Skip to main content
Proceedings of the National Academy of Sciences of the United States of America logoLink to Proceedings of the National Academy of Sciences of the United States of America
. 2017 Mar 6;114(11):2976–2981. doi: 10.1073/pnas.1618596114

Cas9-mediated genome editing in the methanogenic archaeon Methanosarcina acetivorans

Dipti D Nayak a, William W Metcalf b,1
PMCID: PMC5358397  PMID: 28265068

Significance

Methanogenic archaea play a central role in the global carbon cycle, with profound implications for climate change, yet our knowledge regarding the biology of these important organisms leaves much to be desired. A key bottleneck that hinders the study of methanogenic archaea, especially those within the genus Methanosarcina, results from the time-consuming and often cumbersome tools that are currently available for genetic analysis of these microbes. The Cas9-mediated genome-editing approach for Methanosarcina acetivorans described in this study addresses this major constraint by streamlining the mutagenic process and enabling simultaneous introduction of multiple mutations. This work also sheds light on the distinct properties of homology-dependent repair and nonhomologous end-joining machinery in Archaea.

Keywords: Cas9, Archaea, methanogens, Methanosarcina, genetics

Abstract

Although Cas9-mediated genome editing has proven to be a powerful genetic tool in eukaryotes, its application in Bacteria has been limited because of inefficient targeting or repair; and its application to Archaea has yet to be reported. Here we describe the development of a Cas9-mediated genome-editing tool that allows facile genetic manipulation of the slow-growing methanogenic archaeon Methanosarcina acetivorans. Introduction of both insertions and deletions by homology-directed repair was remarkably efficient and precise, occurring at a frequency of approximately 20% relative to the transformation efficiency, with the desired mutation being found in essentially all transformants examined. Off-target activity was not observed. We also observed that multiple single-guide RNAs could be expressed in the same transcript, reducing the size of mutagenic plasmids and simultaneously simplifying their design. Cas9-mediated genome editing reduces the time needed to construct mutants by more than half (3 vs. 8 wk) and allows simultaneous construction of double mutants with high efficiency, exponentially decreasing the time needed for complex strain constructions. Furthermore, coexpression the nonhomologous end-joining (NHEJ) machinery from the closely related archaeon, Methanocella paludicola, allowed efficient Cas9-mediated genome editing without the need for a repair template. The NHEJ-dependent mutations included deletions ranging from 75 to 2.7 kb in length, most of which appear to have occurred at regions of naturally occurring microhomology. The combination of homology-directed repair-dependent and NHEJ-dependent genome-editing tools comprises a powerful genetic system that enables facile insertion and deletion of genes, rational modification of gene expression, and testing of gene essentiality.


The CRISPR (clustered regularly interspaced palindromic repeats) array and associated cas genes are widespread in microbial genomes (1), where they confer acquired immunity to phage and foreign DNA elements (2). The type IIA system from Streptococcus pyogenes is especially well characterized and has been widely applied as a remarkably effective genome-editing tool (3). During genome editing, heterologous expression of the RNA-guided DNA endonuclease Cas9 and a chimeric single-guide (sg) RNA, comprised of a 20-bp spacer that targets the chromosome and an 80-bp scaffold that binds Cas9, leads to a lethal double-strand break (DSB) at all target sites within the genome that are flanked by a 3′ NGG protospacer adjacent motif (PAM) (4) (Fig. S1). In eukaryotes, the nonhomologous end-joining (NHEJ) repair pathway can mend the DSB by generating simple insertions or deletions at the sgRNA target site, thus preventing additional rounds of Cas9-mediated cleavage (3, 5). Alternatively, the native homology-dependent repair (HDR) pathway can repair the fatal DSB, so long as a repair template that modifies or removes the sgRNA target site is provided, again preventing additional rounds of Cas9-mediated cleavage (3, 5) (Fig. S1). Appropriately designed repair templates allow recovery of strains with precise insertions and deletions, allowing unprecedented ability to manipulate the genomes of these diploid (or polyploid) organisms (6). Although Cas9-mediated genome editing has been successfully and broadly implemented in eukaryotes (3), similar progress has not been achieved in prokaryotes, with Cas9-mediated genome editing having been demonstrated in only 10 bacterial genera (7–10); to our knowledge, it has not been applied in archaea.

Fig. S1.

Fig. S1.

An overview of Cas9-mediated genome editing. Heterologous expression of Cas9 from Streptococcus pyogenes (gray) and a chimeric sgRNA, containing a 80-bp scaffold sequence to facilitate Cas9 binding (in pink) and a 20-bp spacer identical to a region on the host chromosome (in blue) flanked by a 3′ NGG PAM (in yellow) generates a DSB. In Archaea, HDR (in orange) is the prevalent mechanism for DSB repair and can be leveraged for genome editing by providing appropriate repair templates for targeted insertions, deletions, or allelic replacements.

Archaea have been recognized as a phylogentically distinct group since the 1990s (11) and it is now well-established that they are prevalent in many environments, often providing keystone ecosystem functions (12, 13). As a result, archaea play a major role in the biogeochemical cycling of nitrogen, sulfur, and carbon (13). Methanogenic archaea are particularly noteworthy from this standpoint. These microorganisms are widely distributed in strictly anaerobic environments, such as waterlogged rice paddies, sewage treatment plants, and the digestive systems of numerous animals (14), where they generate the overwhelming majority of methane released in the atmosphere. As such, it is not surprising that they have a significant impact on climate change and the global carbon cycle. Members of the genus Methanosarcina are among the most abundant and metabolically versatile methanogens known (15). They are also genetically tractable (16) and have emerged as important model organisms for genetic analysis of methanogen biology. Although the range of genetic techniques available for use in Methanosarcina is fairly comprehensive (16, 17), slow-growth and fastidious cultivation requirements have dramatically affected the pace of genetic studies within this genus.

With this in mind, we explored whether the Cas9-mediated genome-editing technique could increase the efficiency, efficacy, and speed of genetic analysis in Methanosarcina. Our results show that Cas9-mediated editing driven by the native HDR machinery in this archaeon is extremely rapid and efficient, even when multiple mutations are simultaneously introduced. Furthermore, although Methanosarcina species do not encode a native NHEJ pathway, coexpression of the NHEJ machinery from the closely related archaeon, Methanocella paludicola, along with the Cas9–sgRNA complex, allowed robust template-independent repair.

Results

Development of a Cas9-Dependent Genome-Editing System for Methanosarcina acetivorans.

To determine whether the appropriate components for genome editing from S. pyogenes are functional in M. acetivorans, we constructed a Methanosarcina/Escherichia coli shuttle vector that expresses the S. pyogenes Cas9 ORF from a tetracycline inducible Methanosarcina promoter (Fig. 1A). We also constructed a derivative of this plasmid that employs a methanol-inducible promoter to express an sgRNA that targets Cas9 to ssuC, a gene required for uptake of the methanogenesis inhibitor bromoethane sulfonic acid (BES) (18) (Fig. 1 A and B). M. acetivorans was readily transformed with the Cas9-only plasmid pDN206 (78,900 ± 9,940 PurR transformants); however, pDN208, which contains the ssuC-targeting sgRNA in addition to Cas9, produced only 4 ± 3 PurR transformants. This difference in plating efficiency of more than four orders-of-magnitude strongly suggests that Cas9 is not toxic by itself, but that the Cas9–sgRNA complex from S. pyogenes is capable of generating a lethal DSB in M. acetivorans. Similar results were obtained with and without the inducers methanol and tetracycline.

Fig. 1.

Fig. 1.

Cas9-mediated genome editing in M. acetivorans. (A) Key elements of the pDN_CRISPR plasmid series include the Cas9 ORF from S. pyogenes fused to the tetracycline-inducible PmcrB(tetO1) promoter (in green), sgRNA(s) fused to the methanol-inducible PmtaCB1 promoter (in pink), a homology repair template (in orange), and the entire pC2A plasmid replicon containing an autonomous Methanosarcina origin of replication (in gray). The puromycin transacetylase (pac) marker enables selection of puromycin resistant (PurR) transformants and the hypoxanthine phosphoribosyltransferase (hpt) marker facilitates plasmid curing by counter selection on medium containing 8ADP. Note: The E. coli replicon and resistance marker genes have not been shown. (B) Expression of sgRNA with a 20-bp target sequence identical to a region of the WT ssuC locus (in blue) flanked by a 3′ NGG PAM (in red) with Cas9 generates a DSB at the ssuC locus. A region of the plasmid pDN211 contains a homology repair (HR) template to abolish the target site by generating a 34-bp deletion and simultaneously introducing a diagnostic NotI restriction endonuclease site in the ssuC ORF (in orange). (C) The chromosomal ssuC locus amplified from 20 PurR transformants containing pDN211 as well as the parent strain (WWM60) and subjected to restriction digest with NotI. Upon digestion, 1.1-kbp and 1.3-kbp fragments are observed for all PurR transformants (lanes 2–21), whereas a single 2.4-kbp fragment corresponding to the WT locus is observed for WWM60 (lane 22).

Next, we determined the ability of the native HDR machinery in M. acetivorans to repair the lethal DSB generated by the sgRNA–Cas9 complex. To this end, repair templates of varying size were added to the ssuC-targeting vector. These repair templates generate a 34-bp deletion/frameshift mutation within ssuC that removes the targeting site while simultaneously introducing a diagnostic NotI restriction endonuclease site (Fig. 1B). Addition of repair templates with 1-kb homology arms to the plasmids relieved the lethal effect of targeting Cas9 to ssuC, generating nearly 20,000 PurR transformants per 2 μg DNA. A similar plasmid with 0.5-kbp homology arms generated roughly half as many transformants. Significantly, the 103-fold higher transformation efficiency for pDN211 relative to pDN208 indicated that 99.9% of the PurR transformants are likely to be mutants (i.e., only 1 of every 1,000 PurR transformants would still contain the WT locus). To validate this hypothesis, 20 of these transformants were genotyped by a performing a NotI digest of a PCR amplicon containing the edited ssuC locus: all tested positive for the introduced mutation (Fig. 1C). Furthermore, as expected for null mutations in the ssu locus, all 20 transformants were resistant to 0.4 mM BES, a concentration lethal to the parent strain. Genome editing was also observed when plasmids were integrated into the chromosome using a ΦC31 integrase system (17).

The initial gene-edited strains produced in these experiments retain the targeting machinery; thus, we constructed plasmid derivatives that include a counter selectable marker (hpt) to facilitate curing of gene-editing vector. This marker confers sensitivity to the purine analog 8-aza-2,6-diaminopurine (8ADP) in strains that lack the native hpt gene (19). To validate the plasmid curing system, which has not previously been attempted in Methanosarcina, we selected 8ADPR clones from three independent PurR transformants constructed using the counter selectable vectors. All 8ADPR isolates analyzed were PurS and also contain the frameshift mutation at the ssuC locus (Fig. S2A). PCR-based screening with plasmid-specific primers showed that the vector was indeed cured from these strains (Fig. S2B). These proof-of-principle experiments show that a Cas9-mediated genome editing technique can be used to effectively introduce unmarked mutations in M. acetivorans.

Fig. S2.

Fig. S2.

Using the counter-selectable hpt marker to cure plasmids containing the genome editing machinery. (A) Growth curves for three independent puromycin-resistant (PurR) transformants (blue) and an 8ADPR isolate derived from each PurR parent (red) in liquid medium containing TMA hydrochloride as the growth substrate and 2 μg/mL puromycin. PurR transformants contain pDN211 in the WWM60 strain background. A 1:10 dilution of stationary-phase cultures grown in liquid medium containing TMA as the growth substrate was inoculated for growth measurement. (B) Primers to amplify the repA gene in pC2A (approximately 1 kbp) were used to screen for the presence of the plasmid containing the genome editing machinery in each of the three PurR parents (lanes 2–4) and 8ADPR isolates (lanes 5–7). The plasmid pDN211 was used as a positive control (lane 8) and the parent strain WWM60 was used as a negative control (lane 9).

Optimization of the Cas9-Dependent Genome-Editing Technique in M. acetivorans.

To determine the optimal expression levels for the genome-editing machinery, we varied the transcription of Cas9 by selecting transformants on media with increasing concentrations of tetracycline, and of the sgRNA by plating on media with either methanol (induced) or trimethylamine (TMA; repressed) as growth substrates. Surprisingly, no significant difference in genome-editing efficiency was observed (Fig. 2A). In fact, the basal level of transcription provided by the two promoters in the absence of the inducers was sufficient for effective editing (Fig. 2A). A control vector identical to pDN211 but lacking the sgRNA (pDN207) was used to estimate the efficiency of genome editing. The efficiency of genome editing was measured as the ratio of mutant recovery (i.e., plating efficiency of pDN211) relative to the plating efficiency of the control vector and was estimated on media with either methanol or TMA as growth substrates. Significantly, genome editing in these experiments was particularly efficient, with edited strains being obtained at frequencies of approximately 20–25% relative to the control (i.e., one in four cells that receive the plasmid undergo gene conversion) (Fig. 2B).

Fig. 2.

Fig. 2.

Optimization of Cas9-mediated genome editing in M. acetivorans. (A) A dose–response curve showing the relative transformation efficiency of pDN211 for different expression levels of Cas9 and the sgRNA. Transformants were plated on solid medium containing either TMA hydrochloride (sgRNA uninduced; in blue) or methanol (sgRNA induced; in green) as the growth substrate with tetracycline concentrations ranging from 0 to 64 μg/mL, as indicated. (B) Mean transformation efficiencies of pDN211 and pDN207 (a control vector that lacks the sgRNA targeting ssuC). (C) Mean transformation efficiencies of plasmids containing repair templates placed at variable distance from the sgRNA-directed DSB for ssuC. Values above each column represent the fraction of transformants for the corresponding plasmid that tested positive for the desired mutation by a PCR-based screen. The error bars represent one SD of the mean transformation efficiency for three independent transformation reactions. All transformations were plated on medium lacking tetracycline with TMA as the growth substrate.

To examine the maximum size of deletions that can be reliably generated by a single sgRNA, we tested repair templates with 1-kb homology arms placed at varying distance from the sgRNA-directed DSB (Fig. 2C). The transformation efficiency remained steady for templates that are ≤250 bp away from each end of the DSB, but declined precipitously when the distance increased beyond this point (Fig. 2C). Thus, a single sgRNA can be reliably used to delete up to 0.5 kbp of the chromosome, although larger deletions (up to 1 kbp) can be produced at the expense of efficiency.

Multiplex Expression of sgRNAs in M. acetivorans Enables Simultaneous Introduction of Multiple Mutations.

To explore the possibility of using multiple Cas9-mediated DSBs to create larger deletions, or to simultaneously introduce more than one mutation, we tested two alternate arrangements for the expression of multiple sgRNAs. In the first arrangement, sgRNAs were expressed individually, whereas in the second they were expressed as a single transcript separated by a 30-bp linker sequence (Fig. 3A). Plasmids with sgRNAs in either arrangement were equally efficient in generating strains with complete deletions (approximately 2 kbp) of the mtmCB1 and mtmCB2 loci, which are highly homologous genes encoding monomethylamine methyltransferase isozymes (Fig. 3B and Fig. S3). Thus, to reduce the size of mutagenic plasmids and simultaneously simplify their design, the placement of sgRNAs on a single transcript was preferred. Subsequently, we generated a plasmid containing all four sgRNAs and each of the corresponding repair templates to simultaneously delete mtmCB1 and mtmCB2 (Fig. S4). Surprisingly, transformants that simultaneously acquired both the ΔmtmCB1 and ΔmtmCB2 mutation were obtained at the same frequency as transformants that acquired only one of two mutations (Fig. 3C). Furthermore, the genomes of two random, independent isolates each for the ΔmtmCB1, ΔmtmCB2, and ΔmtmCB1ΔmtmCB2 mutants were completely sequenced and no off-target activity was detected (Table S1). This finding is especially notable given the high levels of homology between the sgRNA target sites in the two genes (Fig. S5). Hence, Cas9-mediated genome editing is remarkably precise in M. acetivorans.

Fig. 3.

Fig. 3.

Simultaneous expression of multiple sgRNAs and generation of multiple mutations in M. acetivorans. (A) Two configurations for the expression of multiple sgRNAs were tested: in configuration one each sgRNA contains an individual promoter, whereas in configuration two a single promoter drives the expression of multiple sgRNAs separated by a 30-bp linker sequence. (B) Mean transformation efficiency of plasmids with sgRNAs in configuration one (light gray) or two (dark gray) configurations to delete either mtmCB1 or mtmCB2. Note: two independent transformation reactions were performed per plasmid. (C) Mean transformation efficiencies of plasmids to generate either ΔmtmCB1 (green), ΔmtmCB2 (blue), or ΔmtmCB1ΔmtmCB2 (purple) simultaneously. The error bars represent one SD of the mean transformation efficiency for three independent transformation reactions. All transformations were plated on medium lacking tetracycline with methanol as the growth substrate.

Fig. S3.

Fig. S3.

Genomic context of the isozymes encoding the monomethylamnie specific methyltransferases (mtmCB1 and mtmCB2) in Methanosarcina acetivorans. The genes encoding the corrinoid proteins MtmC1 and MtmC2 share 89% amino acid identity, whereas the genes encoding the methyltransferase MtmB1 and MtmB2 share 95% amino acid identity. The orange and pink arrows indicate the location of the two sgRNAs used to generate an in-frame deletion.

Fig. S4.

Fig. S4.

Plasmid map of pDN237. The plasmid pDN237 contains the appropriate sgRNAs and homology repair templates to generate in-frame deletions in mtmCB1 and mtmCB2 simultaneously. The plasmid map was generated using Geneious version R9.

Table S1.

List of mutations in genome-edited strains containing in-frame deletions in mtmCB1 and/or mtmCB2

Position Mutation WWM984 WWM985 WWM986 WWM987 WWM988 WWM989 Notes
171197 Δ1,989 bp Yes Yes No No Yes Yes ΔmtmCB1
487691 C added Yes Yes Yes Yes Yes Yes Present in WWM60
736484 A→G (Y10Y) No No No No Yes No Unique to WWM988
941168 A5→6 Yes Yes Yes Yes Yes Yes Present in WWM60
1314120 Δ1 bp Yes Yes Yes Yes Yes Yes Present in WWM60
1912669 C→T (P7S) No Yes No No No No Unique to WWM985
2086881-82 TC→CT Yes Yes Yes Yes Yes Yes Present in WWM60
2086886 G→T Yes Yes Yes Yes Yes Yes Present in WWM60
2412860 G→T (P107H) No Yes No No No No Unique to WWM985
2534543 C added Yes Yes Yes Yes Yes Yes Present in WWM60
2836646 A→G (F64L) Yes Yes Yes Yes Yes Yes Present in WWM60
2867059 T→G (H313Q) Yes Yes Yes Yes Yes Yes Present in WWM60
3433201 Δ1 bp Yes Yes Yes Yes Yes Yes Present in WWM60
3638887 G→A (Y525Y) Yes No No Yes No Yes Present in WWM60
3707136 Δ1,633 bp No No Yes Yes Yes Yes ΔmtmCB2
4295452 Δ1 bp Yes Yes Yes Yes Yes Yes Present in WWM60
4874567 Δ1 bp Yes Yes Yes Yes Yes Yes Present in WWM60
4945345 C added Yes Yes Yes Yes Yes Yes Present in WWM60
5078585 G→A (M1M) Yes Yes Yes Yes Yes Yes Present in WWM60

Fig. S5.

Fig. S5.

Homology between target sequences for mtmCB1 and mtmCB2. (A) Alignment of the spacer and the PAM (underlined) for mtmB1 and mtmC1 with the corresponding regions in the mtmB2 and mtmC2 CDS, respectively. (B) Alignment of the spacer and the PAM (underlined) for mtmB2 and mtmC2 with the corresponding regions in the mtmB1 and mtmC1 CDS.

Insertion of Large DNA Segments via Cas9-Dependent Genome Editing.

To assess the efficacy of gene knockins, plasmids designed to insert either a 3.05-kbp fragment containing the mtmCB1 locus or a 2.53-kbp fragment containing the mtmCB2 locus were constructed and used to introduce WT copies of each gene into the ssuC gene of the ΔmtmCB1ΔmtmCB2 double mutant (Fig. S6). Although 20–60% fewer transformants were observed (relative to the simple 34-bp deletion mutation described above), all transformants screened contain the desired gene insertions.

Fig. S6.

Fig. S6.

Design of repair templates for Cas9-mediated gene insertions at the ssuC locus in M. acetivorans. (A) Homology repair template to insert the mtmCB1 operon (green) and an 840-bp region upstream (likely to contain the putative promoter) within the ssuC CDS. (B) Homology repair template to insert the mtmCB2 operon (blue) and a 390-bp region upstream (likely to contain the putative promoter) within the ssuC CDS.

A Cas9-Dependent Genetic Screen to Test for Gene Essentiality.

Two methods have previously been used to test gene essentiality in Methanosarcina (17, 20); however, both approaches are laborious and time-consuming. We therefore sought to use the efficient repair of the DSB generated by the Cas9–sgRNA complex to assay gene essentiality in M. acetivorans. For nonessential genes (ssuC, mtmCB1, mtmCB2), 103- to 104-fold more transformants are consistently observed when a repair template to generate a deletion is provided in addition to the sgRNA–Cas9 complex. We expected that this would not be true for essential genes, because HDR-directed repair using a deletion cassette would also be lethal. To test this idea, we constructed plasmids, with and without a repair template, that target the previously established essential genes mcrA and hdrED (17, 21). In contrast to the results with the nonessential ssuC, mtmCB1 and mtmCB2 loci, where we obtained thousands of transformants in the presence of a repair template, plasmids that targeted the essential genes generated fewer than five transformants, regardless of whether a repair template is present (Table 1). Thus, the ratio of transformants obtained in the presence versus absence of a repair template can be used as a reliable and simple test for gene essentiality in M. acetivorans.

Table 1.

Using Cas9-mediated genome editing as a screen for gene essentiality in M. acetivorans

Gene/operon Transformation efficiency of plasmids with genome editing machinery
Repair template absent Repair template present
ssuC 4 ± 3 19,040 ± 4,255
mtmCB1 <1 4,033 ± 716
mtmCB2 Not tested 5,300 ± 235
mcrA 2 ± 1 <1
hdrED <1 0

Transformation efficiencies indicate the mean ± 1 SD of puromycin resistant colonies for three independent transformations.

Heterologous Expression of NHEJ Genes Leads to Template-Independent Repair in M. acetivorans.

A lethal phenotype for plasmids expressing a Cas9–sgRNA complex in the absence of a repair template was uniformly observed across a wide range of sgRNAs tested in this study, suggesting that NHEJ does not occur in M. acetivorans (Table 1). This result is consistent with the absence of genes related to Ku and LigD in the completely sequenced genome (22). Nevertheless, in some circumstances HDR-independent gene editing would be very useful. Therefore, we examined whether NHEJ could be established in Methanosarcina for use in conjunction with the Cas9–sgRNA complex. For this purpose, we chose the NHEJ machinery from the closely related methanogen M. paludicola, which has previously been reconstituted in vitro (23, 24). An artificial operon encoding four M. paludicola NHEJ proteins [DNA ligase (Lig), polymerase (Pol), phosphoesterase (PE), and Ku] was synthesized and transcriptionally fused to the moderately expressed serC promoter (25) to allow transcription in M. acetivorans (Fig. S7). This cassette was then added to the Cas9 ssuC-targeting vector without a repair template. Transformation with this plasmid was approximately 100-fold less efficient than the corresponding HDR vector, but approximately 10-fold higher than with plasmids lacking the NHEJ system (Fig. 4A). Therefore, expression of the M. paludicola NHEJ machinery overcame the lethal effect of the Cas9 ssuC-targeting vector without a repair template. Molecular analysis of the ssuC locus in these transformants revealed deletions ranging from 75 bp to 2.7 kb in length, often occurring at naturally occurring regions of microhomology 6–11 bp in length (Fig. 4B). Thus, the combined Cas9/NHEJ system provides the opportunity to generate a variety of mutations surrounding a single target site. Importantly, these plasmids are much simpler to construct, requiring only addition of target-specific sgRNA. We also tested whether addition of two sgRNAs targeting DNA sequences approximately 450 bp apart in conjunction with NHEJ could be used to generate precise deletions without a repair template. Interestingly, attempts to construct ssuC deletions via this method were not successful: only a handful of colonies were obtained (6 ± 3 per 2 μg plasmid) and none had the precise deletion desired. We examined 20 transformants obtained by this method. Two contained a 1.3-kb deletion of the ssuC locus, which occurred at a region of microhomology (Fig. 4B). The remainder had WT copies of the ssuC gene and, thus, are likely to be so-called escape mutants in which the Cas9 gene or sgRNA has mutated on the targeting plasmid (26).

Fig. S7.

Fig. S7.

Heterlogous expression of the NHEJ genes from Methanocella paludicola. Design of a 3.25-kbp artificial operon with the NHEJ polymerase (Mcp_2125), DNA ligase (Mcp_2126), phosphoesterase (Mcp_2127), and Ku (Mcp_0581) genes from M. paludicola SANAE fused to the Methanosarcina barkeri Fusaro serC promoter and followed by the M. acetivorans Mcr terminator.

Fig. 4.

Fig. 4.

Coexpression of NHEJ genes with the Cas9-sgRNA complex in M. acetivorans. (A) Transformation efficiency of plasmids with a sgRNA targeting the ssuC locus containing either a repair template for HDR-mediated DSB repair, the NHEJ genes, or no repair template. The error bars represent one SD of the mean transformation efficiency for three independent transformation reactions. All transformations were plated on medium lacking tetracycline with TMA as the growth substrate. (B) Regions of naturally occurring microhomology surrounding the ssuC locus at which NHEJ-mediated deletions were observed in PurR transformants.

Discussion

The Cas9-based tools developed in this study will have a transformative impact on the speed, scope, and scale of research that can be accomplished in the methanogenic archaeon, M. acetivorans. Most notably, multiplexed gene-editing plasmids will enable generation of strains with multiple mutations, ranging from SNPs to large indels, in a matter of weeks versus years. These tools will enable researchers to swiftly tag genes at their native loci on the host chromosome, allowing the study of context-specific gene expression, “pull-down” experiments to establish protein–protein and protein–DNA interaction networks, and purification of proteins that contain unique amino acids (27) or novel posttranslational modifications (28). Furthermore, deleting a gene of interest using the NHEJ-based technique is very cost-effective, as it simply requires the insertion of a commercially synthesized DNA fragment containing the appropriate sgRNAs into pDN243, the vector containing Cas9 and the NHEJ machinery. Thus, studies that were previously inconceivable, such as constructing a library of strains with single-gene deletions in every nonessential gene on the M. acetivorans chromosome [as described in Wang et al. (29)], will now become feasible, in terms of both time and cost. Finally, we expect that minor modifications will enable the application of this approach to a broad range of methanogens and other archaea.

Certain features of Cas9-mediated genome editing in M. acetivorans are particularly unique and noteworthy. For example, unlike eukaryotes (30), targeting of the Cas9–sgRNA complex to a particular chromosomal region in M. acetivorans is remarkably precise, as no off-target activity was observed upon resequencing multiple, independent genome-edited mutants (Table S1). Because the M. acetivorans genome (approximately 5.75 Mbp) is 10- to 100-fold smaller in comparison with eukaryotic genomes, it is possible that fewer off-target sites are present. However, no off-target activity could be detected, despite our intentional choice of highly similar sgRNA targets in the mtmCB isozymes (Fig. S5). Thus, it is likely that properties of the Cas9–sgRNA complex, including target specificity, vary significantly across domains of life, perhaps because of differences in chromosomal organization and DNA repair machinery. Notably, unlike the Cas9-mediated genome editing in bacteria (7–9), we observe a high rate of HDR for the Cas9-mediated DSB and a very low frequency of “escape” mutants. These key distinctions are likely to stem from evolutionarily distinct HDR machinery. Archaeal DNA repair involves homologs of the eukaryotic proteins Mre11 and Rad50, and two other unique proteins HerA and NurA, which perform end-resection after a DSB occurs (31). Subsequently, the RecA orthologs RadA and RadB, again more closely related to recombination proteins of eukaryotes, mediate strand invasion (31). Finally, Hjc, unrelated to the RuvABC complex in bacteria (32), is involved in the resolution of the Holliday junction (31). Thus, it is tempting to speculate that coexpression of archaeal HDR machinery along with Cas9 might overcome some of the obstacles that have been reported in recent bacterial work (7–9).

We observed similar host-specific effects upon heterologous expression of the NHEJ machinery from M. paludicola in M. acetivorans. These archaeal proteins have biochemical activities that are strikingly similar to the well-characterized bacterial Ku and LigD of Mycobacterium tuberculosis (33). Thus, we were somewhat surprised by the robust template-independent repair they conferred when coexpressed with the Cas9–sgRNA complex in M. acetivorans (Fig. 4A). These data are in sharp contrast to a recent study in which coexpression of Ku and LigD from M. tuberculosis did not rescue the Cas9-mediated DNA break in E. coli (34). Furthermore, we observed that template-independent DNA repair happens at naturally occurring regions of microhomology (ranging from 6 to 11 bp), which supports a recent hypothesis that the archaeal NHEJ pathway conduct microhomology-mediated end joining (MMEJ) in vivo (24). Thus, we expect that in addition to its application as a means of generating random site-specific mutations in M. acetivorans, this tool can also be used to dissect the archaeal MMEJ machinery in vivo. In this context, we note that no particular sequence pattern or any distinct signature (GC content, nucleotide frequency) could be inferred from the regions of microhomology at which repair occurred (Fig. 4B). Moreover, DNA repair mediated by MMEJ is almost completely abolished when two sgRNAs were simultaneously expressed, suggesting that the repair mechanism has the ability to distinguish breaks that occur at discrete loci.

Finally, one might ask why we chose to use the well-established S. pyogenes Cas9–sgRNA complex for genome-editing purposes over the native type I or type III CRISPR/Cas systems that are commonly found in Methanosarcina spp. (35), as was done in Sulfolobus islandicus (36). First, the CRISPR/Cas subtypes vary significantly across the genus Methanosarcina, even within strains belonging to the same species (35). Hence a genome-editing technique reliant on the native CRISPR/Cas machinery for one strain might not work in other closely related strains. Recent studies across a wide-range of bacteria have revealed that anti-CRISPR proteins to silence the native CRISPR/Cas system are also often encoded on the chromosome (37). Although no anti-CRISPR proteins have been detected in Methanosarcina, it is possible that they exist and might potentially complicate use of the native CRISPR/Cas machinery for genome editing. Finally, tweaking the native CRISPR/Cas machinery for genome editing purposes is likely to impact organismal physiology in an unpredictable fashion and skew genetic analyses downstream. Thus, we chose to deploy the simple, modular Cas9-mediated genome editing machinery on a vector that will be transiently maintained in M. acetivorans.

Materials and Methods

Strains, Media, and Growth Conditions.

All chemicals were purchased from Sigma-Aldrich unless otherwise specified. M. acetivorans strains were grown in single-cell morphology (38) at 37 °C in bicarbonate-buffered high-salt (HS) liquid medium containing 125 mM methanol or 50 mM TMA hydrochloride in Balch tubes with N2/CO2 (80/20). Plating solid medium was conducted in an anaerobic glove chamber (Coy Laboratory Products) as described previously (25). Solid media plates were incubated in an intrachamber anaerobic incubator maintained at 37 °C with N2/CO2/H2S (79.9/20/0.1) in the headspace, as described previously (39). Puromycin (CalBiochem), the purine analog 8ADP (R. I. Chemicals) and BES were added to a final concentration of 2 μg/mL, 20 μg/mL, 0.4 mM, respectively, from sterile, anaerobic stock solutions. Anaerobic, sterile stocks of tetracycline hydrochloride in deionized water were prepared fresh shortly before use and added to a final concentration as indicated. E. coli strains were grown in LB broth at 37 °C with standard antibiotic concentrations. WM4489, a DH10B derivative engineered to control copy-number of oriV-based plasmids (40), was used as the host strain for all plasmids generated in this study (Table S2). Plasmid copy number was increased by adding sterile rhamnose to a final concentration of 10 mM.

Table S2.

List of plasmids used in this study

Plasmid Features Source
pAMG40 Vector for fosmid retrofitting that contains pC2A and λattB (17)
pJK027A Vector with PmcrB(tetO1) promoter fusion to uidA that contains φC31-attB and λattP (17)
pMJ806 pET-based vector that contains the native Spy cas9 ORF (4)
pDN201 pJK027A-derived plasmid with PmcrB(tetO1) promoter fusion to Spy cas9 Present study
pDN202 pDN201-derived plasmid with ssuC repair template containing 0.5-kb homology flanks Present study
pDN203 pDN201-derived plasmid with a synthetic fragment containing PmtaCB1 promoter fusion to a sgRNA targeting ssuC Present study
pDN204 pDN203-derived plasmid with ssuC repair template containing 0.5-kb homology flanks Present study
pDN206 Cointegrate of pDN201 and pAMG40 Present study
pDN207 Cointegrate of pDN202 and pAMG40 Present study
pDN208 Cointegrate of pDN203 and pAMG40 Present study
pDN209 Cointegrate of pDN204 and pAMG40 Present study
pDN210 pDN203-derived plasmid with ssuC repair template containing 1-kb homology flanks Present study
pDN211 Cointegrate of pDN210 and pAMG40 Present study
pDN215 pDN203-derived plasmid with ssuC repair template containing 1-kb homology flanks that are 100 bp from each end of the sgRNA-directed DSB Present study
pDN216 pDN203-derived plasmid with ssuC repair template containing 1-kb homology flanks that are each 250 bp from each end of the sgRNA-directed DSB Present study
pDN217 pDN203-derived plasmid with ssuC repair template containing 1-kb homology flanks that are each 500 bp from each end of the sgRNA-directed DSB Present study
pDN218 Cointegrate of pDN215 and pAMG40 Present study
pDN219 Cointegrate of pDN216 and pAMG40 Present study
pDN220 Cointegrate of pDN217 and pAMG40 Present study
pDN221 pDN201-derived plasmid with two synthetic fragments: one containing PmtaCB1 promoter fusion to sgRNA targeting mtmB1 and another containing PmtaCB1 promoter fusion to sgRNA targeting mtmC1 Present study
pDN222 pDN201-derived plasmid with two synthetic fragments: one containing PmtaCB1 promoter fusion to sgRNA targeting mtmB1 and another with a 30-bp linker sequence and a sgRNA targeting mtmC1 Present study
pDN223 Cointegrate of pDN221 and pAMG40 Present study
pDN224 Cointegrate of pDN222 and pAMG40 Present study
pDN225 pDN221-derived plasmid with a repair template with 1-kb homology flanks to delete mtmCB1 Present study
pDN226 pDN222-derived plasmid with a repair template containing 1-kb homology flanks to delete mtmCB1 Present study
pDN227 Cointegrate of pDN225 and pAMG40 Present study
pDN228 Cointegrate of pDN226 and pAMG40 Present study
pDN229 pDN201-derived plasmid with a repair template containing 1-kb homology flanks to delete mtmCB2 Present study
pDN230 pDN229-derived plasmid with two synthetic fragments: one containing PmtaCB1 promoter fusion to sgRNA targeting mtmC2 and another containing PmtaCB1 promoter fusion to sgRNA targeting mtmB2 Present study
pDN231 pDN229-derived plasmid with two synthetic fragments: one containing PmtaCB1 promoter fusion to sgRNA targeting mtmC2 and another containing a linker sequence and a sgRNA targeting mtmB2 Present study
pDN232 Cointegrate of pDN230 and pAMG40 Present study
pDN233 Cointegrate of pDN231 and pAMG40 Present study
pDN234 pDN225-derived plasmid with a region from pDN230 containing the mtmCB2 repair template and sgRNAs Present study
pDN235 pDN226-derived plasmid with a region from pDN231 containing the mtmCB2 repair template and sgRNAs Present study
pDN236 Cointegrate of pDN234 and pAMG40 Present study
pDN237 Cointegrate of pDN235 and pAMG40 Present study
pDN238 pDN203-derived plasmid with a repair template to insert a 3.05-kbp fragment encoding mtmCB1 within the ssuC CDS Present study
pDN239 Cointegrate of pDN238 and pAMG40 Present study
pDN240 pDN203-derived plasmid with a repair template to insert a 2.53-kbp fragment encoding mtmCB2 within the ssuC CDS Present study
pDN241 Cointegrate of pDN240 and pAMG40 Present study
pDN242 pDN203-derived plasmid containing a PserC promoter fusion to all four NHEJ genes from M. paludicola Present study
pDN243 Cointegrate of pDN242 and pAMG40 Present study
pDN254 pDN201-derived plasmid with two synthetic fragments: one containing PmtaCB1 promoter fusion to sgRNA targeting ssuC and another containing a linker sequence and a second sgRNA targeting ssuC 450 bp away from the cut-site of the first sgRNA Present study
pDN255 pDN254-derived plasmid containing a PserC promoter fusion to all four NHEJ genes from M. paludicola Present study
pDN256 Cointegrate of pDN254 and pAMG40 Present study
pDN257 Cointegrate of pDN255 and pAMG40 Present study
pDN258 pDN201-derived plasmid with two synthetic fragments: one containing PmtaCB1 promoter fusion to one sgRNA targeting mcrA and another containing a linker sequence and a second sgRNA targeting mcrA 1.4 kbp away from the first sgRNA Present study
pDN259 pDN258-derived plasmid with a repair template containing 1-kb homology flanks to delete mcrA Present study
pDN260 Cointegrate of pDN258 and pAMG40 Present study
pDN261 Cointegrate of pDN259 and pAMG40 Present study
pDN268 pDN201-derived plasmid with two synthetic fragments: one containing PmtaCB1 promoter fusion to sgRNA targeting hdrE and another containing a linker sequence and a sgRNA targeting hdrD Present study
pDN269 pDN258-derived plasmid with a repair template containing 1kb homology flanks to delete hdrED Present study
pDN270 Cointegrate of pDN268 and pAMG40 Present study
pDN271 Cointegrate of pDN269 and pAMG40 Present study

Plasmids.

All plasmids used in this study are listed in Table S2. The plasmid pMJ0806 was obtained from Jennifer Doudna, University of California, Berkeley, CA (Addgene plasmid # 39312). The S. pyogenes (Spy) Cas9 ORF was fused to the PmcrB(tetO1) promoter in pJK027A (17), and linearized with NdeI and HindIII by the Gibson assembly method, as described previously (41). The DNA segments containing sgRNA flanked by putative mtaCB1 promoter and terminator sequences from M. acetivorans were synthesized as double-stranded DNA fragments (“gBlocks”) from Integrated DNA Technologies and used for cloning purposes per the manufacturer’s instructions. A 3.25-kbp artificial operon with the NHEJ polymerase (Mcp_2125), DNA ligase (Mcp_2126), phosphoesterase (Mcp_2127), and Ku (Mcp_0581) genes from M. paludicola SANAE fused to the Methanosarcina barkeri Fusaro serC promoter was ordered from the GeneArt gene synthesis service (Life Technologies). All synthetic DNA fragments and repair templates were introduced in the appropriate vector backbone linearized with either AscI or PmeI by the Gibson assembly method, as described previously (41). The entire pC2A plasmid was introduced in the appropriate pJK027A-derived vector (carrying the λattB site) by retrofitting with pAMG40 (carrying the λattP site) using the BP Clonase II master mix (Invitrogen) per the manufacturer’s instructions. WM4489 was transformed by electroporation at 1.8 kV using an E. coli Gene Pulser (Bio-Rad). Standard techniques were used for the isolation and manipulation of plasmid DNA. All pJK027A-derived plasmids were verified by Sanger sequencing at the Roy J. Carver Biotechnology Center, University of Illinois at Urbana–Champaign, and all pAMG40 cointegrates were verified by restriction endonuclease analysis. Primers used in this study are listed in Table S3. The plasmid sequence and annotations for pDN211 have been submitted to GenBank (accession no. KY436376).

Table S3.

List of primers used in this study

Primer Sequence (underlined region indicates overhangs for Gibson assembly)
Cas9_f TTTTAATAAATTAAGGAGGAAATTCATATGGATAAGAAATACTCAATAGGCT
Cas9_r CATACATTATACGAAGTTATCAAGAAGCTTTCAGTCACCTCCTAGCTGACT
ssuC_ds_f (500 bp) TCCTTTTGGAGCCTTTTTTTTTCGAAGTTTAAACATC CAT CCT GTG CAG GTA GT
ssuC_ds_r (500 bp) GCGGCCGC GAA TAA ATT GCT TCT TCC GAG T
ssuC_us_f (500 bp) TCTCCTCCGATTGTTTTTAAAGGCGGCCGC GGC GAT TGC GAA TAT AAG AGA
ssuC_us_r (500 bp) GGCCGCGATCGCCGGCGCGCCTGCAGGTTTAAACGC AAT GGA CGT TCG ATT GTA
ssuC_ds_f (1,000 bp) TCCTTTTGGAGCCTTTTTTTTTCGAAGTTTAAACGGC GAT TGC GAA TAT AAG AG
ssuC_ds_r (1,000 bp) GCGGCCGC AGC TGA ACT TCG GCT ATC AG
ssuC_us_f (1,000 bp) GGGTACTCGGCTGATAGCCGAAGTTCAGCTGCGGCCGCTAC GAA GAT AGA TAC GGC CAG
ssuC_us_r (1,000 bp) GGCCGCGATCGCCGGCGCGCCTGCAGGTTTAAACCGA TGG CAT CTA TAA GGC TG
mtmCB1_ds_f GGACGCATCGTGGCCGGATCTTGCGGCCGCAGT ACC GAA CAT AGA TAG AG
mtmCB1_ds_r CTT GTA TTC TAA GCC GAA AG
mtmCB1_us_f TCAGGTCGAACTTTCGGCTTAGAATACAAGATT TTG AGT TGC GAT CGC GTT G
mtmCB1_us_r CGATACCGTCAAAACTTCATTTTTAATTTTTGCGGCCGCAGC GCC AAT CTC CAG AAA ATG
mtmCB2_us_f CCTTTTGGAGCCTTTTTTTTTCGAAGTTTAAACCAT CTG TCC TCA TGC AAG GTG
mtmCB2_us_r CCTATTGACATTATCACAAAGGGCCTCTCCGTT GCC TCA GCA AAG GGT GTT G
mtmCB2_ds_f GTT GCC TCA GCA AAG GGT GTT G
mtmCB2_ds_r GCCGCGATCGCCGGCGCGCCTGCAGGTTTAAACCTC CCT ACC AAT CTC CGA TAA CC
mtmCB1_repair_sgRNAs_f TGGTTACCCAGGCCGTGCCGGCACGTTAACCAT CTG TCC TCA TGC AAG GTG C
mtmCB1_repair_sgRNAs_r CACACTTGCATCGGATGCAGCCCGGTTAACTAC ATG AGG GCT GAA AAG CCG
mcrA_ds_f CCTTTTGGAGCCTTTTTTTTTCGAAGTTTAAACATT CTC TCC TCT GGC AGA ACA G
mcrA_ds_r GT CAT CCC GGC AAA ATA AAC
mcrA_us_f GATTTATTGAGTTTATTTTGCCGGGATGACCAT CGG GTT GTA GAA TGC AAT G
mcrA_ds_r GATGTTGTTGGCGCGCCTGCAGGTTTAAACGTC CCA GGG ATA AAC TAA ATT C
hdrED_us_f CCTTTTGGAGCCTTTTTTTTTCGAAGTTTAAACATG GCT GTT TCA GGT TGT CC
hdrED_us_r GAA GTA TGC CAT CTC ACT GC
hdrED_ds_f TAAATTATTAGCAGTGAGATGGCATACTTCTCG GGC TCA GCG TAG AGT AAC
hdrED_ds_r GATGTTGTTGGCGCGCCTGCAGGTTTAAACCGC ATA CAA TGA GGG GCA AGG

In Silico Design of Target Sequences.

All target sequences used in this study are listed in Table S4. Target sequences were designed using the CRISPR site finder tool in Geneious version R9 (42). The M. acetivorans chromosome and the plasmid pC2A were used to score off-target binding sites.

Table S4.

List of target sequences used in this study

Gene (locus tag) Target sequence (+ PAM) Position on M. acetivorans chromosome
ssuC (MA0064) ATC CGC TGC AAA CTG CCA TA TGG 73479–73498 (+ strand)
ssuC (MA0064) CTG AGG GAA TCG CAA CAA AA CGG 73037–73056 (+ strand)
mtmC1 (MA0145) AGGT TGC GCA CAG TTA GCC C AGG 173167–173186 (− strand)
mtmB1 (MA0144) AAG GAA GAA GCT CGA AGA CC TGG 171211–1721230 (− strand)
mtmC2 (MA2971) CTG AGG CAG AAA GAT CTC TG CGG 3707170–3707189 (− strand)
mtmB2 (MA2972) GAG GAG GCA CAT CTC CGT AC CGG 3708692–3708711 (− strand)
mcrA (MA4546) TGA ACT CTC TGA TGG CAC CG CGG 5596716–5596735 (+ strand)
mcrA (MA4546) GAT TGC ACG CTG ACC GAG AG GGG 5598139–5598158 (+ strand)
hdrD (MA0688) GAG AGT CAC GAC CAT CCA TA AGG 805287–805306 (− strand)
hdrE (MA0687) TTA TCT GGA CAA ACG TCA GT CGG 803399–803418 (− strand)

Transformation of M. acetivorans.

All M. acetivorans strains used in this study are listed in Table S5. Liposome-mediated transformation was used for M. acetivorans, as described previously(43), and 10 mL of late-exponential phase culture of M. acetivorans and 2 μg of plasmid DNA were used for each transformation.

Table S5.

List of Methanosarcina acetivorans strains used in this study

Strain Genotype Construction details Source
WWM60 Δhpt::PmcrB-tetR — (17)
WWM984 Δhpt::PmcrB-tetR, ΔmtmCB1 WWM60 was transformed to PurR with pDN227; plasmid-cured strain was isolated by plating on medium with 8ADP Present study
WWM985 Δhpt::PmcrB-tetR, ΔmtmCB1 WWM60 was transformed to PurR with pDN228; plasmid-cured strain was isolated by plating on medium with 8ADP Present study
WWM986 Δhpt::PmcrB-tetR, ΔmtmCB2 WWM60 was transformed to PurR with pDN232; plasmid-cured strain was isolated by plating on medium with 8ADP Present study
WWM987 Δhpt::PmcrB-tetR, ΔmtmCB2 WWM60 was transformed to PurR with pDN223; plasmid-cured strain was isolated by plating on medium with 8ADP Present study
WWM988 Δhpt::PmcrB-tetR, ΔmtmCB1, ΔmtmCB2 WWM60 was transformed to PurR with pDN236; plasmid-cured strain was isolated by plating on medium with 8ADP Present study
WWM989 Δhpt::PmcrB-tetR, ΔmtmCB1, ΔmtmCB2 WWM60 was transformed to PurR with pDN237; plasmid-cured strain was isolated by plating on medium with 8ADP Present study
WWM990 Δhpt::PmcrB-tetR, ΔmtmCB1, ΔmtmCB2, ssuC::mtmCB1 WWM988 was transformed to PurR with pDN239; plasmid-cured strain was isolated by plating on medium with 8ADP Present study
WWM991 Δhpt::PmcrB-tetR, ΔmtmCB1, ΔmtmCB2, ssuC::mtmCB2 WWM988 was transformed to PurR with pDN241; plasmid-cured strain was isolated by plating on medium with 8ADP Present study

Genome Sequencing and Analysis.

Genomic DNA from M. acetivorans was extracted using a protocol described previously (44). DNA libraries were prepared with the Hyper Library construction kit (Kapa Biosystems) and quantified using qPCR. All libraries were sequenced on one lane of an Illumina MiSeq v2 (Illumina) at the Roy J. Carver Biotechnology Center, University of Illinois at Urbana–Champaign using a 500 cycles v2 sequencing kit (Illumina). Trimmed, paired end 250-nt reads were mapped to the M. acetivorans reference genome (NC_003552) using default parameters for breseq v0.25 (45). Trimmed genome sequencing reads have been deposited in the Sequenced Reads Archive at the National Center for Biotechnology Information under accession no. PRJNA352863.

Acknowledgments

We thank Dr. Mary Elizabeth Metcalf for technical assistance. This work was supported in part by the Division of Chemical Sciences, Geosciences, and Biosciences, Office of Basic Energy Sciences of the US Department of Energy Grant DE-FG02-02ER15296 (to W.W.M.), and the Carl R. Woese Institute for Genomic Biology postdoctoral fellowship (to D.D.N.). D.D.N. is currently a Simons Foundation fellow of the Life Sciences Research Foundation.

Footnotes

The authors declare no conflict of interest.

This article is a PNAS Direct Submission.

Data deposition: The sequences reported in this paper have been deposited in the GenBank database (accession no. KY436376) and the Sequenced Reads Archive (SRA) in the National Center for Biotechnology Information (accession no. PRJNA352863).

This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.1073/pnas.1618596114/-/DCSupplemental.

References

  • 1.Makarova KS, et al. An updated evolutionary classification of CRISPR-Cas systems. Nat Rev Microbiol. 2015;13(11):722–736. doi: 10.1038/nrmicro3569. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Horvath P, Barrangou R. CRISPR/Cas, the immune system of bacteria and archaea. Science. 2010;327(5962):167–170. doi: 10.1126/science.1179555. [DOI] [PubMed] [Google Scholar]
  • 3.Doudna JA, Charpentier E. Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science. 2014;346(6213):1258096. doi: 10.1126/science.1258096. [DOI] [PubMed] [Google Scholar]
  • 4.Jinek M, et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 2012;337(6096):816–821. doi: 10.1126/science.1225829. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Ran FA, et al. Genome engineering using the CRISPR-Cas9 system. Nat Protoc. 2013;8(11):2281–2308. doi: 10.1038/nprot.2013.143. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Hsu PD, Lander ES, Zhang F. Development and applications of CRISPR-Cas9 for genome engineering. Cell. 2014;157(6):1262–1278. doi: 10.1016/j.cell.2014.05.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Luo ML, Leenay RT, Beisel CL. Current and future prospects for CRISPR-based tools in bacteria. Biotechnol Bioeng. 2016;113(5):930–943. doi: 10.1002/bit.25851. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Barrangou R, van Pijkeren JP. Exploiting CRISPR-Cas immune systems for genome editing in bacteria. Curr Opin Biotechnol. 2016;37:61–68. doi: 10.1016/j.copbio.2015.10.003. [DOI] [PubMed] [Google Scholar]
  • 9.Mougiakos I, Bosma EF, de Vos WM, van Kranenburg R, van der Oost J. Next generation prokaryotic engineering: The CRISPR-Cas Toolkit. Trends Biotechnol. 2016;34(7):575–587. doi: 10.1016/j.tibtech.2016.02.004. [DOI] [PubMed] [Google Scholar]
  • 10.Li H, et al. CRISPR-Cas9 for the genome engineering of cyanobacteria and succinate production. Metab Eng. 2016;38:293–302. doi: 10.1016/j.ymben.2016.09.006. [DOI] [PubMed] [Google Scholar]
  • 11.Woese CR, Kandler O, Wheelis ML. Towards a natural system of organisms: Proposal for the domains Archaea, Bacteria, and Eucarya. Proc Natl Acad Sci USA. 1990;87(12):4576–4579. doi: 10.1073/pnas.87.12.4576. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.DeLong EF, Pace NR. Environmental diversity of bacteria and archaea. Syst Biol. 2001;50(4):470–478. [PubMed] [Google Scholar]
  • 13.Offre P, Spang A, Schleper C. Archaea in biogeochemical cycles. Annu Rev Microbiol. 2013;67(1):437–457. doi: 10.1146/annurev-micro-092412-155614. [DOI] [PubMed] [Google Scholar]
  • 14.Liu Y, Whitman WB. Metabolic, phylogenetic, and ecological diversity of the methanogenic archaea. Ann N Y Acad Sci. 2008;1125(1):171–189. doi: 10.1196/annals.1419.019. [DOI] [PubMed] [Google Scholar]
  • 15.Costa KC, Leigh JA. Metabolic versatility in methanogens. Curr Opin Biotechnol. 2014;29(1):70–75. doi: 10.1016/j.copbio.2014.02.012. [DOI] [PubMed] [Google Scholar]
  • 16.Kohler PRA, Metcalf WW. Genetic manipulation of Methanosarcina spp. Front Microbiol. 2012;3:259. doi: 10.3389/fmicb.2012.00259. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Guss AM, Rother M, Zhang JK, Kulkarni G, Metcalf WW. New methods for tightly regulated gene expression and highly efficient chromosomal integration of cloned genes for Methanosarcina species. Archaea. 2008;2(3):193–203. doi: 10.1155/2008/534081. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Guss AM, Mukhopadhyay B, Zhang JK, Metcalf WW. Genetic analysis of mch mutants in two Methanosarcina species demonstrates multiple roles for the methanopterin-dependent C-1 oxidation/reduction pathway and differences in H(2) metabolism between closely related species. Mol Microbiol. 2005;55(6):1671–1680. doi: 10.1111/j.1365-2958.2005.04514.x. [DOI] [PubMed] [Google Scholar]
  • 19.Pritchett MA, Zhang JK, Metcalf WW. Development of a markerless genetic exchange method for Methanosarcina acetivorans C2A and its use in construction of new genetic tools for methanogenic archaea. Appl Environ Microbiol. 2004;70(3):1425–1433. doi: 10.1128/AEM.70.3.1425-1433.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Rother M, Boccazzi P, Bose A, Pritchett MA, Metcalf WW. Methanol-dependent gene expression demonstrates that methyl-coenzyme M reductase is essential in Methanosarcina acetivorans C2A and allows isolation of mutants with defects in regulation of the methanol utilization pathway. J Bacteriol. 2005;187(16):5552–5559. doi: 10.1128/JB.187.16.5552-5559.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Buan NR, Metcalf WW. Methanogenesis by Methanosarcina acetivorans involves two structurally and functionally distinct classes of heterodisulfide reductase. Mol Microbiol. 2010;75(4):843–853. doi: 10.1111/j.1365-2958.2009.06990.x. [DOI] [PubMed] [Google Scholar]
  • 22.Galagan JE, et al. The genome of M. acetivorans reveals extensive metabolic and physiological diversity. Genome Res. 2002;12(4):532–542. doi: 10.1101/gr.223902. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Bartlett EJ, Brissett NC, Doherty AJ. Ribonucleolytic resection is required for repair of strand displaced nonhomologous end-joining intermediates. Proc Natl Acad Sci USA. 2013;110(22):E1984–E1991. doi: 10.1073/pnas.1302616110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Bartlett EJ, Brissett NC, Plocinski P, Carlberg T, Doherty AJ. Molecular basis for DNA strand displacement by NHEJ repair polymerases. Nucleic Acids Res. 2016;44(5):2173–2186. doi: 10.1093/nar/gkv965. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Metcalf WW, Zhang JK, Shi X, Wolfe RS. Molecular, genetic, and biochemical characterization of the serC gene of Methanosarcina barkeri Fusaro. J Bacteriol. 1996;178(19):5797–5802. doi: 10.1128/jb.178.19.5797-5802.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Gomaa AA, et al. Programmable removal of bacterial strains by use of genome-targeting CRISPR-Cas systems. MBio. 2014;5(1):e00928–e13. doi: 10.1128/mBio.00928-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Srinivasan G, James CM, Krzycki JA. Pyrrolysine encoded by UAG in Archaea: Charging of a UAG-decoding specialized tRNA. Science. 2002;296(5572):1459–1462. doi: 10.1126/science.1069588. [DOI] [PubMed] [Google Scholar]
  • 28.Kahnt J, et al. Post-translational modifications in the active site region of methyl-coenzyme M reductase from methanogenic and methanotrophic archaea. FEBS J. 2007;274(18):4913–4921. doi: 10.1111/j.1742-4658.2007.06016.x. [DOI] [PubMed] [Google Scholar]
  • 29.Wang T, Wei JJ, Sabatini DM, Lander ES. Genetic screens in human cells using the CRISPR-Cas9 system. Science. 2014;343(6166):80–84. doi: 10.1126/science.1246981. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Fu Y, et al. High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat Biotechnol. 2013;31(9):822–826. doi: 10.1038/nbt.2623. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.White MF. Homologous recombination in the archaea: The means justify the ends. Biochem Soc Trans. 2011;39(1):15–19. doi: 10.1042/BST0390015. [DOI] [PubMed] [Google Scholar]
  • 32.West SC. Processing of recombination intermediates by the RuvABC proteins. Annu Rev Genet. 1997;31(1):213–244. doi: 10.1146/annurev.genet.31.1.213. [DOI] [PubMed] [Google Scholar]
  • 33.Della M, et al. Mycobacterial Ku and ligase proteins constitute a two-component NHEJ repair machine. Science. 2004;306(5696):683–685. doi: 10.1126/science.1099824. [DOI] [PubMed] [Google Scholar]
  • 34.Cui L, Bikard D. Consequences of Cas9 cleavage in the chromosome of Escherichia coli. Nucleic Acids Res. 2016;44(9):4243–4251. doi: 10.1093/nar/gkw223. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Youngblut ND, et al. Genomic and phenotypic differentiation among Methanosarcina mazei populations from Columbia River sediment. ISME J. 2015;9(10):2191–2205. doi: 10.1038/ismej.2015.31. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Li Y, et al. Harnessing type I and type III CRISPR-Cas systems for genome editing. Nucleic Acids Res. 2016;44(4):e34. doi: 10.1093/nar/gkv1044. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Pawluk A, et al. Inactivation of CRISPR-Cas systems by anti-CRISPR proteins in diverse bacterial species. Nat Microbiol. 2016;1(8):16085. doi: 10.1038/nmicrobiol.2016.85. [DOI] [PubMed] [Google Scholar]
  • 38.Sowers KR, Boone JE, Gunsalus RP. Disaggregation of Methanosarcina spp. and growth as single cells at elevated osmolarity. Appl Environ Microbiol. 1993;59(11):3832–3839. doi: 10.1128/aem.59.11.3832-3839.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Metcalf WW, Zhang JK, Wolfe RS. An anaerobic, intrachamber incubator for growth of Methanosarcina spp. on methanol-containing solid media. Appl Environ Microbiol. 1998;64(2):768–770. doi: 10.1128/aem.64.2.768-770.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Kim SY, et al. Different biosynthetic pathways to fosfomycin in Pseudomonas syringae and Streptomyces species. Antimicrob Agents Chemother. 2012;56(8):4175–4183. doi: 10.1128/AAC.06478-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Gibson DG, et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat Methods. 2009;6(5):343–345. doi: 10.1038/nmeth.1318. [DOI] [PubMed] [Google Scholar]
  • 42.Kearse M, et al. Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics. 2012;28(12):1647–1649. doi: 10.1093/bioinformatics/bts199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Metcalf WW, Zhang J, Apolinario E, Sowers KR, Wolfe RS. A genetic system for Archaea of the genus Methanosarcina: Liposome-mediated transformation and construction of shuttle vectors. Proc Natl Acad Sci USA. 1997;94(6):2626–2631. doi: 10.1073/pnas.94.6.2626. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Boccazzi P, Zhang JK, Metcalf WW. Generation of dominant selectable markers for resistance to pseudomonic acid by cloning and mutagenesis of the ileS gene from the archaeon Methanosarcina barkeri fusaro. J Bacteriol. 2000;182(9):2611–2618. doi: 10.1128/jb.182.9.2611-2618.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Barrick JE, et al. Identifying structural variation in haploid microbial genomes from short-read resequencing data using breseq. BMC Genomics. 2014;15(1):1039. doi: 10.1186/1471-2164-15-1039. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Proceedings of the National Academy of Sciences of the United States of America are provided here courtesy of National Academy of Sciences

RESOURCES