobial peptides exist, such as amylolysin, which is a type of bacteriocin that is produced by B. amyloliquefacien (24,25). The majority of bacteriocins only inhibit gram-positive bacteria, and certain non-CLPs are produced using the ribosomal synthesis method with gene modification, which is not the same as in the Bacillus genus (25). Therefore, CLPs isolated from B. amyloliquefaciens may be considered a better choice for the treatment of pathogenic infections, compared with non-CLPs.

Listeria monocytogenes is a foodborne pathogen, which induces listeriosis (26,27). L. monocytogenes is present in several ready-to-eat foods, including vegetables, poultry and beef, which have been found to cause human listeriosis (28,29). Due to clinical severity and the high mortality rates of L. monocytogenes-induced listeriosis, the control of L. monocytogenes food contamination is an important issue (30,31). Previous studies have reported that bacteriocins produced by B. amyloliquefaciens can inhibit the growth of L. monocytogenes (32,33). These studies indicated that products of B. amyloliquefaciens may be useful to control growth of L. monocytogenes; however, whether CLPs produced by B. amyloliquefaciens may target L. monocytogenes remains unclear.

Staphylococcus aureus can cause clinical acute hematogenous, osteomyelitis, endocarditis, pulmonary abscesses and spondylodiscitis (3436). Methicillin-resistant S. aureus (MRSA) is not inhibited by treatment with several antibiotics (37,38). MRSA is a major and serious pathogen, which is particularly associated with nosocomial infection (39,40). Since numerous antibiotics can not effectively inhibit MRSA, the development of a novel anti-MRSA drug is important. A previous study indicated that B. amyloliquefaciens produced amylolysin, a ribosomally synthesized peptide, which can inhibit MRSA (25). However, to the best of our knowledge, whether CLPs produced by B. amyloliquefaciens can target MRSA has not yet been reported.

Based on the findings of previous studies, the present study aimed to determine whether CLPs isolated from B. amyloliquefaciens purified from chicken intestines can exert antibacterial effects on MRSA and L. monocytogenes.

Materials and methods

Materials

Difco™ agar and Luria broth (LB) culture medium were obtained from BD Biosciences (Franklin Lakes, NJ, USA). The polymerase chain reaction (PCR) primers for 16S ribosomal (r)RNA and DNA gyrase, subunit B (gyrB) genes were synthesized by MD Bio (Taipei, Taiwan). The API® 50 CHB system assay kit was obtained from bioMerieux (Marcy-l'Étoile, France). Bond Elut® C18 was purchased from Agilent Technologies (Santa Clara, CA, USA). The polytetrafluoroethylene membrane (JP020) was obtained from Advantec Co., Ltd. (Tokyo, Japan). The indicator strains Staphylococcus epidermidis and Bacillus cereus were obtained from Bioresource Collection and Research Center (Hsinchu, Taiwan). The indicator strains Streptococcus pyogenes, Listeria monocytogenes, Clostridium tyrobutyricum, Escherichia coli, Helicobacter pylori, Salmonella typhimurium, Pseudomonas aeruginosa, Aspergillus flavus var. flavus, Aspergillus niger and Penicillium pinophilum were obtained from American Type Culture Collection (Manassas, VA, USA). MRSA HCT20 was kindly provided by the Department of Pathology and Laboratory Medicine, Taichung Veterans General Hospital (Taichung, Taiwan). The iturin A and surfactin standards were purchased from Sigma-Aldrich; Merck Millipore (Darmstadt, Germany).

Selection of potential bacterial strains from chicken intestines

Potential bacterial strains with antimicrobial activities isolated from chicken intestines (obtained from a local market, Taichung, Taiwan) using microscopic examination and streak plate methods were selected and determined using the modified spot-on-the-lawn method, as previously described (41,42). Briefly, 0.7% top agar containing 105 colony-forming units (CFU)/ml indicator strains (A. niger or P. pinophilum) was overlaid onto a potato dextrose agar (PDA) plate, dried for 30 min, and subsequently spotted with 2 µl (108 CFU/ml) of an overnight culture of the candidate strains. Subsequently, the PDA plates were incubated at 25°C for 5 days. Zones of inhibition are found in the sites containing potential strains with antimicrobial activities.

Identification of potential bacterial strain

The B. amyloliquefaciens JN68 strain isolated from chicken intestines was identified by analyzing data from the API® 50 CHB system (43,44), as well as the results of a 16S rRNA and gyrB sequence detection (4547). The results were analyzed on the National Center for Biotechnology Information BLAST tool (blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome). According to morphological and physiological characteristics, biological testing and comparison of the 16S rRNA sequence, the strain was identified as B. amyloliquefaciens. Briefly, phenotypic characterization and sugar fermentation pattern of the candidate strain was analyzed according to standard methods, using the API® 50 CHB system assay kit. The obtained sugar fermentation pattern was analyzed using APILAB Plus software version 3.2.2 (bioMerieux). Further strain identification was confirmed by PCR detection of 16S rRNA and gyrB. Briefly, the candidate strain was cultured in LB culture medium (30°C, 200 × g, 8–12 h) and the genomic DNA was extracted using the Blood and Tissue Genomic DNA Extraction Miniprep (Viogene BioTek Corporation, New Taipei City). The amplification of the 16S rRNA and gyrB gene region of candidate strain was conducted in a 50 µl reaction mixture containing 1 µl genomic DNA template, 5 µl PCR reaction buffer [10 mM Tris-HCl (pH 8.8), 1.5 mM MgCl2, 50 mM KCl and 0.1% Triton X-100] containing 200 µM of each deoxynucleoside triphosphate (GE Healthcare Life Sciences, Chalfont, UK), 4 µl MgCl2 (52 mM), 1 µM each primer (Table I), 1 unit of Taq polymerase (GE Healthcare Life Sciences) and 39 µl autoclaved Milli-Q water (Merck Millipore). The amplification was performed with thermocycling conditions as follows: Denaturation for 10 min at 95°C; 35 cycles (as presented in Table I); termination at 72°C for 7 min. The PCR was conducted in a Robocycler® temperature thermal cycler (Agilent Technologies, Inc., Santa Clara, CA, USA). The PCR products were sequenced using an automatic sequencer (ABI PRISM® 3730; Applied Biosystems; Thermo Fisher Scientific, Inc., Waltham, MA, USA). Databases were screened for similarities using Basic Local Alignment Search Tool (48) and the alignment of overlapping fragments was performed using Vector NTI Advance 10 Contig Express software (Thermo Fisher Scientific, Inc.).

Table I.

Primer sequences and PCR conditions used in the present study.

First author, year Target gene and primers Sequence (5′ to 3′) PCR conditions Product size Refs.
Wang, 2007 gyrB degenerate primers 94°C ×1 min/55°C ×30 sec/72°Cx1 min 898 bp (47)
  UP-1S CGTAGAGCCACTTGAGCG
  UP-2Sr CTGCCGTTACAGTTCCTT
Perea Vélez, 2007 16S universal primer for bacteria 94°C ×1 min/45°C ×30 sec/72°Cx1 min ~1.5 kb (51)
  Pro26 AGAGTTTGATCCTGGCTCAG
  Pro27 AAGGAGGTGATCCAGCCGCA

Total number of cycles conducted was 35, initial denaturation step was 10 min at 95°C and final termination step was 7 min at 72°C. PCR, polymerase chain reaction; gyrB, DNA gyrase, subunit B.

Culture conditions and isolation of the lipopeptide fraction

The B. amyloliquefaciens JN68 strain was cultured and activated with 5 ml LB culture medium at 30°C. Subsequently, 5% B. amyloliquefaciens JN68 was seeded into 200 ml number 3 medium (49). After incubation under an agitation rate of ~200 rpm at 30°C for 4 days, the fermentation medium was centrifuged at 11,000 × g for 20 min at 4°C. The supernatant was collected and filtered through a polytetrafluoroethylene membrane (0.22 µM pore size). The filtered supernatant was then treated with 6 N HCl (pH 2.0) at 4°C overnight, and was further centrifuged at 11,000 × g for 20 min at 4°C. The sediment was washed with PBS and extracted three times with methanol. The methanolic extracts were concentrated and dissolved in methanol. Finally, the purified CLPs of the B. amyloliquefaciens JN68 strain were obtained from the methanolic extracts using the Bond Elut® C18 (5 g) mini column as previously described (50).

Identification of CLP structure by liquid chromatography-electrospray ionization-mass spectrometry (LC-ESI-MS)/MS

Purified CLPs produced by B. amyloliquefaciens JN68 were obtained from methanolic extracts as aforementioned. Subsequently, the structure of the CLPs was detected using LC and MS. For LC, an Agilent 1200 series system (Agilent Technologies), including a binary pump and an autosampler, was used for the chromatographic separation. The separation was conducted using an Atlantis C18 column (150×2.1 mm, 3.5 µm; Waters UK, Elstree, UK) at 30°C with a flow rate of 200 µl/min using the following gradient: i) 50% B for 2 min; ii) a gradient of 50–100% B for 10 min; iii) 100% B for 10 min; iv) re-equilibration with 50% B for 10 min. Mobile phase A consisted of 10% methanol and mobile phase B consisted of 100% methanol. The injection volume was set to 10 µl. For MS analysis an LTQ XL™ Linear Ion Trap MS was used (Thermo Fisher Scientific, Inc.), which was equipped with an ESI source. MS was operated in positive-ion mode with a spray voltage of 5.0 KV, and a capillary voltage of 40 V. Capillary temperature and sheath gas (N2) were set at 275°C and 20 arbitrary units, respectively. The precursor ion width was set at 3 Da and the normalized collision energy was set at 35%. For LC-ESI-MS/MS, the MS was operated in the selected target precursor ions as follows: m/z 1,036, surfactin; 1,043, iturin A; 1464, fengycin A, using the Linear Ion Trap MS. The three major CLP components containing surfactin, iturin A and fengycin A were analyzed in the present study as previously described (5254).

Antimicrobial profile assay

The antimicrobial activities of the purified CLPs produced by B. amyloliquefaciens JN68 were determined using an agar well diffusion assay, as previously described (41,55). Briefly, small holes were dug into agar plates using a 200 µl pipette tip. Each indicator microorganism (~106 CFU/ml bacterium or 105 CFU/ml fungus) was spread onto an agar plate. Subsequently, 50 µl B. amyloliquefaciens JN68 extracts were seeded into the holes on the agar plates for 2 h at 4°C. The agar plates were then incubated for 16–18 h at 37°C (indicator bacteria) or at 30°C (indicator fungi). After a 16–18 h incubation, the appearance of the zones of inhibition was determined.

Results

Screening of potential antimicrobial strains

Several bacterial strains were obtained from the chicken intestines. In order to identify potential strains with antimicrobial activities, the spot-on-the-lawn method was used (41). In the present study, bacterial strains isolated from chicken intestines were spotted onto top agar plates containing indicator strains (A. niger or P. pinophilum). Zones of inhibition are found in the sites containing potential strains with antimicrobial activities. The results indicated that marked zones of inhibition appeared at the B5 and B7 sites; these sites therefore contained potential strains that can effectively inhibit the growth of A. niger (Fig. 1A) and P. pinophilum (Fig. 1B). Therefore, the strains at the B5 and B7 sites were considered to possess antimicrobial activities. In the present study, the potential bacterium at the B7 site was selected and analyzed (identical to B5).

Figure 1.

Figure 1.

Screening of potential antimicrobial strains against (A) Aspergillus niger and (B) Penicillium pinophilum, as demonstrated from the zones of inhibition produced using the spot-on-the-lawn method.

Identification of the bacterial strain

The potential bacteria at the B7 site was primarily identified using the API® 50 CHB system (Table II). Subsequently, the potential bacteria at the B7 site was further confirmed by 16S rRNA and gyrB sequence detection. The PCR primer sequences of 16S rRNA and gyrB used in the present study are presented in Table I. Analysis of the API® 50 CHB system and gene sequence detection indicated that the potential bacteria at the B7 site belonged to the Bacillus amyloliquefaciens family. In the present study, this potential bacterial strain was named Bacillus amyloliquefaciens JN68.

Table II.

Sugar fermentation pattern of the candidate strain was determined using the API 50 CHB system.

Carbohydrate fermentation

Active ingredient Response
Control
Glycerol +
Erythritol
D-arabinose
L-arabinose +
D-ribose +
D-cylose w
L-cylose
D-adonitol
β-methyl-D-xylopyranoside
D-galactose
D-glucose +
D-fructose +
D-mannose +
L-sorbose
L-rhamnose
Dulcitol
Inositol +
D-mannitol +
D-sorbitol +
Methyl α-D-mannopyranoside
Methyl α-D-glucopyranoside +
N-acetyl glucosamine
Amygdalin
Arbutin +
Esculin (ferric citrate) +
Salicin +
D-cellobiose +
D-maltose +
D-lactose (bovine origin) w
D-melibiose
D-saccharose (sucrose) +
D-trehalose +
Inulin
D-melezitose
D-raffinose
Amidon (starch) w
Glycogen ±
Xylitol
Gentiobiose w
D-turanose
D-lyxose
D-tagatose
D-fucose
L-fucose
D-Arabitol
L-arabitol
Potassium giuconate
Potassium 2-ketogluconate
Potassium 5-ketogluconate

Control is the culture medium alone. +, positive reaction; -, negative reaction; w, weak reaction.

Determination of CLP extract components

LC-ESI-MS/MS analysis of the CLP extracts is presented in Figs. 24. As shown in Fig. 2C, the main peak of surfactin lipopeptide was revealed at retention time (Rt) 17.93 min corresponding to protonated molecules [M+H]+ at m/z 1,036 in positive modality. The representative MS/MS spectrum is shown in Fig. 2D. These results were similar to those observed during surfactin standard LC-ESI-MS/MS analysis (Fig. 2A and B). This analysis confirmed the presence of one main surfactin in the extracted CLPs. As shown in Fig. 3C, the one main peak of iturin A lipopeptide was revealed at Rt 13.16 min corresponding to the protonated molecules [M+H]+ at m/z 1,043 in positive modality. The representative MS/MS spectrum is shown in Fig. 3D. The Rt and product ions were similar to those obtained during iturin A standard LC-ESI-MS/MS analysis (Fig. 3A and B). The results of the LC-ESI-MS/MS analysis of fengycin A lipopeptide are presented in Fig. 4. The one main peak of fengycin A was observed at Rt 13.90 min corresponding to the protonated molecules [M+H]+ at m/z 1,464 in positive modality (Fig. 4A). The representative MS/MS spectrum is shown in Fig. 4B. Although no fengycin A standard was used in the present study, the product ions were consistent with those from previous studies, which reported that product ions at m/z 1,080 and 966 were representative ions present in the fengycin A MS/MS spectrum at m/z 1,464 (56,57). Taking into account the results obtained by LC-MS/MS analysis of CLPs, there are at least three lipopeptide groups within the whole B. amyloliquefaciens extract, which included surfactant, iturin A and fengycin A.

Figure 2.

Figure 2.

LC-ESI-MS/MS analysis of (A and B) surfactin standard and (C and D) biosurfactant lipopeptide extract. (A and C) Exact ion current chromatogram of surfactin (m/z 1,036). (B and D) Product ion spectra of the protonated molecules [M+H]+ of surfactin at m/z 1,036. LC-ESI-MS/MS, liquid chromatography-electrospray ionization-mass spectrometry/mass spectrometry.

Figure 4.

Figure 4.

LC-ESI-MS/MS analysis of biosurfactant lipopeptide extract. (A) Exact ion current chromatogram of fengycin A (m/z 1,464). (B) Product ion spectra of the protonated molecules [M+H]+ of fengycin A at m/z 1,464. Significant fragment ions of fengycin A were marked with an asterisk. LC-ESI-MS/MS, liquid chromatography-electrospray ionization-mass spectrometry/mass spectrometry.

Figure 3.

Figure 3.

LC-ESI-MS/MS analysis of (A and B) iturin A standard and (C and D) biosurfactant lipopeptide extract. (A and C) Exact ion current chromatogram of iturin A (m/z 1,043). (B and D) Product ion spectra of the protonated molecules [M+H]+ of iturin A at m/z 1,043. LC-ESI-MS/MS, liquid chromatography-electrospray ionization-mass spectrometry/mass spectrometry.

Antimicrobial spectrum of the potential strain

Previous studies have demonstrated that CLPs isolated from various B. amyloliquefaciens strains possess distinct antifungal (9,17,58,59) and antibacterial activities (6063). However, to the best of our knowledge, no previous experiment has demonstrated that CLPs isolated from B. amyloliquefaciens can inhibit MRSA and L. monocytogenes. The present study indicated that CLPs containing surfactin, iturin and fengycin A, isolated from B. amyloliquefaciens JN68, can inhibit several pathogenic fungal and bacterial strains (Table III). Notably, the present study is the first, to the best of our knowledge, to indicate that CLPs isolated from B. amyloliquefaciens JN68 can inhibit the growth of MRSA and L. monocytogenes (Table III).

Table III.

Antimicrobial spectrum of CLPs produced by Bacillus amyloliquefacients JN68 using the agar well diffusion method.

Antimicrobial activitya

Indicator strain Growth medium Unpurified CLP
Gram-positive
  HCT20 MRSA TSA +++
  Staphylococcus epidermidis BCRC15245 NA ++
  Streptococcus pyogenes ATCC12344 TSA with 5% blood +++
  Listeria monocytogenes ATCC15313 BHI +++
  Clostridium tyrobutyricum ATCC25755 NA +
  Bacillus cereus BCRC10250 NA +
Gram-negative
  Escherichia coli ATCC11775 (10675) NA ++
  Helicobacter pylori ATCC43526 Brucella with 3% blood   +
  Salmonella typhimurium ATCC13311 TSA +++
  Pseudomonas aeruginosa ATCC9027 (11633) NA ++
Mold
  Aspergillus flavus var. flavusb ATCC26770 PDA +++
  Aspergillus niger ATCC16404 PDA +
  Penicillium pinophilum ATCC9644 PDA +++
a

Interpretation of zone of inhibition diameter: +, 5–10 mm (weak inhibition); ++, 10–15 mm (moderate inhibition); +++, >15 mm (strong inhibition).

b

Production of α-toxins, B1, B2, G1 and G2. BCRC, Bioresource Collection and Research Center; ATCC, American Type Culture Collection; MRSA, methicillin-resistant Staphylococcus aureus; TSA, tryptone soya agar; NA, nutrient agar; BHI, brain-heart infusion medium; PDA, potato dextrose agar.

Discussion

At present, various B. amyloliquefaciens strains have been isolated from plants and soil; in addition, some B. amyloliquefaciens strains have been found to be present in animals (16). Several studies have reported that extracts of various B. amyloliquefaciens strains exert antimicrobial activities (12,64,65). However, to the best of our knowledge, no previous studies have reported that B. amyloliquefaciens strains isolated from chickens possess antimicrobial activities. The present study isolated the B. amyloliquefaciens JN68 strain from chicken intestines, and confirmed it possessed antimicrobial activities. At present, several components have been identified that exert antimicrobial activities, including CLPs (15,66,67), antifungal enzymes (5,68) and non-CLPs (24,25). Among these components, CLPs exert more broad-spectrum antifungal and antibacterial activities, compared with antifungal enzymes and non-CLPs (17,64). In general, CLPs can exert antifungal and antibacterial activities (against both gram-positive and gram-negative bacteria) (64,67), whereas antifungal enzymes only exert antifungal activities (5,68) and non-CLPs exert only antibacterial activities against gram-positive bacteria (24,25). In the present study, the CLP extracts purified from the B. amyloliquefaciens JN68 strain exerted antifungal and antibacterial activities on gram-positive and gram-negative bacteria.

Since CLPs produced by B. amyloliquefaciens possess several advantages, including broad-spectrum antimicrobial activities, low toxicity, high biodegradability and environmentally positive characteristics (2023,64), CLPs may therefore be considered potential antimicrobials for food and clinical application. Previous studies have reported that surfactin, iturin and fengycin A are major CLP components that exert antimicrobial activities (6,1719). In the present study, the extracts purified from the B. amyloliquefaciens JN68 strain were confirmed to be surfactin, iturin and fengycin A. Since various B. amyloliquefaciens strains have similar genome sequences, with the exception of differences in the variable region of the genome (7), there are several types and expression levels of surfactin, iturin and fengycin A in the different strains (69). This may be why CLPs produced by different strains possess distinct antimicrobial activities.

Previous studies have reported that CLPs produced by some B. amyloliquefaciens strains possess antifungal activities, including the CGMCC5569, NJN-6, Q-426 and PPCB004 strains (9,17,58,59). Furthermore, CLPs produced by some B. amyloliquefaciens strains possess antibacterial activities, including FZB42, HR62, NJN-6 and B9601-Y2 strains (6063). In addition, CLPs produced by some B. amyloliquefaciens strains possess antifungal and antibacterial activities, such as the NJN-6 and B9601-Y2 strains (9,62,63). Compared with previous studies, antifungal and antibacterial activities were detected in the B. amyloliquefaciens JN68 strain isolated from chicken intestines in the present study. It is well known that MRSA is an important bacterial species that causes nosocomial infections (39,40), whereas L. monocytogenes induces listeriosis, which has a high mortality rate (30,31). No previous studies, to the best of our knowledge, have demonstrated that CLPs produced by B. amyloliquefaciens can inhibit the growth of MRSA and L. monocytogenes. Therefore, the present study is the first to indicate that the B. amyloliquefaciens JN68 strain can inhibit MRSA and L. monocytogenes.

In conclusion, the present study isolated B. amyloliquefaciens JN68 from chicken intestines, and confirmed it possessed antifungal and antibacterial activities. In particular, B. amyloliquefaciens JN68 was able to inhibit the growth of MRSA and L. monocytogenes. These results suggested that the B. amyloliquefaciens JN68 strain may be applied to prevent the occurrence of foodborne diseases and nosocomial infections.

Acknowledgements

The present study was supported by grants from the Taipei Tzu Chi Hospital (grant nos. TCRD-TPE-104-34 and TCRD-TPE-104-06).

References

  • 1.Niazi A, Manzoor S, Bejai S, Meijer J, Bongcam-Rudloff E. Complete genome sequence of a plant associated bacterium Bacillus amyloliquefaciens subsp. plantarum UCMB5033. Stand Genomic Sci. 2014;9:718–725. doi: 10.4056/sigs.4758653. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Cai J, Liu F, Liao X, Zhang R. Complete genome sequence of Bacillus amyloliquefaciens LFB112 isolated from Chinese herbs, a strain of a broad inhibitory spectrum against domestic animal pathogens. J Biotechnol. 2014;175:63–64. doi: 10.1016/j.jbiotec.2014.01.013. [DOI] [PubMed] [Google Scholar]
  • 3.Ait Kaki A, Chaouche N Kacem, Dehimat L, Milet A, Youcef-Ali M, Ongena M, Thonart P. Biocontrol and plant growth promotion characterization of Bacillus species isolated from calendula officinalis rhizosphere. Indian J Microbiol. 2013;53:447–452. doi: 10.1007/s12088-013-0395-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Geetha I, Aruna R, Manonmani AM. Mosquitocidal Bacillus amyloliquefaciens: Dynamics of growth & production of novel pupicidal biosurfactant. Indian J Med Res. 2014;140:427–434. [PMC free article] [PubMed] [Google Scholar]
  • 5.Han JH, Shim H, Shin JH, Kim KS. Antagonistic activities of Bacillus spp. strains isolated from tidal flat sediment towards anthracnose pathogens Colletotrichum acutatum and C. gloeosporioides in South Korea. Plant Pathol J. 2015;31:165–175. doi: 10.5423/PPJ.OA.03.2015.0036. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Xu HM, Rong YJ, Zhao MX, Song B, Chi ZM. Antibacterial activity of the lipopetides produced by Bacillus amyloliquefaciens M1 against multidrug-resistant Vibrio spp. isolated from diseased marine animals. Appl Microbiol Biotechnol. 2014;98:127–136. doi: 10.1007/s00253-013-5291-1. [DOI] [PubMed] [Google Scholar]
  • 7.Ruckert C, Blom J, Chen X, Reva O, Borriss R. Genome sequence of B. amyloliquefaciens type strain DSM7(T) reveals differences to plant-associated B. amyloliquefaciens FZB42. J Biotechnol. 2011;155:78–85. doi: 10.1016/j.jbiotec.2011.01.006. [DOI] [PubMed] [Google Scholar]
  • 8.Xu Z, Shao J, Li B, Yan X, Shen Q, Zhang R. Contribution of bacillomycin D in Bacillus amyloliquefaciens SQR9 to antifungal activity and biofilm formation. Appl Environ Microbiol. 2013;79:808–815. doi: 10.1128/AEM.02645-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Yuan J, Raza W, Huang Q, Shen Q. The ultrasound-assisted extraction and identification of antifungal substances from B. amyloliquefaciens strain NJN-6 suppressing Fusarium oxysporum. J Basic Microbiol. 2012;52:721–730. doi: 10.1002/jobm.201100560. [DOI] [PubMed] [Google Scholar]
  • 10.Zhao P, Quan C, Jin L, Wang L, Wang J, Fan S. Effects of critical medium components on the production of antifungal lipopeptides from Bacillus amyloliquefaciens Q-426 exhibiting excellent biosurfactant properties. World J Microbiol Biotechnol. 2013;29:401–409. doi: 10.1007/s11274-012-1180-5. [DOI] [PubMed] [Google Scholar]
  • 11.Chi Z, Rong YJ, Li Y, Tang MJ, Chi ZM. Biosurfactins production by Bacillus amyloliquefaciens R3 and their antibacterial activity against multi-drug resistant pathogenic E. coli. Bioprocess Biosyst Eng. 2015;38:853–861. doi: 10.1007/s00449-014-1328-9. [DOI] [PubMed] [Google Scholar]
  • 12.Kadaikunnan S, Rejiniemon T, Khaled JM, Alharbi NS, Mothana R. In-vitro antibacterial, antifungal, antioxidant and functional properties of Bacillus amyloliquefaciens. Ann Clin Microbiol Antimicrob. 2015;14:9. doi: 10.1186/s12941-015-0069-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Cao H, He S, Wei R, Diong M, Lu L. Bacillus amyloliquefaciens G1: A potential antagonistic bacterium against eel-pathogenic aeromonas hydrophila. Evid Based Complement Alternat Med. 2011;2011:824104. doi: 10.1155/2011/824104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Ma Z, Hu J, Wang X, Wang S. NMR spectroscopic and MS/MS spectrometric characterization of a new lipopeptide antibiotic bacillopeptin B1 produced by a marine sediment-derived Bacillus amyloliquefaciens SH-B74. J Antibiot (Tokyo) 2014;67:175–178. doi: 10.1038/ja.2013.89. [DOI] [PubMed] [Google Scholar]
  • 15.Mora I, Cabrefiga J, Montesinos E. Cyclic lipopeptide biosynthetic genes and products, and inhibitory activity of plant-associated Bacillus against phytopathogenic bacteria. PLoS One. 2015;10:e0127738. doi: 10.1371/journal.pone.0127738. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Nihorimbere V, Cawoy H, Seyer A, Brunelle A, Thonart P, Ongena M. Impact of rhizosphere factors on cyclic lipopeptide signature from the plant beneficial strain Bacillus amyloliquefaciens S499. FEMS Microbiol Ecol. 2012;79:176–191. doi: 10.1111/j.1574-6941.2011.01208.x. [DOI] [PubMed] [Google Scholar]
  • 17.Arrebola E, Jacobs R, Korsten L. Iturin A is the principal inhibitor in the biocontrol activity of Bacillus amyloliquefaciens PPCB004 against postharvest fungal pathogens. J Appl Microbiol. 2010;108:386–395. doi: 10.1111/j.1365-2672.2009.04438.x. [DOI] [PubMed] [Google Scholar]
  • 18.Arguelles-Arias A, Ongena M, Halimi B, Lara Y, Brans A, Joris B, Fickers P. Bacillus amyloliquefaciens GA1 as a source of potent antibiotics and other secondary metabolites for biocontrol of plant pathogens. Microb Cell Fact. 2009;8:63. doi: 10.1186/1475-2859-8-63. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Vágvölgyi C, Sajben-Nagy E, Bóka B, Vörös M, Berki A, Palágyi A, Krisch J, Skrbić B, Durišić-Mladenović N, Manczinger L. Isolation and characterization of antagonistic Bacillus strains capable to degrade ethylenethiourea. Curr Microbiol. 2013;66:243–250. doi: 10.1007/s00284-012-0263-8. [DOI] [PubMed] [Google Scholar]
  • 20.Kim PI, Bai H, Bai D, Chae H, Chung S, Kim Y, Park R, Chi YT. Purification and characterization of a lipopeptide produced by Bacillus thuringiensis CMB26. J Appl Microbiol. 2004;97:942–949. doi: 10.1111/j.1365-2672.2004.02356.x. [DOI] [PubMed] [Google Scholar]
  • 21.Maget-Dana R, Peypoux F. Iturins, a special class of pore-forming lipopeptides: Biological and physicochemical properties. Toxicology. 1994;87:151–174. doi: 10.1016/0300-483X(94)90159-7. [DOI] [PubMed] [Google Scholar]
  • 22.Stein T. Bacillus subtilis antibiotics: Structures, syntheses and specific functions. Mol Microbiol. 2005;56:845–857. doi: 10.1111/j.1365-2958.2005.04587.x. [DOI] [PubMed] [Google Scholar]
  • 23.Yoshida S, Hiradate S, Tsukamoto T, Hatakeda K, Shirata A. Antimicrobial activity of culture filtrate of Bacillus amyloliquefaciens RC-2 isolated from mulberry leaves. Phytopathology. 2001;91:181–187. doi: 10.1094/PHYTO.2001.91.2.181. [DOI] [PubMed] [Google Scholar]
  • 24.Benitez L, Correa A, Daroit D, Brandelli A. Antimicrobial activity of Bacillus amyloliquefaciens LBM 5006 is enhanced in the presence of Escherichia coli. Curr Microbiol. 2011;62:1017–1022. doi: 10.1007/s00284-010-9814-z. [DOI] [PubMed] [Google Scholar]
  • 25.Arias A Arguelles, Ongena M, Devreese B, Terrak M, Joris B, Fickers P. Characterization of amylolysin, a novel lantibiotic from Bacillus amyloliquefaciens GA1. PLoS One. 2013;8:e83037. doi: 10.1371/journal.pone.0083037. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Salazar JK, Wu Z, McMullen PD, Luo Q, Freitag NE, Tortorello ML, Hu S, Zhang W. PrfA-like transcription factor gene lmo0753 contributes to L-rhamnose utilization in Listeriamonocytogenes strains associated with human food-borne infections. Appl Environ Microbiol. 2013;79:5584–5592. doi: 10.1128/AEM.01812-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Shalaby MA, Mohamed MS, Mansour MA, Abd El-Haffiz AS. Comparison of polymerase chain reaction and conventional methods for diagnosis of Listeria monocytogenes isolated from different clinical specimens and food stuffs. Clin Lab. 2011;57:919–924. [PubMed] [Google Scholar]
  • 28.Neetoo H, Ye M, Chen H. Potential antimicrobials to control Listeria monocytogenes in vacuum-packaged cold-smoked salmon pâté and fillets. Int J Food Microbiol. 2008;123:220–227. doi: 10.1016/j.ijfoodmicro.2008.02.001. [DOI] [PubMed] [Google Scholar]
  • 29.Pérez-Rodriguez F, van Asselt ED, Garcia-Gimeno RM, Zurera G, Zwietering MH. Extracting additional risk managers information from a risk assessment of Listeria monocytogenes in deli meats. J Food Prot. 2007;70:1137–1152. doi: 10.4315/0362-028X-70.5.1137. [DOI] [PubMed] [Google Scholar]
  • 30.Althaus D, Lehner A, Brisse S, Maury M, Tasara T, Stephan R. Characterization of Listeria monocytogenes strains isolated during 2011–2013 from human infections in Switzerland. Foodborne Pathog Dis. 2014;11:753–758. doi: 10.1089/fpd.2014.1747. [DOI] [PubMed] [Google Scholar]
  • 31.Pontello M, Guaita A, Sala G, Cipolla M, Gattuso A, Sonnessa M, Gianfranceschi MV. Listeria monocytogenes serotypes in human infections (Italy, 2000–2010) Ann Ist Super Sanita. 2012;48:146–150. doi: 10.4415/ANN_12_02_07. [DOI] [PubMed] [Google Scholar]
  • 32.Lisboa MP, Bonatto D, Bizani D, Henriques JA, Brandelli A. Characterization of a bacteriocin-like substance produced by Bacillus amyloliquefaciens isolated from the Brazilian Atlantic forest. Int Microbiol. 2006;9:111–118. [PubMed] [Google Scholar]
  • 33.Sağdiç O, Ozkan G, Ozcan M, Ozçelik S. A study on inhibitory effects of Siğla tree (Liquidambar orientalis Mill. var. orientalis) storax against several bacteria. Phytother Res. 2005;19:549–551. doi: 10.1002/ptr.1654. [DOI] [PubMed] [Google Scholar]
  • 34.Agarwal A, Aggarwal AN. Bone and joint infections in children: Acute hematogenous osteomyelitis. Indian J Pediatr. 2015 doi: 10.1007/s12098-015-1806-3. [DOI] [PubMed] [Google Scholar]
  • 35.Christiansen JG, Jensen HE, Johansen LK, Kochl J, Koch J, Aalbaek B, Nielsen OL, Leifsson PS. Porcine models of non-bacterial thrombotic endocarditis (NBTE) and infective endocarditis (IE) caused by Staphylococcus aureus: A preliminary study. J Heart Valve Dis. 2013;22:368–376. [PubMed] [Google Scholar]
  • 36.Vos FJ, Kullberg BJ, Sturm PD, Krabbe PF, van Dijk AP, Wanten GJ, Oyen WJ, Bleeker-Rovers CP. Metastatic infectious disease and clinical outcome in Staphylococcus aureus and Streptococcus species bacteremia. Medicine (Baltimore) 2012;91:86–94. doi: 10.1097/MD.0b013e31824d7ed2. [DOI] [PubMed] [Google Scholar]
  • 37.Hasanvand A, Ghafourian S, Taherikalani M, Jalilian FA, Sadeghifard N, Pakzad I. Antiseptic resistance in methicillin sensitive and methicillin resistant Staphylococcus aureus isolates from some major hospitals, Iran. Recent Pat Antiinfect Drug Discov. 2015;10:105–112. doi: 10.2174/1574891X10666150623093259. [DOI] [PubMed] [Google Scholar]
  • 38.Kaur DC, Chate SS. Study of antibiotic resistance pattern in methicillin resistant Staphylococcus aureus with special reference to newer antibiotic. J Glob Infect Dis. 2015;7:78–84. doi: 10.4103/0974-777X.157245. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.McMaster J, Booth MG, Smith A, Hamilton K. Meticillin-resistant Staphylococcus aureus in the intensive care unit: Its effect on outcome and risk factors for acquisition. J Hosp Infect. 2015;90:327–332. doi: 10.1016/j.jhin.2015.04.009. [DOI] [PubMed] [Google Scholar]
  • 40.Dancer SJ. Controlling hospital-acquired infection: Focus on the role of the environment and new technologies for decontamination. Clin Microbiol Rev. 2014;27:665–690. doi: 10.1128/CMR.00020-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Lima ET, Filho RL Andreatti, Okamoto AS, Noujaim JC, Barros MR, Crocci AJ. Evaluation in vitro of the antagonistic substances produced by Lactobacillus spp. isolated from chickens. Can J Vet Res. 2007;71:103–107. [PMC free article] [PubMed] [Google Scholar]
  • 42.Chen H, Wang L, Su CX, Gong GH, Wang P, Yu ZL. Isolation and characterization of lipopeptide antibiotics produced by Bacillus subtilis. Lett Appl Microbiol. 2008;47:180–186. doi: 10.1111/j.1472-765X.2008.02412.x. [DOI] [PubMed] [Google Scholar]
  • 43.Østensvik Ø, From C, Heidenreich B, O'Sullivan K, Granum PE. Cytotoxic Bacillus spp. belonging to the B. cereus and B. subtilis groups in Norwegian surface waters. J Appl Microbiol. 2004;96:987–993. doi: 10.1111/j.1365-2672.2004.02226.x. [DOI] [PubMed] [Google Scholar]
  • 44.Zaghloul TI, Al-Bahra M, Al-Azmeh H. Isolation, identification, and keratinolytic activity of several feather-degrading bacterial isolates. Appl Biochem Biotechnol 70–72. 1998:207–213. doi: 10.1007/BF02920137. [DOI] [PubMed] [Google Scholar]
  • 45.Marroki A, Zúñiga M, Kihal M, Pérez-Martinez G. Characterization of lactobacillus from algerian goat's milk based on phenotypic, 16S rDNA sequencing and their technological properties. Braz J Microbiol. 2011;42:158–171. doi: 10.1590/S1517-83822011000100020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Tajbakhsh M, Nayer BN, Motavaze K, Kharaziha P, Chiani M, Zali MR, Klena JD. Phylogenetic relationship of Salmonella enterica strains in Tehran, Iran, using 16S rRNA and gyrB gene sequences. J Infect Dev Ctries. 2011;5:465–472. doi: 10.3855/jidc.1504. [DOI] [PubMed] [Google Scholar]
  • 47.Wang LT, Lee FL, Tai CJ, Kasai H. Comparison of gyrB gene sequences, 16S rRNA gene sequences and DNA-DNA hybridization in the Bacillus subtilis group. Int J Syst Evol Microbiol. 2007;57:1846–1850. doi: 10.1099/ijs.0.64685-0. [DOI] [PubMed] [Google Scholar]
  • 48.Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucleic Acids Res. 1997;25:3389–3402. doi: 10.1093/nar/25.17.3389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Tsuge K, Akiyama T, Shoda M. Cloning, sequencing, and characterization of the iturin A operon. J Bacteriol. 2001;183:6265–6273. doi: 10.1128/JB.183.21.6265-6273.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Razafindralambo H, Paquot M, Hbid C, Jacques P, Destain J, Thonart P. Purification of antifungal lipopeptides by reversed-phase high-performance liquid chromatography. J Chromatogr. 1993;639:81–85. doi: 10.1016/0021-9673(93)83091-6. [DOI] [PubMed] [Google Scholar]
  • 51.Perea Vélez M, Hermans K, Verhoeven TL, Lebeer SE, Vanderleyden J, De Keersmaecker SC. Identification and characterization of starter lactic acid bacteria and probiotics from Columbian dairyproducts. J Appl Microbiol. 2007;103:666–674. doi: 10.1111/j.1365-2672.2007.03294.x. [DOI] [PubMed] [Google Scholar]
  • 52.Zeriouh H, de Vicente A, Pérez-Garcia A, Romero D. Surfactin triggers biofilm formation of Bacillus subtilis in melon phylloplane and contributes to the biocontrol activity. Environ Microbiol. 2014;16:2196–2211. doi: 10.1111/1462-2920.12271. [DOI] [PubMed] [Google Scholar]
  • 53.Zhao X, Han Y, Tan XQ, Wang J, Zhou ZJ. Optimization of antifungal lipopeptide production from Bacillus sp. BH072 by response surface methodology. J Microbiol. 2014;52:324–332. doi: 10.1007/s12275-014-3354-3. [DOI] [PubMed] [Google Scholar]
  • 54.Wang J, Liu J, Wang X, Yao J, Yu Z. Application of electrospray ionization mass spectrometry in rapid typing of fengycin homologues produced by Bacillus subtilis. Lett Appl Microbiol. 2004;39:98–102. doi: 10.1111/j.1472-765X.2004.01547.x. [DOI] [PubMed] [Google Scholar]
  • 55.Tagg JR, McGiven AR. Assay system for bacteriocins. Appl Microbiol. 1971;21:943. doi: 10.1128/am.21.5.943-943.1971. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Pecci Y, Rivardo F, Martinotti MG, Allegrone G. LC/ESI-MS/MS characterisation of lipopeptide biosurfactants produced by the Bacillus licheniformis V9T14 strain. J Mass Spectrom. 2010;45:772–778. doi: 10.1002/jms.1767. [DOI] [PubMed] [Google Scholar]
  • 57.Vanittanakom N, Loeffler W, Koch U, Jung G. Fengycin-a novel antifungal lipopeptide antibiotic produced by Bacillus subtilis F-29-3. J Antibiot (Tokyo) 1986;39:888–901. doi: 10.7164/antibiotics.39.888. [DOI] [PubMed] [Google Scholar]
  • 58.Zhao P, Quan C, Wang Y, Wang J, Fan S. Bacillus amyloliquefaciens Q-426 as a potential biocontrol agent against Fusarium oxysporum f. sp. spinaciae. J Basic Microbiol. 2014;54:448–456. doi: 10.1002/jobm.201200414. [DOI] [PubMed] [Google Scholar]
  • 59.Yuan B, Wang Z, Qin S, Zhao GH, Feng YJ, Wei LH, Jiang JH. Study of the anti-sapstain fungus activity of Bacillus amyloliquefaciens CGMCC 5569 associated with Ginkgo biloba and identification of its active components. Bioresour Technol. 2012;114:536–541. doi: 10.1016/j.biortech.2012.03.062. [DOI] [PubMed] [Google Scholar]
  • 60.Kröber M, Wibberg D, Grosch R, Eikmeyer F, Verwaaijen B, Chowdhury SP, Hartmann A, Pühler A, Schlüter A. Effect of the strain Bacillus amyloliquefaciens FZB42 on the microbial community in the rhizosphere of lettuce under field conditions analyzed by whole metagenome sequencing. Front Microbiol. 2014;5:252. doi: 10.3389/fmicb.2014.00252. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Huang J, Wei Z, Tan S, Mei X, Shen Q, Xu Y. Suppression of bacterial wilt of tomato by bioorganic fertilizer made from the antibacterial compound producing strain Bacillus amyloliquefaciens HR62. J Agric Food Chem. 2014;62:10708–10716. doi: 10.1021/jf503136a. [DOI] [PubMed] [Google Scholar]
  • 62.Yuan J, Zhang F, Wu Y, Zhang J, Raza W, Shen Q, Huang Q. Recovery of several cell pellet-associated antibiotics produced by Bacillus amyloliquefaciens NJN-6. Lett Appl Microbiol. 2014;59:169–176. doi: 10.1111/lam.12260. [DOI] [PubMed] [Google Scholar]
  • 63.He P, Hao K, Blom J, Rückert C, Vater J, Mao Z, Wu Y, Hou M, He P, He Y, Borriss R. Genome sequence of the plant growth promoting strain Bacillus amyloliquefaciens subsp. plantarum B9601-Y2 and expression of mersacidin and other secondary metabolites. J Biotechnol. 2012;164:281–291. doi: 10.1016/j.jbiotec.2012.12.014. [DOI] [PubMed] [Google Scholar]
  • 64.Compaoré CS, Nielsen DS, Sawadogo-Lingani H, Berner TS, Nielsen KF, Adimpong DB, Diawara B, Ouédraogo GA, Jakobsen M, Thorsen L. Bacillus amyloliquefaciens ssp. plantarum strains as potential protective starter cultures for the production of Bikalga, an alkaline fermented food. J Appl Microbiol. 2013;115:133–146. doi: 10.1111/jam.12214. [DOI] [PubMed] [Google Scholar]
  • 65.Hajji S, Ghorbel-Bellaaj O, Younes I, Jellouli K, Nasri M. Chitin extraction from crab shells by Bacillus bacteria. Biological activities of fermented crab supernatants. Int J Biol Macromol. 2015;79:167–173. doi: 10.1016/j.ijbiomac.2015.04.027. [DOI] [PubMed] [Google Scholar]
  • 66.Alvarez F, Castro M, Principe A, Borioli G, Fischer S, Mori G, Jofré E. The plant-associated Bacillus amyloliquefaciens strains MEP2 18 and ARP2 3 capable of producing the cyclic lipopeptides iturin or surfactin and fengycin are effective in biocontrol of sclerotinia stem rot disease. J Appl Microbiol. 2012;112:159–174. doi: 10.1111/j.1365-2672.2011.05182.x. [DOI] [PubMed] [Google Scholar]
  • 67.Hsieh FC, Lin TC, Meng M, Kao SS. Comparing methods for identifying Bacillus strains capable of producing the antifungal lipopeptide iturin A. Curr Microbiol. 2008;56:1–5. doi: 10.1007/s00284-007-9003-x. [DOI] [PubMed] [Google Scholar]
  • 68.Wang SL, Shih IL, Liang TW, Wang CH. Purification and characterization of two antifungal chitinases extracellularly produced by Bacillus amyloliquefaciens V656 in a shrimp and crab shell powder medium. J Agric Food Chem. 2002;50:2241–2248. doi: 10.1021/jf010885d. [DOI] [PubMed] [Google Scholar]
  • 69.Ongena M, Jacques P. Bacillus lipopeptides: Versatile weapons for plant disease biocontrol. Trends Microbiol. 2008;16:115–125. doi: 10.1016/j.tim.2007.12.009. [DOI] [PubMed] [Google Scholar]

Articles from Molecular Medicine Reports are provided here courtesy of Spandidos Publications

RESOURCES