Skip to main content
Annals of Clinical Microbiology and Antimicrobials logoLink to Annals of Clinical Microbiology and Antimicrobials
. 2017 Mar 21;16:13. doi: 10.1186/s12941-017-0189-x

Occurrence of blaDHA-1 mediated cephalosporin resistance in Escherichia coli and their transcriptional response against cephalosporin stress: a report from India

Birson Ingti 1, Deepjyoti Paul 1, Anand Prakash Maurya 1, Debajyoti Bora 3, Debadatta Dhar Chanda 2, Atanu Chakravarty 2, Amitabha Bhattacharjee 1,✉
PMCID: PMC5359928  PMID: 28320396

Abstract

Background

Treatment alternatives for DHA-1 harboring strains are challenging as it confers resistance to broad spectrum cephalosporins and may further limit treatment option when expressed at higher levels. Therefore, this study was designed to know the prevalence of DHA genes and analyse the transcription level of DHA-1 against different β-lactam stress.

Methods

Screening of AmpC β-lactamase phenotypically by modified three dimensional extract method followed by Antimicrobial Susceptibility and MIC determination. Genotyping screening of β-lactamase genes was performed by PCR assay followed by their sequencing. The bla DHA-1 transcriptional response was evaluated under different cephalosporin stress by RT PCR. Transferability of bla DHA gene was performed by transformation and conjugation and plasmid incompatibility typing, DNA fingerprinting by enterobacterial repetitive intergenic consensus sequences PCR.

Results

16 DHA-1 genes were screened positive from 176 Escherichia coli isolates and primer extension analysis showed a significant increase in DHA-1 mRNA transcription in response to cefotaxime at 8 µg/ml (6.99 × 102 fold), ceftriaxone at 2 µg/ml (2.63 × 103 fold), ceftazidime at 8 µg/ml (7.06 × 103 fold) and cefoxitin at 4 µg/ml (3.60 × 104 fold) when compared with untreated strain. These transcription data were found significant when analyzed statistically using one way ANOVA. Four different ESBL genes were detected in 10 isolates which include CTX-M (n = 6), SHV (n = 4), TEM (n = 3) and OXA-10 (n = 1), whereas, carbapenemase gene (NDM) was detected only in one isolate. Other plasmid mediated AmpC β-lactamases CIT (n = 9), EBC (n = 2) were detected in nine isolates. All DHA-1 genes detected were encoded in plasmid and incompatibility typing from the transformants indicated that the plasmid encoding bla DHA-1 was carried mostly by the FIA and L/M Inc group.

Conclusion

This study demonstrates the prevalence of DHA-1 gene in this region and highlights high transcription of DHA-1 when induced with different β-lactam antibiotics. Therefore, cephalosporin treatment must be restricted for the patients infected with pathogen expressing this resistance determinant.

Background

Escherichia coli (E. coli) possess a chromosomal cephalosporinase gene, which is regulated by a weak promoter and a transcriptional attenuator. The gene confers resistance only to narrow-spectrum cephalosporins [1, 2]. However, spontaneous mutations in the promoter, as well as transcriptional attenuator region of the AmpC gene may induce constitutive overproduction of the cephalosporinase resulting in resistance to penicillins and broad-spectrum cephalosporins (e.g. cefotaxime, ceftazidime, ceftriaxone, aztreonam etc.) [3, 4]. Besides hyper-production of the chromosomally encoded enzyme, the presence of one or more plasmid-mediated AmpC β-lactamases along with other intrinsic mechanisms in E. coli leads to resistance against multiple antimicrobial agents, compromising the efficacy of treatment [5–7]. Six families of plasmid-encoded AmpC β-lactamases were described based on their sequence similarities as CIT, FOX, MOX, DHA, EBC, and ACC [8]. The most commonly recognized plasmid-mediated AmpC among the strains of E. coli includes the CMY-2 type which belongs to the CIT family [9, 10].

DHA-1, another plasmid-mediated AmpC β-lactamase, belonging to DHA family was found increasingly among Enterobacteriaceae in many parts of the world and was a growing concerned in the medical world as it leads to treatment failure [7]. It was first characterized in a Salmonella enteritidis which has the ability to hydrolyze penicillins, cephamycin, including broad spectrum cephalosporin leaving physicians with limited antibiotic choices. It was also the first plasmid-encoded β-lactamase found to be inducible and can be expressed in high levels [11, 12]. So far a total of 24 gene types of DHA family have been reported (http://www.ncbi.nlm.nih.gov/projects/pathogens/submit_beta_lactamase). The regulation of this β-lactamase expression is closely linked to cell wall recycling and involves at least three genes: ampR (codes for a transcriptional regulator of the LysR family), ampG (codes for a transmembrane permease) and ampD (codes for a cytosolic N-acetyl-anhydromuramyl- l-alanine amidase) [13].

Though it was well established that β-lactam antibiotics are potent inducers of class C in most of the members of the family Enterobacteriaceae [7], there is no relevant information on the level of AmpC expression taking place when the strains with incomplete regulatory elements were under antibiotic stress. Therefore, this study was undertaken to investigate the transcriptional response of DHA-1 under various cephalosporin’s stresses.

Methods

Bacterial strains

A total of 176 consecutive, non-duplicate Escherichia isolates were collected from different clinical specimens (mostly from urine followed by pus) obtained from different Wards/OPD of Silchar Medical College and Hospital, India from October 2012 to March 2013. The isolates were identified by cultural characteristics, biochemical reactions and further confirmed by 16S rDNA sequencing using primers, a forward primer 5′-AGAGTTTGATCMTGGCTCAG-3′ and a reverse primer 5′-TACGGYTACCTTGTTACGACTT-3′.

Screening of AmpC β-lactamase by cefoxitin disc test and modified three dimensional extract method

Preliminary screening of AmpC β-lactamase was carried out on Mueller–Hinton Agar plates containing cefoxitin (30 µg) (Hi Media, Mumbai). Isolates with inhibition zones of less than 18 mm, were considered as screen positives [14]. The suspected AmpC β-lactamase producers were further confirmed by modified three dimensional extract test (M3DET) [15]. Escherichia coli ATCC 25922 and Enterobacter cloacae P99 were used as negative and positive control respectively.

Antimicrobial susceptibility and minimum inhibitory concentrations (MIC’s) determination

Antimicrobial susceptibility was determined by Kirby Bauer disc diffusion method on Mueller–Hinton Agar plates. Following antibiotics were used: amikacin (30 μg), gentamicin (10 μg), ciprofloxacin (30 μg), trimethoprim/sulphamethoxazole (1.25/23.75 μg), tigecycline (15 μg) (Hi Media, Mumbai). MIC’s of various antibiotics were also determined on Mueller–Hinton Agar plates by agar dilution method according to CLSI and EUCAST guidelines [16, 17]. Following antibiotics were used: cefotaxime, ceftazidime, ceftriaxone, cefepime, imipenem, meropenem, ertapenem and aztreonam (Hi-Media, Mumbai, India).

Detection of DHA gene by polymerase chain reaction

Polymerase chain reaction (PCR) was performed targeting all the DHA genes by using a pair of primers as listed in Table 1. Isolates positive for DHA genes were further investigated for the presence of other AmpC gene families, namely: CIT, ACC, FOX and EBC [18]. PCR amplification was performed using 30 µl of total reaction volume. Reactions were run under the following conditions: initial denaturation at 95 °C for 2 min, 34 cycles of 95 °C for 15 s, 51 °C for 1 min, 72 °C for 1 min and final extension at 72 °C for 7 min.

Table 1.

List of oligonucleotide primers for amplification of β-lactamase genes

Serial no. Targets Primers pairs Sequence (5′→3′) Product size (bp) Reference
1 DHA-1 and DHA-2 DHA F
DHA R
TGATGGCACAGCAGGATATTC
GCTTTGACTCTTTCGGTATTCG
997 [18]
2 KPC KPC F
KPC R
5′-CATTCAAGGGCTTTCTTGCTGC-3′
5′-ACGACGGCATAGTCATTTGC-3′
538 [20]
3 IMI/NMC IMI/NMC F
IMI/NMC R
5′-CCATTCACCCATCACAAC-3′
5′-CTACCGCATAATCATTTGC-3′
440 [21]
4 SME SME F
SME R
5′-AACGGCTTCATTTTTGTTTAG-3′
5′-GCTTCCGCAATAGTTTTATCA-3′
831 [22]
5 VIM VIM F
VIMR
5′-GATGGTGTTTGGTCGCATA-3′
5′-CGAATGCGCAGCACCAG-3′
390 [23]
6 IMP IMP F
IMP R
5′-TTGACACTCCATTTACDG-3′
5′-GATYGAGAATTAAGCCACYCT-3′
139 [23]
7 NDM NDM F
NDM R
5′-GGGCAGTCGCTTCCAACGGT-3′
5′-GTAGTGCTCAGTGTCGGCAT-3′
476 [24]
8 DHA-1 DHA-RT F
DHA-RT R
5′-TGATGGCACAGCAGGATATTC-3′
5′-TACTTACAGATCCGAGCTCAA-3′
144 This study

PCR products were purified by QIAquick Gel Extraction Kit (QIAGEN, Germany) and sequenced. Sequence results were analysed using a BLAST suite program of NCBI (http://blast.ncbi.nlm.nih.gov/Blast.cgi).

Molecular characterization of ESBL and carbapenemase genes by multiplex PCR

For amplification and characterization of ESBL genes, a set of five primers were used, namely: TEM, CTX-M, SHV, OXA-2, and PER [19]. Reactions were run under the following conditions: initial denaturation at 94 °C for 5 min, 33 cycles of 94 °C for 35 s., 51 °C for 1 min, 72 °C for 1 min and a final extension at 72 °C for 7 min.

For amplification and characterization of carbapenemase genes, a set of seven primers were used, namely: KPC, IMI, NMC, SME, VIM, IMP, and NDM (Table 1). Reactions were run as described previously.

Transcriptional expression analysis of blaDHA-1 by quantitative realtime PCR

Expression of the bla DHA-1 gene was studied in response to cefoxitin, cefotaxime, ceftriaxone and ceftazidime stress at different concentrations (2, 4, 8 µg/ml) and was determined by inoculating the organisms harboring bla DHA-1 in Luria–Bertani broth (Hi-media, Mumbai, India). Isolate without any antibiotic pressure was used as a control. A total RNA was isolated using Qiagen RNase Mini Kit (Qiagen, Germany), immediately reverse transcribed into cDNA by using QuantiTect® reverse transcription kit (Qiagen, Germany). The cDNA was quantified by Picodrop (Pico 200, Cambridge, UK) and quantitative real time PCR was performed using Power Sybr Green Master Mix (Applied Biosystem, Warrington, UK) in step one plus real time detection system (Applied Biosystem, USA). The house keeping gene rpsel of E. coli was used as an internal standard [25]. DHA-1 positive isolates showing resistance to broad spectrum cephalosporins and also devoid of other β-lactamases was selected for this study. The primer used for amplification of DHA-1 is listed in Table 1. PCR reactions were performed in triplicates for the isolate. The reaction was run under the following conditions: 95 °C for 2 min, 32 cycles of 95 °C for 20 s, 48 °C for 40 s and 72 °C for 1 min. The relative expression of bla DHA-1 at a different antibiotics pressure was determined by the ΔΔCt method. Relative quantification was compared with strain grown for 16 h without any antibiotic pressure.

Statistical analysis

The changes in DHA-1 mRNA expression in response to different β-lactam antibiotic stresses at different concentration were analyzed using one-way ANOVA followed by Tukey–Kramer (Tukey’s W) multiple comparison test using SPSS version 17.0. Differences were considered statistically significant at both 5 and 1% level when p < 0.05. Data are presented as mean fold change + standard error of the mean.

Plasmid preparation

The bacterial isolates were cultured in Luria–Bertani broth (LB broth) containing 0.25 µg/ml of cefotaxime. Cultures were incubated on shaker incubator overnight at 37 °C, 160 rpm. Plasmids were purified by QIA prep Spin Miniprep Kit (QIAGEN, Germany).

Transferability of blaDHA gene by transformation and conjugation

The transformation experiments were carried out by heat shock method [26] using E. coli DH5α as the recipient. Transformants were selected on cefotaxime (0.5 µg/ml) containing LB Agar plates.

Conjugation experiments were carried out between clinical isolates as donors and a streptomycin resistant E. coli strain B (Genei, Bangalore) as the recipient. An overnight culture of the bacteria was diluted in Luria–Bertani broth (Hi-Media, Mumbai, India) and was grown at 37 °C till the O.D. of the recipient and donor culture reached 0.8–0.9 at A600. Donor and recipient cells were mixed at 1:5 donor-to-recipient ratios and transconjugants were selected L.B Agar plates supplemented with cefotaxime (0.5 µg/ml) and streptomycin (600 µg/ml).

Plasmid incompatibiltiy typing

For detection of incompatibility group type of plasmid carrying bla DHA, PCR based replicon typing was carried out, targeting 18 different replicon types, to perform five multiplex and three simplex PCRs to amplify the FIA, FIB, FIC, HI1, HI2, I1-Ig, L/M, N, P, W, T, A/C, K, B/O, X, Y, F and FIIA replicons [27].

DNA fingerprinting by enterobacterial repetitive intergenic consensus sequences PCR

Typing of all bla DHA-1 producing E. coli isolates was done by enterobacterial repetitive intergenic consensus (ERIC) PCR as described previously [28]. Isolates were put into cluster based on banding pattern and dendogram was prepared by NTSYS software.

Results

During the study period, a total of 176 E. coli isolates were obtained from different clinical samples. Among these, 110 (62.5%) were resistant to cefoxitin and 63 (35.8%) isolates were found to show AmpC activity by M3DET. By performing PCR, 16 isolates were detected for DHA genes and showed a sequence identical to that of DHA-1 (Table 1). These isolates harboring DHA-1 gene were selected for further study. Among DHA-1 positive isolates four different ESBL genes were detected in 10 isolates which include CTX-M (n = 6), SHV (n = 4), TEM (n = 3) and OXA-10 (n = 1). Carbapenemase gene (NDM-1) was detected only in one isolate. Other plasmid mediated AmpC β-lactamase CIT (n = 9), EBC (n = 2) were detected in nine isolates that carried either CTX-M (n = 3),SHV (n = 1), TEM (n = 1), NDM (n = 1) alone or CTX-M plus SHV(n = 2), CTX-M plus TEM (n = 1) and OXA-10 plus SHV (n = 1) (Table 2). These isolates harboring AmpC β-lactamase were mostly obtained from Surgery and medicine ward. To demonstrate whether DHA-1 expression would take place in the presence of different cephalosporins at a different concentration, an E.coli strain BM-567 (Table 2) harboring only DHA-1 β-lactamase and showing resistance to broad spectrum cephalosporins was selected. The fold increase in mRNA production was measured using primer extension analysis. It was observed that there was a significant increase in the expression of DHA-1 gene in response to cefotaxime, ceftriaxone, ceftazidime but not as high as those for cefoxitin when compared with the basal level without antibiotic pressure (Fig. 1). Though increased in transcription was observed in response to these β-lactam antibiotics, high transcript level were achieved when induced by cefotaxime at 8 µg/ml (6.99 × 102 fold), ceftriaxone at 2 µg/ml (2.63 × 103 fold), ceftazidime at 8 µg/ml (7.06 × 103 fold) and cefoxitin at 4 µg/ml (3.60 × 104 fold) (Fig. 1). The ANOVA and Tukey–Kramer (Tukey’s W) multiple comparison test for checking the differences in the expression of DHA-1 was found to be significant (p value is less than 0.05; Table 3).

Table 2.

Clinical history, their molecular details and resistance profile of DHA-1 gene-positive E. coli isolates

Sl. No. Sample ID Age (years) Sex Ward/clinics Type of clinical specimen aESBL genes detected Carbapenemase genes detected Other plasmid AmpC genes (Inc type) Resistance profile MIC of β-lactam (mg/l)
CTX CAZ CRO FEP ATM IMP MEM ETP
1 BM12 35 Male Surgery Pus – – – K AMK, GEN, SXT >512 >512 256 >512 64 16 8 8
2 BM26 107 Female Pediatrics Urine TEM – – FIA, CIP, AMK, GEN, SXT 64 128 64 8 64 <2 <2 <2
3 BM59 55 Female Medicine Urine – – – FIA CIP, AMK, GEN, SXT 128 64 64 16 128 <2 <2 <2
4 BM63 60 Female Surgery Pus CTX-M – CIT – CIP, AMK, GEN, SXT 128 128 256 16 64 <2 <2 <2
5 BM130 27 Female Surgery Pus TEM – CIT,
EBC
HI1,
L/M
CIP, AMK, GEN, SXT >512 512 >512 64 256 16 4 4
6 BM138 45 Male Surgery Pus CTX-M – – – CIP, GEN, SXT 64 128 128 32 128 <2 <2 <2
7 BM197 30 Female Surgery Pus – – CIT L/M CIP, AMK, GEN, SXT 512 >512 256 64 512 2 <2 <2
8 BM230 43 Female Surgery Pus CTX-M, SHV – CIT L/M CIP, AMK, GEN, SXT 64 128 256 32 256 16 8 16
9 BM252 7 Female Paediatrics Urine SHV – CIT, EBC F1B, FIA CIP, AMK, GEN, SXT >512 >512 >512 128 256 8 <2 <2
10 BM355 10 Male Paediatrics Urine – NDM CIT FIA CIP, AMK, SXT >512 512 >512 8 256 <2 <2 <2
11 BM409 61 Male Medicine Urine CTX-M – CIT K CIP, AMK, GEN, SXT 64 64 32 16 128 <2 <2 <2
12 BM441 40 Male Medicine Stool CTX-M, SHV – – FIA CIP, AMK, GEN, SXT 32 64 128 32 256 <2 <2 <2
13 BM508 48 Male Surgery Pus – – CIT I1 CIP, AMK, GEN 32 32 32 16 256 <2 <2 <2
14 BM520 55 Female Surgery Pus OXA-10, SHV – – – CIP, GEN, SXT 16 128 128 32 32 <2 <2 <2
15 BM567 30 Male Medicine Urine – – – – CIP, AMK, GEN, SXT 128 256 256 32 256 <2 <2 <2
16 BM576 40 Female Medicine Urine CTX-M, TEM – CIT K, B/O AMK, GEN, SXT >512 >512 >512 128 >512 16 16 32

AMK amikacin; GEN gentamycin; CIP ciprofloxacin; SXT cottrimoxazole; CTX cefotaxime; CAZ ceftazidime; CRO ceftriaxone; FEP cefepime; ATM aztreonam; IMP imipenem; MEM meropenem; ETP ertapenem

aExtended spectrum β-lactamase

Fig. 1.

Fig. 1

Transcriptional analysis of DHA-1 espression by RT-PCR. Total bacterial RNA was isolated from mid-log- phase cultures of E. coli. The error bars represent the standard deviations of the means of triplicate samples

Table 3.

Statistical analysis of changes in DHA-1 mRNA expression in response to different-lactam antibiotic stress at different concentration using one way ANOVA

Sl no. β-lactam antibiotics Value (Mean ± SEM) p value
NA 2 mg/l 4 mg/l 8 mg/l
1 Cefotaxime 1.00 ± 0 56.66 ± 1.18 58.10 ± 0.58 699.25 ± 5.27 0.001*
2 Ceftriaxone 1.00 ± 0 2634.69 ± 16.58 2383.97 ± 20.73 510.70 ± 6.04
3 Ceftazidime 1.00 ± 0 249.50 ± 11.63 356.27 ± 14.20 7059.48 ± 60.91
4 Cefoxitin 1.00 ± 0 17721.31 ± 608.47 35855.21 ± 1050.38 1363.69 ± 237.37

NA no antibiotic; SEM standard error of the mean

*Significant (p < 0.05)

Typing by ERIC-PCR confirmed 16 different haplotypes (Fig. 2) indicating the diversity of the isolates. The susceptibility pattern of these bla DHA-1 harboring isolates showed resistance towards β-lactam including broad spectrum cephalosporin but most of them were susceptible against a carbapenem group of drugs. They also show susceptibility to tigecycline and moderate to high resistance against amikacin, gentamycin, co-trimoxazole, ciprofloxacin. The MICs of selected β-lactam antibiotics for all the parental strains harboring DHA-1 were found to be above breakpoint level (Table 2). The transformation experiment could establish that DHA-1 was encoded in plasmid however, conjugation experiment revealed that only 4 isolates could conjugatively transfer DHA-1 gene in E. coli strain B which was confirmed by PCR analysis. On performing incompatibility typing it was established that most of the transformants with DHA-1 were associated with K, FIA, L/M, FIB, HI1, B/O & I1 Inc group (Table 2).

Fig. 2.

Fig. 2

ERIC PCR analysis of E. coli producing DHA-1 β-lactamase. Lane L: molecular weight marker; lanes 1–16: isolates harboring DHA-1 β-lactamase

Discussion

The first plasmid mediated AmpC β-lactamase, to be reported was CMY-1, in 1989 [29]. Since then, several plasmid-encoded AmpC β-lactamases (ACC, FOX, MOX, CMY, ACT, etc.) have been reported in several genera of bacteria, including Salmonella spp., Pseudomonas spp., Proteus mirabilis and Klebsiella pneumoniae [7]. Among them plasmid encoded DHA-1; a clinically important AmpC β-lactamase was the first β-lactamase found to be inducible and can be expressed at higher levels in strains having AmpR regulatory gene [11, 30]. This plasmid- mediated β-lactamase is now being increasingly detected in a strain of E. coli worldwide [31–33] and early detection of this β-lactamase (DHA-1) is mandatory for better antibiotic therapy and also to prevent further spread. The present study reports the prevalence of DHA-1 (9%) among E. coli strains in this region which is quite high compared to other studies [30, 32, 33] and typing of these DHA-1 harboring isolates by ERIC PCR revealed diverse haplotypes, indicating the spread of the DHA-1 gene through horizontal transfer. Based on the present susceptibility data (Table 2) and previous studies [11, 12], carbapenem and other non-β-lactam antibiotics such as tigecycline could be better drugs of choice for the treatment of infections caused by E. coli producing DHA-1.

From the earlier study, it appears that E. coli lack one of the regulatory component (AmpR gene), which leads to the lower level, non-inducible expression of AmpC [34]. However, inducible cephalosporinase (bla CMY-13) found associated with an AmpR gene was detected recently in a strain of E. coli [35]. Several broad spectrum cephalosporins were believed to increase the expression of AmpC β-lactamase [36], although the concentration which leads to increase in the expression of AmpC β-lactamase was not established. This study demonstrates higher transcription of DHA-1 when induced with different cephalosporins. These differences in the relative amounts of RNA transcription of DHA-1 gene, when induced with different cephalosporins at a concentration below MIC level suggest that the transcription varies depending on the level of antibiotics stress. Higher AmpC production was supported by another finding, where blaMIR-1, a plasmid-encoded AmpC gene exhibited a 95-fold increase in expression relative to WT AmpC [37]. Concentration dependent expression of AmpC cephalosporinase was also observed in a strain of Pseudomonas aeruginosa, when the strain was induced with cefoxitin or clavulanic acid at 8, 16 and 50 µg/ml [38]. So far, the factors behind the quantitative differences of AmpC expression in E.coli strain when exposed to different β-lactam concentration is unknown. A transformation experiment could establish that all the DHA-1 gene were encoded in a plasmid which is in agreement with the previous study [12, 30–33] and Incompatibility typing from the transformants indicated that the plasmid encoding bla DHA-1 was carried mostly by FIA and L/M Inc group as found in another study [39]. Although detection of other Inc group, namely HI1, FIB, I1, K in the present study was mostly associated with CMY-2 and ACC harboring strains [39]. Plasmids carrying genes for AmpC β-lactamases often carry ESBL genes such as CTX-M [40, 41] as found in the present study, where most of these DHA-1 harboring isolates co-harbour ESBL genes (Table 2). Co-existence of New Delhi metallo-β-lactamase (NDM) gene was also observed in one isolate as the high prevalence of the E. coli harboring a metallo-β-lactamase known as the NDM has been increasingly observed in the Indian subcontinent [42].

Conclusion

Strains harboring plasmid mediated AmpC (DHA-1) genes are often resistant to multiple antimicrobial agents and the overexpression of this resistant determinant when induced with different cephalosporins stress will further limit treatment option. The present study demonstrates that higher expression of DHA-1 takes place when induced with specific concentrations of β-lactam antibiotics, although further research is required to understand the factors behind the upregulation of DHA-1 gene in the future. Therefore, revision in cephalosporin usage policy is required for effective treatment of patients infected with pathogen harboring this mechanism.

Authors’ contributions

BI performed the experimental work, data collection and analysis and prepared the manuscript. AB supervised the research work and participated in designing the study and drafting the manuscript. DP and APM participated in sample collection and part of experiments. DB participated in statistical analysis. DD and AC Participated in experiment designing and manuscript correction. All authors read and approved the final manuscript.

Acknowledgements

The authors would like to acknowledge the help of HOD, Microbiology, Assam University for providing infrastructure. The authors sincerely acknowledge the financial support provided by University Grants Commissions (UGC-MRP) Government of India. Authors also acknowledge the help from Assam University Biotech Hub for providing laboratory facility to complete this work.

Competing interests

The authors declared that they have no competing interests.

Availability of data and materials

All the relevant data and information are presented in the manuscript.

Consent for publication

All the authors read and approved the final version of the manuscript.

Ethical approval

The work was approved by Institutional Ethical committee of Assam University, Silchar vide Reference Number: IEC/AUS/C/2014-003. The authors confirm that participants provided their written informed consent to participate in this study.

Funding

University grants commission (UGC-MRP) and (UGC-RGNF) to Birson Ingti Vide letter no. F1-17.1/2013-14/RGNF-2013-14-ST-ASS-38069/(SAIII/Website).

Contributor Information

Birson Ingti, Email: ingtibir1012@gmail.com.

Deepjyoti Paul, Email: deepmicro0404@gmail.com.

Anand Prakash Maurya, Email: anandmaurya02@yahoo.in.

Debajyoti Bora, Email: debu.bora19@gmail.com.

Debadatta Dhar Chanda, Email: drdebadattadhar@rediffmail.com.

Atanu Chakravarty, Email: atanu_chakravarty@rediffmail.com.

Amitabha Bhattacharjee, Phone: 00918471939088, Email: ab0404@gmail.com.

References

  • 1.Jaurin B, Grundstrom T. AmpC cephalosporinase of Escherichia coli K-12 has a different evolutionary origin from that of β-lactamases of the penicillinase type. Proc Natl Acad Sci USA. 1981;78:4897–4901. doi: 10.1073/pnas.78.8.4897. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Bergstrom S, Normark S. β-Lactam resistance in clinical isolates of Escherichia coli caused by elevated production of the ampC mediated chromosomal β-lactamase. Antimicrob Agents Chemother. 1979;16:427–433. doi: 10.1128/AAC.16.4.427. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Caroff N, Espaze E, Gautreau D, Richet H, Reynaud A. Analysis of the effects of −42 and −32 ampC promoter mutations in clinical isolates of Escherichia coli hyperproducing ampC. J Antimicrob Chemother. 2000;45:783–788. doi: 10.1093/jac/45.6.783. [DOI] [PubMed] [Google Scholar]
  • 4.Jaurin B, Grundstrom T, Edlund T, Normark S. The E. coli β-lactamase attenuator mediates growth rate-dependent regulation. Nature. 1981;290:221–225. doi: 10.1038/290221a0. [DOI] [PubMed] [Google Scholar]
  • 5.Deshpande LM, Jones RN, Fritsche TR, Sader HS. Occurrence of plasmidic AmpC type β-lactamase-mediated resistance in Escherichia coli: report from the SENTRY Antimicrobial Surveillance Program (North America, 2004) Int J Antimicrob Agents. 2006;28:578–581. doi: 10.1016/j.ijantimicag.2006.07.025. [DOI] [PubMed] [Google Scholar]
  • 6.Mammeri H, Nordmann P, Berkani A, Eb F. Contribution of extended-spectrum AmpC (ESAC) β-lactamases to carbapenem resistance in Escherichia coli. FEMS Microbiol Lett. 2008;282:238–240. doi: 10.1111/j.1574-6968.2008.01126.x. [DOI] [PubMed] [Google Scholar]
  • 7.Jacoby GA. AmpC β-lactamases. Clin Microbiol Rev. 2009;22:161–182. doi: 10.1128/CMR.00036-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Pérez-Pérez FJ, Hanson ND. Detection of plasmid-mediated AmpC β-lactamase genes in clinical isolates by using multiplex PCR. J Clin Microbiol. 2002;40:2153–2162. doi: 10.1128/JCM.40.6.2153-2162.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Naseer U, Haldorsen B, Simonsen GS, Sundsfjord A. Sporadic occurrence of CMY-2-producing multidrug-resistant Escherichia coli of ST-complexes 38 and 448, and ST131 in Norway. Clin Microbiol Infect. 2010;16:171–178. doi: 10.1111/j.1469-0691.2009.02861.x. [DOI] [PubMed] [Google Scholar]
  • 10.Pavez M, Neves P, Dropa M, et al. Emergence of carbapenem resistant Escherichia coli producing CMY-2-type AmpC β-lactamase in Brazil. J Med Microbiol. 2008;57:1590–1592. doi: 10.1099/jmm.0.2008/002774-0. [DOI] [PubMed] [Google Scholar]
  • 11.Gaillot O, Clement C, Simonet M, Philippon A. Novel transferable β-lactam resistance with cephalosporinase characteristics in Salmonella enteritidis. J Antimicrob Chemother. 1997;39:85–87. doi: 10.1093/jac/39.1.85. [DOI] [PubMed] [Google Scholar]
  • 12.Barnaud G, Arlet G, Verdet C, Gaillot O, Lagrange PH, Philippon A. Salmonella enteritidis: AmpC plasmid-mediated inducible β-lactamase (DHA-1) with an ampR gene from Morganella morganii. Antimicrob Agents Chemother. 1998;42:2352–2358. doi: 10.1128/aac.42.9.2352. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Hanson ND, Sanders CC. Regulation of inducible AmpC β-lactamase expression among Enterobacteriaceae. Curr Pharm Des. 1999;5:881–894. [PubMed] [Google Scholar]
  • 14.Lorian V. Antibiotics in laboratory medicine. 5. Philadelphia: Lippincott Williams and Wilkins; 2005. [Google Scholar]
  • 15.Coudron PE, Moland ES, Thomson KS. Occurrence and detection of AmpC β-lactamases among Escherichia coli, Klebsiella pneumoniae, and Proteus mirabilis isolates at a Veterans Medical Center. J Clin Microbiol. 2000;38:1791–1796. doi: 10.1128/jcm.38.5.1791-1796.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing; twenty-third informational supplement. M100-S23. Wayne: CLSI; 2013.
  • 17.European committee on antimicrobial susceptibility testing. Breakpoint tables for interpretation of MICs and zone diameters, version 6.0; 2016.
  • 18.Caroline D, Anaelle DC, Dominique D, Christine F, Guillaume A. Development of a set of multiplex PCR assays for the detection of genes encoding important β-lactamases in Enterobacteriaceae. J Antimicrob Chemother. 2010;65:490–495. doi: 10.1093/jac/dkp498. [DOI] [PubMed] [Google Scholar]
  • 19.Lee S, Park YJ, Kim M, Lee HK, Han K, Kang CS. Prevalence of Ambler class A and D β-lactamases among clinical isolates of Pseudomonas aeruginosa in Korea. J Antimicrob Chemother. 2005;56:122–127. doi: 10.1093/jac/dki160. [DOI] [PubMed] [Google Scholar]
  • 20.Nass T, Cuzon G, Villegas MV, Lartigue MF, Quinn JP, Nordmann P. Genetic structures at the origin of acquisition of the β-lactamase blaKPC gene. Antimicrob Agents Chemother. 2008;52:1257–1263. doi: 10.1128/AAC.01451-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Rasmussen BA, Bush K, Keeney D, Yang Y, Hare R, Gara CO, et al. Characterization of IMI-1 betalactamase, a class A carbapenem-hydrolyzing enzyme from Enterobacter cloaceae. Antimicrob Agents Chemother. 1996;40:2080–2086. doi: 10.1128/aac.40.9.2080. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Nass T, Vandel L, Sougakoff W, Livermore DM, Nordmann P. Cloning and sequence analysis of the gene for a carbapenem hydrolyzing class A β-lactamase, SME-1, from Serratia marcescens S6. Antimicrob Agents Chemother. 1994;38:1262–1270. doi: 10.1128/AAC.38.6.1262. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Jh Y, Yi K, Lee H, Yong D, Lee K, Kim JM, et al. Molecular characterization of metallo-β-lacatamaseproducing Acinetobacter baumannii and Acinetbacter genomospecies 3 from Korea: identification of two new integrons carrying the blaVIM-2 gene cassettes. J Antimicrob Chemother. 2002;49:837–840. doi: 10.1093/jac/dkf043. [DOI] [PubMed] [Google Scholar]
  • 24.Yong D, Toleman MA, Giske CG, Cho HS, Sundman K, Lee K, et al. Characterization of a New Metallo-β-Lactamase Gene, blaNDM-1, and a Novel Erythromycin Esterase Gene Carried on a Unique Genetic Structure in Klebsiella pneumoniae Sequence Type 14 from India. Antimicrob Agents Chemother. 2009;53:5046–5054. doi: 10.1128/AAC.00774-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Swick MC, Morgan-Linnell SK, Carlson KM, et al. Expression of multidrug efflux pump genes acrAB-tolC, mdfA and norE in Escherichia coli clinical isolates as a function of fluroquinolone and multidrug resistance. Antimicrob Agents Chemother. 2011;55:921–924. doi: 10.1128/AAC.00996-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. 2. New York: Cold Spring Harbor Laboratory Press; 1989. [Google Scholar]
  • 27.Carattoli A, Bertini A, Villa L, Falbo V, et al. Identification of plasmids by PCR-based replicon typing. J Microbiol Methods. 2005;63:219–228. doi: 10.1016/j.mimet.2005.03.018. [DOI] [PubMed] [Google Scholar]
  • 28.Versalovic J, Koeuth T, Lupski JR. Distribution of repetitive DNA sequences in eubacteria and application to fingerprinting of bacterial genomes. Nucleic Acids Res. 1995;19:6823–6831. doi: 10.1093/nar/19.24.6823. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Bauernfeind A, Chong Y, Schweighart S. Extended broad spectrum β-lactamase in Klebsiella pneumoniae including resistance to cephamycins. Infection. 1989;17:316–321. doi: 10.1007/BF01650718. [DOI] [PubMed] [Google Scholar]
  • 30.Yong D, Limc Y, Song W, et al. Plasmid-mediated, inducible AmpC β-lactamase (DHA-1)-producing Enterobacteriaceae at a Korean hospital: wide dissemination in Klebsiella pneumoniae and Klebsiella oxytoca and emergence in Proteus mirabilis. Diagn Microbiol Infect Dis. 2005;53:65–70. doi: 10.1016/j.diagmicrobio.2005.03.008. [DOI] [PubMed] [Google Scholar]
  • 31.Pham JN, Chambers I, Poirel L, Nordmann P, Bell SM. Detection of a plasmid-mediated inducible cephalosporinase DHA-1 from Escherichia coli. Pathology. 2010;42(2):196–197. doi: 10.3109/00313020903494961. [DOI] [PubMed] [Google Scholar]
  • 32.Giakkoupi P, Tambic-Andrasevic A, Vourli S, et al. Transferable DHA-1 cephalosporinase in Escherichia coli. Int J Antimicrob Agents. 2006;27:77–80. doi: 10.1016/j.ijantimicag.2005.09.013. [DOI] [PubMed] [Google Scholar]
  • 33.Song W, Kim JS, Kim HS, et al. Emergence of Escherichia coli isolates producing conjugative plasmid-mediated DHA-1 β-lactamase in a Korean University Hospital. J. Hospital Infection. 2006;63:459–464. doi: 10.1016/j.jhin.2006.03.009. [DOI] [PubMed] [Google Scholar]
  • 34.Honore N, Nicolas MH, Cole ST. Inducible cephalosporinase production in clinical isolates of Enterobacter cloacae is controlled by a regulatory gene that has been deleted from Escherichia coli. EMBO J. 1986;5(13):3709–3714. doi: 10.1002/j.1460-2075.1986.tb04704.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Miriagou V, Tzouvelekis LS, Villa L, Lebessi E, Vatopoulos AC, Carattoli A, et al. CMY-13, a novel inducible cephalosporinase encoded by an Escherichia coli plasmid. Antimicrob Agents Chemother. 2004;48:3172–3174. doi: 10.1128/AAC.48.8.3172-3174.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Livermore DM. Clinical significance of β-lactamase induction and stable derepression in gram-negative rods. Eur. J. Clin. Microbiol. 1987;6:439–445. doi: 10.1007/BF02013107. [DOI] [PubMed] [Google Scholar]
  • 37.Reisbig MD, Ashfaque H, Nancy DH. Factors influencing gene expression and resistance for gram-negative organisms expressing plasmid-encoded ampC genes of Enterobacter origin. J Antimicrob Chemother. 2003;2003(51):1141–1151. doi: 10.1093/jac/dkg204. [DOI] [PubMed] [Google Scholar]
  • 38.Lister PD, Gardner VM, Sanders CC. Clavulanate induces expression of the Pseudomonas aeruginosa AmpC cephalosporinase at physiologically relevant concentrations and antagonizes the antibacterial activity of ticarcillin. Antimicrob Agents Chemother. 1999;43:882–889. doi: 10.1128/aac.43.4.882. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Mata C, Miro E, Alvarado A, et al. Plasmid typing and genetic context of AmpC β-lactamases in Enterobacteriaceae lacking inducible chromosomal ampC genes: findings from a Spanish hospital 1999–2007. J Antimicrob Chemother. 2012;67:115–122. doi: 10.1093/jac/dkr412. [DOI] [PubMed] [Google Scholar]
  • 40.Migma DT, Hyang NM, Geum CJ, Su RK, Myung HC, Suk CJ, et al. Molecular characterization of extended-spectrum-β-lactamase- producing and plasmid-mediated AmpC β-lactamase-producing Escherichia coli isolated from stray dogs in South Korea. Antimicrob Agents Chemother. 2012;56:2705–2712. doi: 10.1128/AAC.05598-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Lee CH, Liu JW, Li CC, Chien CC, Tang YF, Su LH. Spread of ISCR1 elements containing blaDHA-1 and multiple antimicrobial resistance genes leading to increase of flomoxef resistance in extended-spectrum-β-lactamase producing Klebsiella pneumoniae. Antimicrob Agents Chemother. 2011;55:4058–4063. doi: 10.1128/AAC.00259-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Kumarasamy KK, Toleman MA, Walsh TR, Bagaria J, Butt F, Balakrishnan R, et al. Emergence of a new antibiotic resistance mechanism in India, Pakistan, and the UK: a molecular, biological, and epidemiological study. Lancet Infect. Dis. 2012;10:597–602. doi: 10.1016/S1473-3099(10)70143-2. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All the relevant data and information are presented in the manuscript.


Articles from Annals of Clinical Microbiology and Antimicrobials are provided here courtesy of BMC

RESOURCES