Skip to main content
Infection and Immunity logoLink to Infection and Immunity
. 2017 Mar 23;85(4):e00009-17. doi: 10.1128/IAI.00009-17

Coinfection with Helicobacter pylori and Opisthorchis viverrini Enhances the Severity of Hepatobiliary Abnormalities in Hamsters

Rungtiwa Dangtakot a,b, Somchai Pinlaor c,d, Upsornsawan Itthitaetrakool e, Apisit Chaidee c,d, Chariya Chomvarin f,d, Arunnee Sangka b, Chotechana Wilailuckana b, Porntip Pinlaor b,d,✉
Editor: Steven R Blankeg
PMCID: PMC5364296  PMID: 28138021

ABSTRACT

Persistent infection with Opisthorchis viverrini causes hepatobiliary abnormalities, predisposing infected individuals to cholangiocarcinoma (CCA). In addition, Helicobacter pylori is highly prevalent in most countries and is a possible risk factor for CCA; however, its role in enhancing hepatobiliary abnormality is unclear. Here, we investigated the effects of coinfection with H. pylori and O. viverrini on hepatobiliary abnormality. Hamsters were divided into four groups: (i) normal, (ii) H. pylori infected (HP), (iii) O. viverrini infected (OV), and (iv) O. viverrini and H. pylori infected (OV+HP). At 6 months postinfection, PCR and immunohistochemistry were used to test for the presence of H. pylori in the stomach, gallbladder, and liver. In the liver, H. pylori was detected in the following order: OV+HP, 5 of 8 (62.5%); HP, 2 of 5 (40%); OV, 2 of 8 (25%). H. pylori was not detected in normal (control) liver tissues. Coinfection induced the most severe hepatobiliary abnormalities, including periductal fibrosis, cholangitis, and bile duct hyperplasia, leading to a significantly decreased survival rate of experimental animals. The greatest thickness of periductal fibrosis was associated with a significant increase in fibrogenesis markers (expression of alpha smooth muscle actin and transforming growth factor beta). Quantitative reverse transcription-PCR revealed that the highest expression levels of genes for proinflammatory cytokines (interleukin-1 [IL-1], IL-6, and tumor necrosis factor alpha) were also observed in the OV+HP group. These results suggest that coinfection with H. pylori and O. viverrini increased the severity of hepatobiliary abnormalities to a greater extent than either single infection did.

KEYWORDS: Helicobacter pylori, Opisthorchis viverrini, hepatobiliary disease, periductal fibrosis, cholangitis, hepatic inflammation

INTRODUCTION

Infection with the human liver fluke Opisthorchis viverrini causes opisthorchiasis, which is endemic in the Greater Mekong Subregion. In Thailand, approximately six million people are currently infected with O. viverrini and the highest prevalence rate is found in the northeastern regions (1, 2). This fluke is classified as a group 1 carcinogen by the International Agency for Research on Cancer because of its role in the development of cholangiocarcinoma (CCA) (3). Humans become infected after eating raw freshwater fish contaminated with the infective stage, the metacercaria. Newly excysted juvenile worms in the duodenum migrate into the hepatobiliary system and develop into adults within 1 month, promoting hepatobiliary abnormalities including hepatic dysplasia, bile duct hyperplasia, periductal fibrosis, and bile duct cancer (3). Fewer than 10% of the infected individuals in the community develop CCA (1, 2).

The etiology of CCA is multifactorial. The importance of single risk factors, such as bacterial infection, can be hard to gauge. A meta-analysis revealed that Helicobacter species in the hepatobiliary system are associated with CCA globally, as well as in liver fluke-free areas (4). One member of the genus, Helicobacter pylori, has also been classified as a group I carcinogen and is common in the gastroduodenal system (3). Recent reviews have reported that H. pylori infection is associated with several diseases outside the gastrointestinal tract, including in the hepatobiliary system (5, 6). The presence of H. pylori DNA in the gallbladder and gastric mucosa has been strongly associated with clinicopathological features of chronic cholecystitis patients, a risk condition for CCA (7). More than 50% of the human population worldwide is colonized by H. pylori. Prevalences are particularly high in developing countries, including in the northeastern part of Thailand (8). Although H. pylori has been detected in various organs and products such as the liver, bile, the gallbladder, and gallstones (9), its role in the development of hepatobiliary disease is unclear.

In areas of Thailand where flukes are endemic, H. pylori was found in 66.7% of the patients with CCA and 41.5% of the patients with cholelithiasis. The presence of H. pylori in the liver and gallbladder was associated with biliary inflammation and proliferation (10). Recently, H. pylori infection was found to be more prevalent in O. viverrini-infected hamsters than in normal hamsters, suggesting that the parasite in the bile duct is a reservoir of H. pylori and Helicobacter-like bacteria (11). Taken together, these lines of evidence support the hypothesis that H. pylori coinfection with O. viverrini synergistically increases the severity of hepatobiliary abnormalities.

To test this hypothesis, the present study aimed to clarify the effect of coinfection with H. pylori and O. viverrini on hepatobiliary abnormalities in a hamster model. The outcome of this study might help to explain the hepatobiliary changes in humans in areas where flukes are endemic. It might also be useful for suggesting modifications to the therapeutic approaches to the prevention and control of opisthorchiasis-associated CCA.

RESULTS

Clinical findings.

All of our experimental hamsters infected with both O. viverrini and H. pylori became debilitated. However, animals inoculated with H. pylori alone remained healthy and exhibited activity similar to that of normal controls. Before the end of the experiment, two hamsters in each of the groups inoculated with either H. pylori or O. viverrini alone had died, as also did seven hamsters infected with O. viverrini and H. pylori. Thus, five hamsters in the normal group, five hamsters in the H. pylori-infected (HP) group, and eight hamsters in both the O. viverrini-infected (OV) and O. viverrini- and H. pylori-infected (OV+HP) groups were terminated at the designated time point at 6 months.

The survival rate of the OV+HP group was statistically significantly lower than that of the normal control group (P = 0.0105, Fig. 1), whereas either OV or HP treatment alone decreased the survival rate, but not to a statistically significant level relative to that of controls. However, all normal hamsters were still alive at 6 months and did not show any clinical signs.

FIG 1.

FIG 1

Survival rates of animals in the H. pylori-infected (HP) group, the O. viverrini-infected (OV) group, and the group coinfected with O. viverrini and H. pylori (OV+HP) compared with that of normal (N) hamsters.

Detection of H. pylori by PCR and immunohistochemistry.

The prevalence of H. pylori in all gastric, gallbladder, and liver samples, as detected by PCR and immunohistochemistry, is summarized in Table 1. PCR analysis of liver samples revealed H. pylori DNA in 2 of 8 (25%), 2 of 5 (40%), and 4 of 8 (50%) hamsters in the OV, HP, and OV+HP groups, respectively; H. pylori DNA was not detected in any normal liver sample.

TABLE 1.

Prevalence of H. pylori in gastric, liver, and gallbladder samples, as detected by PCR and immunohistochemistry

Group and specimen % (no./total) of samples H. pylori positive by:
% (no./total) of samples H. pylori positive
PCR IHC
Normal (n = 5)
    Stomach 20 (1/5) 0 (0/5) 20 (1/5)
    Liver 0 (0/5) 0 (0/5) 0 (0/5)
    Gallbladder 0 (0/5) NDa 0 (0/5)
HP (n = 5)
    Stomach 40 (2/5) 20 (1/5) 40 (2/5)
    Liver 40 (2/5) 20 (1/5) 40 (2/5)
    Gallbladder 0 (0/5) ND 0 (0/5)
OV (n = 8)
    Stomach 50 (4/8) 0 (0/8) 50 (4/8)
    Liver 25 (2/8) 0 (0/8) 25 (2/8)
    Gallbladder 12.5 (1/8) ND 12.5 (1/8)
OV+HP (n = 8)
    Stomach 62.5 (5/8) 62.5 (5/8) 75 (6/8)
    Liver 50 (4/8) 25 (2/8) 62.5 (5/8)
    Gallbladder 12.5 (1/8) ND 12.5 (1/8)
a

ND, not determined.

Immunohistochemistry demonstrated H. pylori in liver sections from the HP group (1 of 5, 20%) and the OV+HP group (2 of 8, 25%) but not in the OV and normal groups (Fig. 2).

FIG 2.

FIG 2

Representative images of immunohistochemistry with antibody against H. pylori demonstrating the bacterium in gastric and liver tissues. No colonization of H. pylori in gastric (a, e) or liver (b, f) tissues was found in control hamsters (Normal) or in O. viverrini-infected hamsters (OV). Colonization of H. pylori was observed in a gastric pit (c, g) and in the liver tissues (d, h) of H. pylori-infected hamsters (HP) and in H. pylori- and O. viverrini-infected hamsters (OV+HP). Arrows indicate positive signals. Scale bars, 10 μm.

The overall prevalences of H. pylori in gastric samples were 20, 40, 50, and 75% in the normal, HP, OV, and OV+HP groups, respectively. The corresponding results for liver samples from the OV, HP, and OV+HP groups were 25, 40, and 62.5%, respectively. No H. pylori was found in the liver tissues of the normal group.

Histopathological finding.

Gastric lesions, including ulcers, mucosal hyperplasia, and gland proliferation, were observed in one hamster in the HP group and one hamster in the OV+HP group. In contrast, such lesions were not observed in normal or OV group hamsters (see Fig. S1 in the supplemental material).

Cholangitis was not observed in any hamster in the normal control group (Fig. 3a). Only one hamster in the HP group showed mild invasion of inflammatory cells around the bile duct (Fig. 3b). Around the bile ducts containing adult worms (OV and OV+HP groups), marked accumulations of inflammatory cells were evident (Fig. 3c and d). The most severe histopathological changes were observed in the OV+HP group. These changes included infiltration by inflammatory cells, thickening of periductal fibrosis, lymphoid follicles, and cholangitis. Cholangitis was observed in hamsters in the OV and OV+HP groups. The grade scores of cholangitis increased in the order HP group, OV group, and OV+HP group (Table 2). Although the OV and OV+HP groups exhibited similar cholangitis grade scores, massive invasion of inflammatory cells around the bile duct, with abscess formation in the liver and bile duct hyperplasia, was more evident in the OV+HP group than in the OV group.

FIG 3.

FIG 3

Representative images of hepatobiliary abnormalities in H&E-stained sections. Panels: a, normal liver and hepatocytes; b, liver tissue after H. pylori infection; c, e, and g, liver tissues of O. viverrini-infected hamsters; c and e, cell infiltration around the bile duct with and without O. viverrini (Ov) inside; g, inflammatory cell infiltration in liver tissues; d, f, and h, liver tissues of O. viverrini- and H. pylori-infected hamsters; d, inflammatory cell infiltration around the bile duct within which is an adult O. viverrini (Ov) fluke; f, massive inflammatory cell infiltration and bile duct hyperplasia (arrows) in an O. viverrini- and H. pylori-infected hamster; h, liver abscess formation (arrow). Scale bars, 100 μm.

TABLE 2.

Effects of coinfection with H. pylori and O. viverrini on fibrosis grade, cholangitis grade, and serum biochemical factors in experimental animalsa

Exptl group Fibrosis grade Cholangitis grade Concn (U/liter) in serum of:
ALT AST ALP
Normal 0.17 ± 0.19 0.00 ± 0.00 41.60 ± 2.07 47.20 ± 4.32 55.00 ± 16.54
HP 1.07 ± 0.36b 0.20 ± 0.44 52.40 ± 39.16 60.80 ± 28.93 54.40 ± 11.65
OV 2.79 ± 0.43b,c 2.18 ± 0.26b 57.63 ± 17.32 59.75 ± 12.22 58.75 ± 3.88
OV+HP 3.29 ± 0.60b,c 2.56 ± 0.50b,c 74.13 ± 46.08 68.75 ± 17.96 55.63 ± 18.63
a

All numerical values are means ± standard deviations.

b

P < 0.05 compared to normal group.

c

P < 0.05 compared to HP group.

Fibrosis in hamster livers.

Liver collagen content was determined by Picrosirius Red staining (Fig. 4A), which facilitated the scoring of fibrosis. The fibrosis grade scores increased in the order HP group, OV group, and OV+HP group (Table 2). All hamsters in the HP group exhibited mild fibrous expansion of some portal areas and parenchyma. All of the hamsters in the OV group developed moderate-to-severe fibrous expansion of most portal areas with short fibrous septa or occasional portal-to-portal bridging. Two hamsters in the OV+HP group developed moderate fibrous expansion of most portal areas with short fibrous septa, four hamsters developed severe fibrous expansion of most portal areas with occasional portal-to-portal bridging, and two hamsters developed more severe fibrous expansion of most portal areas with marked bridging. Interestingly, the most severe fibrosis was observed in the OV+HP group, especially in individuals positive for H. pylori. No fibrosis was observed in the normal group.

FIG 4.

FIG 4

Representative images of fibrosis in liver tissue visualized by Picrosirius Red staining (A) and expression of α-SMA protein in liver tissues (B) and its abundance relative to that of β-tubulin (C). Twenty-six samples were run in two gels at the same time. A pooled sample was included in both gels. Each experimental group was separated into a different image. The Western blot image of the OV group was obtained from two different gels, as indicated by the thin line (B, third set of images, between OV3 and OV4). Scale bars, 100 μm. Experimental groups are defined in the legend to Fig. 1. The number indicates each individual animal within the group. -ve, negative; +ve, positive. *, P < 0.05 compared to normal group; †, P < 0.05 compared to H. pylori-infected group; ‡, P < 0.05 compared to O. viverrini-infected group.

Expression of α-SMA in hamster livers.

To evaluate fibrosis, we investigated the expression level of alpha smooth muscle actin (α-SMA) by Western blotting (Fig. 4B). In the normal and HP groups, α-SMA was hardly detected by Western blotting. The greatest α-SMA band intensity was observed in some of the hamsters in the OV group (2 of 8) and in the OV+HP group (5 of 8). Interestingly, the relative intensities of α-SMA expression were significantly greater in the OV+HP group than in the OV group (P < 0.05) (Fig. 4C).

Expression of cytokines related to inflammation and fibrogenesis.

The expression of mRNAs encoding proinflammatory and profibrotic cytokines in hamster livers was examined by quantitative reverse transcription (qRT)-PCR (Fig. 5). The relative interleukin-1 (IL-1), IL-6, tumor necrosis factor alpha (TNF-α), and transforming growth factor beta (TGF-β) mRNA expression levels were similar in the normal and HP groups. In the OV and OV+HP groups, the IL-1, IL-6, and TNF-α expression levels were higher than in the normal and HP groups. Moreover, the expression of the profibrotic marker TGF-β was significantly higher in the livers of the OV+HP group than in those of the OV group (P < 0.05).

FIG 5.

FIG 5

Expression of mRNA encoding proinflammatory and profibrotic cytokines in hamster livers, as analyzed by qRT-PCR. The data are presented as the mean ± the standard error of the mean. Analysis of variance was used to compare relative mRNA expression levels. *, P < 0.05 compared to the normal group; †, P < 0.05 compared to the H. pylori-infected group; ‡, P < 0.05 compared to the O. viverrini-infected group. Experimental groups are defined in the legend to Fig. 1.

Changes in biochemical parameters of serum.

As shown in Table 2, there were no significant differences in the serum aspartate transferase (AST), alanine transferase (ALT), and alkaline phosphatase (ALP) levels of the experimental groups. However, one hamster in the HP group that was positive for H. pylori exhibited elevated serum ALT and AST levels (122 and 111 U/liter, respectively). In the OV+HP group, one hamster positive for H. pylori also showed increased serum ALT and AST levels (133 and 104 U/liter, respectively); another hamster, found to be H. pylori negative, exhibited an increased serum ALT level (159 U/liter).

DISCUSSION

A previous study in an area where opisthorchiasis is endemic demonstrated H. pylori in CCA tissues (10), and that bacterium is considered to be associated with hepatobiliary disease in humans (10). Indeed, H. pylori showed the highest prevalence in gastric biopsy tissues where O. viverrini is endemic (8). Despite this, there have been no detailed studies of hepatobiliary abnormalities in the H. pylori-infected opisthorchiasis hamster model: the present study is the first to do this. As we know, in acute infection, O. viverrini releases antigens that activate host-parasite interactions resulting in inflammatory cell infiltration, an excess of cytokine and free radical production, bile duct epithelial hyperplasia, and injury of epithelial and hepatic cells. In chronic infection, myofibroblasts become activated and migrate into the damaged tissue and synthesize extracellular matrix (ECM) components leading to increased periductal fibrosis, which might be one possible risk condition for CCA development (2).

Here, we have demonstrated the effect of coinfection with H. pylori and O. viverrini on histopathological changes in the hamster liver. Coinfection promoted more severe hepatobiliary abnormalities than did either single infection. The pathological changes seen included cholangitis and periductal fibrosis, leading to a decreased hamster survival rate. This was accompanied by upregulated expression of the genes encoding the proinflammatory cytokines IL-1, IL-6, and TNF-α and the profibrotic cytokine TGF-β, which showed the highest levels in the coinfected group. Cholangitis, periductal fibrosis, and bile duct hyperplasia were also found to be the most severe in some hamster livers in the coinfected group. In addition, the expression of α-SMA protein, an indicator of myofibroblasts, increased significantly in the group coinfected with both pathogens compared to O. viverrini infection alone.

Previously, we have sequentially reported that O. viverrini infection induces inflammation-mediated oxidative stress (12), leading to accumulated periductal fibrosis increasing with time (13), and that the fibrotic lesion plays an important role in the genesis of CCA in hamsters (14). In this study, periductal fibrosis was most prominent in hamsters coinfected with H. pylori and O. viverrini, suggesting that H. pylori may also accelerate the fibrogenesis that occurs during O. viverrini infection.

The enhanced periductal fibrosis seen in the coinfected group was associated with increased expression of genes for inflammatory factors such as IL-1, IL-6, and TNF-α, in addition to any IL-17 and gamma interferon response that might occur because of H. pylori in gastric lesions (15). Upregulated expression of IL-6 has been noted previously in O. viverrini (16) and H. pylori single infections (17), which might synergistically induce inflammation-mediated liver injury through oxidative stress (12, 17). As a result of this, the lipopolysaccharide of bacteria, including H. pylori, can induce TGF-β signaling through Toll-like receptor 4 (18), contributing to fibrogenesis. Synergistic induction of TGF-β induces the activation of myofibroblasts, leading to the synthesis of large amounts of extracellular component proteins to restore injured tissues. Finally, the excessive accumulation of ECM components promotes the formation of the most prominent periductal fibrosis during O. viverrini and H. pylori coinfection. Relevantly, a combination of H. pylori and carbon tetrachloride treatment can enhance the severity of hepatic fibrosis in animals (19). Also, in chronic hepatitis C patients, coinfection with H. pylori can enhance liver fibrosis and cirrhosis (20).

It is notable that not all of the animals in the H. pylori-treated (HP and OV+HP) groups exhibited severe hepatobiliary abnormalities. Most of the individuals exhibiting abnormalities returned positive tests for H. pylori in the liver. In the HP group, two hamsters positive for H. pylori showed mild fibrous expansion of some portal areas and parenchyma and one of them had highly elevated ALT and AST levels. In the OV+HP group, among five hamsters positive for H. pylori, severe periductal fibrosis with marked bridging was seen in four. Among those with severe hepatic lesions, three hamsters showed intense α-SMA protein expression and one hamster had highly increased serum ALT and AST levels. In contrast, one hamster in the coinfection group was negative for H. pylori but exhibited an increased plasma ALT level and cholangitis, suggesting that other bacterial infections could not be excluded as an explanation. Similarly, two hamsters in the OV group with moderate-to-severe periductal fibrosis were negative for H. pylori and exhibited slightly increased levels of ALT and AST.

The question of whether other Helicobacter species might play a role in hepatobiliary disease arises. Hamsters have been found naturally infected in various tissues with several novel Helicobacter spp. (21–24) belonging to the H. bilis cluster, which is known to be involved in hepatobiliary lesions (21, 25). To support this, H. bilis could be detected in 14.9 and 9.4% of patients with CCA and cholelithiasis, respectively, and was absent from the control group (10). On the other hand, H. pylori, a group 1 carcinogen, was detected at a higher prevalence (66.7% in patients with CCA, 41.5% in patients with cholelithiasis, and 25.0% in control groups) than H. bilis was (10). Therefore, we strongly believe that H. pylori rather than H. bilis is involved in the pathogenesis of hepatobiliary diseases in Thai patients (26).

DNA of H. pylori has been detected in the liver tissue, bile, gallbladders, and gallstones of patients with hepatobiliary diseases. It is not clear how H. pylori enters the hepatobiliary system. In mice inoculated orally with H. pylori, the stomach was the most common site (86%) but the infection rate in the hepatobiliary system was only 40% (27). In the present study, in the HP group, H. pylori was detected in 40% of the liver samples tested, a prevalence similar to that in the gastric samples. In hamsters infected with O. viverrini alone, H. pylori was detected in 50% of the gastric tissues tested but was less prevalent in the hepatobiliary system (25%) than in the HP group, suggesting that oral inoculation with H. pylori permits its transmission to the biliary system with or without the presence of flukes. There appears to be a background level of natural infection of gastric tissue (but not liver tissue) with H. pylori in our hamsters, which was similar to findings in a previously study (11, 28). Inoculation with additional H. pylori and/or the presence of worms was associated with the presence of H. pylori in the biliary system.

Moreover, our results showed that when hamsters were orally inoculated with H. pylori and O. viverrini, the rates of H. pylori detection in gastric and liver tissues increased to 75% and 62.5%, respectively. The rate of H. pylori colonization was higher in the coinfected group than in either of the single-infection groups. H. pylori may reach the liver in three possible ways. The first is by causing gastric injury, facilitating transport to the liver via the bloodstream (29). Second, when inoculated with O. viverrini, H. pylori may be carried into the hepatobiliary system directly by the worms (11). Third, physical obstruction of the bile ducts by O. viverrini infection (30) may lead to increased pressure and a low pH within the biliary tract, which might permit influx of H. pylori from the gastrointestinal tract into the hepatobiliary system.

In addition, H. pylori was detected by PCR but not by immunostaining in two hamsters inoculated with O. viverrini alone. This may have represented natural infection. Alternatively, H. pylori DNA in the stomach may have been passively carried to the hepatobiliary system (31). In some individual hamsters inoculated with H. pylori, the bacterium could be detected in the liver sample by PCR or immunohistochemical staining but not in the gastric sample. This might be due to low numbers of bacteria colonizing the gastric site. The prevalences of H. pylori in the gallbladder were similar in the OV and OV+HP groups. This may be due to a limitation of this study, that we could not collect bile because of a significant decrease in bile production from as early as 1 month postinfection (p.i.). Moreover, the status of our hamsters with regard to Helicobacter infection was not determined before the start of the experiment. Nor did we determine the genetic profile of H. pylori (e.g., with respect to the cagA and vacA genes) in the samples. However, we did inoculate our experimental animals with a virulent H. pylori strain (DMST20165) that is cagA+ and vacA+. These virulence genes are likely to enhance the severity of hepatobiliary diseases (32) and peptic ulcers (33). We believe that a virulent strain of H. pylori is more likely to accelerate the induction of hepatobiliary diseases in addition to O. viverrini infection alone.

In summary, this study showed that H. pylori orally inoculated could not only cause gastric lesions but could also reach the hepatobiliary system, enhancing the severity of hepatobiliary abnormalities such as periductal fibrosis and cholangitis, leading to significantly decreased survival rates in experimental opisthorchiasis. Longitudinal studies using a larger number of animals and extensive studies of H. pylori virulence gene profiles should be performed for risk assessment of opisthorchiasis-associated CCA to confirm this finding. This provides greater understanding of the effect of H. pylori not only in experimental opisthorchiasis but also in coinfection with H. pylori with other helminth-related hepatobiliary diseases. In addition, it might be useful when considering relevant therapeutic approaches to human opisthorchiasis-associated CCA.

MATERIALS AND METHODS

Bacterial strain.

H. pylori strain DMST20165 (cagA+ vacA+ ureA+), obtained from the National Institute of Health, Department of Medical Sciences, Ministry of Public Health, Thailand, was used in this study. H. pylori was grown on 10% sheep blood agar and incubated for 48 to 72 h at 37°C under microaerobic conditions (10% CO2, 5% O2, and 85% N2) with CampyGen 3.5L (Oxoid Ltd.). Enrichment of bacterial growth on the plates was confirmed by biochemical tests including catalase, oxidase, urease, and Gram staining. Next, H. pylori was subcultured in brucella broth supplemented with 10% fetal bovine serum for 24 h at 37°C under microaerobic conditions in an incubator shaker and then checked for urease, catalase, and oxidase activities. After that, cells were suspended in phosphate-buffered saline (PBS) to an optical density at 600 nm of 1.000 (∼109 CFU) (34) under microaerobic conditions and were ready for inoculation by gastric intubation.

Preparation of O. viverrini metacercariae.

O. viverrini metacercariae were isolated from the naturally infected cyprinoid fishes by artificial pepsin digestion (0.25% pepsin A; BDH, USA) as previously described elsewhere (13). Metacercariae of O. viverrini were identified under a stereomicroscope.

Animals.

Male Syrian golden hamsters (Mesocricetus auratus) 4 to 6 weeks old were obtained from the Animal Unit, Faculty of Medicine, Khon Kaen University, Khon Kaen, Thailand. These animals were used in this study because the anatomical structure of the hamster hepatobiliary system is similar to that of humans and it is a susceptible host for O. viverrini. Animals were housed under conventional conditions and given food and water ad libitum. The study protocol was reviewed and approved by the Animal Ethics Committee of Khon Kaen University (reference no. 0514.1.75/21). The standard guidelines of the Ethics of Animal Experimentation of the National Research Council of Thailand were followed to ensure the health and well-being of our study animals. All of the animals enrolled in the experiment were healthy, and their health status was monitored daily. Before use, cages were washed with Dettol, a liquid antiseptic and disinfectant, and then with washing-up liquid (Sunlight, a cleaning product) and finally fully dried. Bedding was autoclaved before the start of the experiment. Cages and bedding were changed once or twice a week.

Experimental design.

Forty animals were divided into four groups: (i) normal controls (n = 5), (ii) H. pylori infected (HP; n = 10), (iii) O. viverrini infected (OV; n = 10), and (iv) H. pylori and O. viverrini infected (OV+HP; n = 15). Metacercariae of O. viverrini and H. pylori were administered to hamsters via gastric intubation. For the H. pylori-infected groups, hamsters were infected with 0.5 ml of H. pylori suspended in PBS (approximately 5 × 108 CFU) within 1 h of preparation of the bacteria under microaerophilic conditions. Hamsters in the O. viverrini-infected groups were infected with 50 fluke metacercariae in normal saline solution. Usually, H. pylori colonizes the stomach. To maximize the chances of the bacterium reaching the hepatobiliary system, H. pylori was administered to hamsters 1 week before and 1 month after O. viverrini infection (by which time the worms have matured and already produced inflammation-mediated bile duct and liver injuries).

Specimen collection.

At 6 months p.i., hamsters were sacrificed by sodium pentobarbital anesthesia. For DNA isolation, stomach, liver, and gallbladder tissues were collected, snap-frozen in liquid nitrogen, and stored at −80°C until use. For RNA isolation, livers were collected in TRIzol reagent and stored at −80°C until use. For histopathological and immunohistochemical studies, stomach and liver tissues were collected and fixed in 10% buffered formalin. Blood samples were taken from the heart and centrifuged at 3,000 rpm for 10 min at 4°C, and serum was collected, divided into 400-μl aliquots, and kept at −80°C until used for biochemical analyses.

Histopathology and immunohistochemistry.

Hamster liver and stomach samples were fixed in neutral buffered 10% formalin, embedded in paraffin wax, sectioned at 5 μm, and stained with hematoxylin and eosin (H&E). The grade of cholangitis visible in liver sections was scored according to the infiltration of inflammatory cells as follows: grade 0, no cholangitis; grade 1, mild invasion of inflammatory cells around the bile duct; grade 2, severe invasion of inflammatory cells around the bile duct; grade 3, abscess formation in the liver (35). Deposition of collagen at sites of hepatic and periductal fibrosis was stained with the Picrosirius Red Stain kit (Polysciences, Inc., Warrington, PA, USA) in accordance with the manufacturer's instructions. Periductal fibrosis was graded under a bright-field microscope (Carl Zeiss, Jena, Germany) into five stages as follows: grade 0, no fibrosis; grade 1, mild fibrous expansion of some portal areas; grade 2, moderate fibrous expansion of most portal areas with short fibrous septa; grade 3, severe fibrous expansion of most portal areas with occasional portal-to-portal bridging; grade 4, more severe fibrous expansion of most portal areas with marked bridging (36).

The presence of H. pylori in stomach and liver samples was identified by immunostaining with a rabbit anti-H. pylori polyclonal antibody (ab7788, 1:10 dilution; Abcam, Cambridge, MA, USA), counterstained with Mayer's hematoxylin, and examined with a bright-field microscope.

Western blot analysis.

Hepatic fibrosis was also confirmed by the expression of α-SMA. The concentration of protein extracted from a liver sample was determined with a Bio-Rad protein assay kit (Bio-Rad, Hercules, CA, USA). Twenty micrograms of protein was used for Western blotting and stained with an anti-α-SMA antibody (ab5694, 1:1,000; Abcam) and β-tubulin (9F3) rabbit monoclonal antibody (catalog no. 2128S, 1:100; Cell Signaling Technology, USA) solution at 4°C overnight. Immunostaining was detected with an ECL Prime Western blotting detection kit (GE Healthcare, Maidstone, United Kingdom). Relative band density was quantified with myImageAnalysis v2.0 software (Life Technologies, Thermo Fisher Scientific, Carlsbad, CA, USA).

DNA extraction.

With a QIAamp Tissue kit (Qiagen, Germany), DNA was extracted from pieces of 15 to 25 mg cut from frozen samples of stomach, liver, and gallbladder tissues. DNA concentrations were measured with a NanoDrop 2000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). The purity of DNA in individual samples was assessed by measuring absorbance at 260 and 280 nm; ratios of these values ranging from 1.7 to 2.1 were considered acceptable.

PCR amplification.

Amplification of DNA extracted from gastric, liver, and gallbladder tissues was done with Helicobacter genus-specific 16S rRNA primers. Identification of H. pylori was done with H. pylori ureA primers (for primer sequences and PCR conditions, see Table S1) (28). The primers were checked for specificity by BLAST searches at https://blast.ncbi.nlm.nih.gov. The 20-μl PCR mixture included 1× PCR buffer, 1 mM MgCl2, 0.3 mM deoxynucleoside triphosphates, 0.25 μM each primer, 1 U of platinum Taq DNA polymerase, and 300 ng of template DNA. Negative controls without template DNA and positive controls with H. pylori DNA were run in parallel. The PCRs were run in a thermal cycler and an Expand High Fidelity PCR System (Bio-Rad C1000 thermal cycler). The amplified PCR products were separated by electrophoresis on 1.5% agarose gels along with a 100 bp Plus DNA Ladder and visualized with UV light after staining with ethidium bromide.

Gene expression study.

To determine TNF-α, IL-1, IL-6, and TGF-β mRNA expression, total RNA was extracted from frozen hamster liver tissue with TRIzol (Invitrogen, Carlsbad, CA, USA). The concentration of RNA was measured with a NanoDrop 2000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). The purity of the RNA in individual samples was assessed by measuring absorbance at 260 and 280 nm; ratios of these values ranging from 1.99 to 2.1 were considered acceptable. cDNA was synthesized with RevertAid reverse transcriptase (Thermo Scientific) and used for qRT-PCR. The specific primer pairs used for amplification of hamster genes were as follows: IL-1, 5′GCCCATCTTCTGTGACTCCT3′ (forward) and 5′TGGAGAACACCACTTGTTGG3′ (reverse); IL-6, 5′GACTTCACAGAGGACACTAC3′ (forward) and 5′CACATAGTCATTGTCCATACAG3′ (reverse); TNF-α, 5′GACGGGCTGTACCTGGTTTA3′ (forward) and 5′GAGTCGGTCACCTTTCTCCA3′ (reverse); TGF-β, 5′ACATCGACTTTCGCAAGGAC3′ (forward) and 5′TGGTTGTAGAGGGCAAGGAC3′ (reverse); GAPDH, 5′AGAAGACTGTGGATGGCCCC3′ (forward) and 5′TGACCTTGCCCACAGCCTT3′ (reverse). Relative mRNA expression was analyzed with a LightCycler 480 II with LightCycler 480 SYBR green I Master. All data were analyzed relative to GAPDH mRNA with LightCycler 480 software and then processed by the 2−ΔΔCT method (37).

Biochemical analyses.

Serum AST, ALT, and ALP levels, the indicators of liver and bile duct injury, were measured with an automated spectrophotometer (automate RA100) with a commercial kit (Thermo Trace Ltd., Melbourne, Australia).

Statistical analysis.

To compare two groups, nonparametric data were analyzed with Kruskal-Wallis and Mann-Whitney U tests and parametric data were analyzed by analysis of variance. P values of <0.05 were considered significant. All statistical analyses were performed with the SPSS version 19 statistical program.

Supplementary Material

Supplemental material

ACKNOWLEDGMENTS

This work was supported by a grant from The Thailand Research Fund and Khon Kaen University, Thailand (TRG5680032), and the Khon Kaen University Research Fund (KKU590302). Rungtiwa Dangtakot was supported by the Center for Research and Development of Medical Diagnostic Laboratories, Faculty of Associated Medical Sciences, Khon Kaen University.

We thank The National Institute of Health, Department of Medical Sciences, Ministry of Public Health, Thailand, for providing H. pylori strain DMST20165. We also thank David Blair at the publication clinic for his advice and English presentation.

P.P., S.P., C.C., A.S., and C.W. contributed to the experimental design of the study. R.D., U.I., and A.C. performed the experiments and data analysis and drafted the manuscript. P.P. and S.P. read and corrected the manuscript.

We have no competing interests to declare.

Footnotes

Supplemental material for this article may be found at https://doi.org/10.1128/IAI.00009-17.

REFERENCES

  • 1.Sithithaworn P, Yongvanit P, Duenngai K, Kiatsopit N, Pairojkul C. 2014. Roles of liver fluke infection as risk factor for cholangiocarcinoma. J Hepatobiliary Pancreat Sci 21:301–308. doi: 10.1002/jhbp.62. [DOI] [PubMed] [Google Scholar]
  • 2.Sripa B, Brindley PJ, Mulvenna J, Laha T, Smout MJ, Mairiang E, Bethony JM, Loukas A. 2012. The tumorigenic liver fluke Opisthorchis viverrini—multiple pathways to cancer. Trends Parasitol 28:395–407. doi: 10.1016/j.pt.2012.07.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.IARC Working Group on the Evaluation of Carcinogenic Risks to Humans. 2012. Biological agents. Volume 100 B. A review of human carcinogens. IARC Monogr Eval Carcinog Risks Hum 100(Pt B):1–441. [PMC free article] [PubMed] [Google Scholar]
  • 4.Xiao M, Gao Y, Wang Y. 2014. Helicobacter species infection may be associated with cholangiocarcinoma: a meta-analysis. Int J Clin Pract 68:262–270. doi: 10.1111/ijcp.12264. [DOI] [PubMed] [Google Scholar]
  • 5.Franceschi F, Zuccala G, Roccarina D, Gasbarrini A. 2014. Clinical effects of Helicobacter pylori outside the stomach. Nat Rev Gastroenterol Hepatol 11:234–242. doi: 10.1038/nrgastro.2013.243. [DOI] [PubMed] [Google Scholar]
  • 6.Roubaud Baudron C, Franceschi F, Salles N, Gasbarrini A. 2013. Extragastric diseases and Helicobacter pylori. Helicobacter 18(Suppl 1):S44–S51. doi: 10.1111/hel.12077. [DOI] [PubMed] [Google Scholar]
  • 7.Zhou D, Guan WB, Wang JD, Zhang Y, Gong W, Quan ZW. 2013. A comparative study of clinicopathological features between chronic cholecystitis patients with and without Helicobacter pylori infection in gallbladder mucosa. PLoS One 8:e70265. doi: 10.1371/journal.pone.0070265. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Uchida T, Miftahussurur M, Pittayanon R, Vilaichone RK, Wisedopas N, Ratanachu-Ek T, Kishida T, Moriyama M, Yamaoka Y, Mahachai V. 2015. Helicobacter pylori infection in Thailand: a nationwide study of the CagA phenotype. PLoS One 10:e0136775. doi: 10.1371/journal.pone.0136775. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Lee JW, Lee DH, Lee JI, Jeong S, Kwon KS, Kim HG, Shin YW, Kim YS, Choi MS, Song SY. 2010. Identification of Helicobacter pylori in gallstone, bile, and other hepatobiliary tissues of patients with cholecystitis. Gut Liver 4:60–67. doi: 10.5009/gnl.2010.4.1.60. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Boonyanugomol W, Chomvarin C, Sripa B, Bhudhisawasdi V, Khuntikeo N, Hahnvajanawong C, Chamsuwan A. 2012. Helicobacter pylori in Thai patients with cholangiocarcinoma and its association with biliary inflammation and proliferation. HPB (Oxford) 14:177–184. doi: 10.1111/j.1477-2574.2011.00423.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Deenonpoe R, Chomvarin C, Pairojkul C, Chamgramol Y, Loukas A, Brindley PJ, Sripa B. 2015. The carcinogenic liver fluke Opisthorchis viverrini is a reservoir for species of Helicobacter. Asian Pac J Cancer Prev 16:1751–1758. doi: 10.7314/APJCP.2015.16.5.1751. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Pinlaor S, Hiraku Y, Ma N, Yongvanit P, Semba R, Oikawa S, Murata M, Sripa B, Sithithaworn P, Kawanishi S. 2004. Mechanism of NO-mediated oxidative and nitrative DNA damage in hamsters infected with Opisthorchis viverrini: a model of inflammation-mediated carcinogenesis. Nitric Oxide 11:175–183. doi: 10.1016/j.niox.2004.08.004. [DOI] [PubMed] [Google Scholar]
  • 13.Prakobwong S, Pinlaor S, Yongvanit P, Sithithaworn P, Pairojkul C, Hiraku Y. 2009. Time profiles of the expression of metalloproteinases, tissue inhibitors of metalloproteases, cytokines and collagens in hamsters infected with Opisthorchis viverrini with special reference to peribiliary fibrosis and liver injury. Int J Parasitol 39:825–835. doi: 10.1016/j.ijpara.2008.12.002. [DOI] [PubMed] [Google Scholar]
  • 14.Prakobwong S, Yongvanit P, Hiraku Y, Pairojkul C, Sithithaworn P, Pinlaor P, Pinlaor S. 2010. Involvement of MMP-9 in peribiliary fibrosis and cholangiocarcinogenesis via Rac1-dependent DNA damage in a hamster model. Int J Cancer 127:2576–2587. doi: 10.1002/ijc.25266. [DOI] [PubMed] [Google Scholar]
  • 15.Bhuiyan TR, Islam MM, Uddin T, Chowdhury MI, Janzon A, Adamsson J, Lundin SB, Qadri F, Lundgren A. 2014. Th1 and Th17 responses to Helicobacter pylori in Bangladeshi infants, children and adults. PLoS One 9:e93943. doi: 10.1371/journal.pone.0093943. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Sripa B, Mairiang E, Thinkhamrop B, Laha T, Kaewkes S, Sithithaworn P, Tessana S, Loukas A, Brindley PJ, Bethony JM. 2009. Advanced periductal fibrosis from infection with the carcinogenic human liver fluke Opisthorchis viverrini correlates with elevated levels of interleukin-6. Hepatology 50:1273–1281. doi: 10.1002/hep.23134. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Piao JY, Lee HG, Kim SJ, Kim DH, Han HJ, Ngo HK, Park SA, Woo JH, Lee JS, Na HK, Cha YN, Surh YJ. 2016. Helicobacter pylori activates IL-6-STAT3 signaling in human gastric cancer cells: potential roles for reactive oxygen species. Helicobacter 21:405–416. doi: 10.1111/hel.12298. [DOI] [PubMed] [Google Scholar]
  • 18.Seki E, De Minicis S, Osterreicher CH, Kluwe J, Osawa Y, Brenner DA, Schwabe RF. 2007. TLR4 enhances TGF-β signaling and hepatic fibrosis. Nat Med 13:1324–1332. doi: 10.1038/nm1663. [DOI] [PubMed] [Google Scholar]
  • 19.Goo MJ, Ki MR, Lee HR, Yang HJ, Yuan DW, Hong IH, Park JK, Hong KS, Han JY, Hwang OK, Kim DH, Do SH, Cohn RD, Jeong KS. 2009. Helicobacter pylori promotes hepatic fibrosis in the animal model. Lab Invest 89:1291–1303. doi: 10.1038/labinvest.2009.90. [DOI] [PubMed] [Google Scholar]
  • 20.Sakr SA, Badrah GA, Sheir RA. 2013. Histological and histochemical alterations in liver of chronic hepatitis C patients with Helicobacter pylori infection. Biomed Pharmacother 67:367–374. doi: 10.1016/j.biopha.2013.03.004. [DOI] [PubMed] [Google Scholar]
  • 21.Fox JG, Shen Z, Muthupalani S, Rogers AR, Kirchain SM, Dewhirst FE. 2009. Chronic hepatitis, hepatic dysplasia, fibrosis, and biliary hyperplasia in hamsters naturally infected with a novel Helicobacter classified in the H. bilis cluster. J Clin Microbiol 47:3673–3681. doi: 10.1128/JCM.00879-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Patterson MM, Schrenzel MD, Feng Y, Xu S, Dewhirst FE, Paster BJ, Thibodeau SA, Versalovic J, Fox JG. 2000. Helicobacter aurati sp. nov., a urease-positive Helicobacter species cultured from gastrointestinal tissues of Syrian hamsters. J Clin Microbiol 38:3722–3728. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Simmons JH, Riley LK, Besch-Williford CL, Franklin CL. 2000. Helicobacter mesocricetorum sp. nov., a novel Helicobacter isolated from the feces of Syrian hamsters. J Clin Microbiol 38:1811–1817. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Zenner L. 1999. Pathology, diagnosis and epidemiology of the rodent Helicobacter infection. Comp Immunol Microbiol Infect Dis 22:41–61. doi: 10.1016/S0147-9571(98)00018-6. [DOI] [PubMed] [Google Scholar]
  • 25.Woods SE, Ek C, Shen Z, Feng Y, Ge Z, Muthupalani S, Whary MT, Fox JG. 2016. Male Syrian hamsters experimentally infected with Helicobacter spp. of the H. bilis cluster develop MALT-associated gastrointestinal lymphomas. Helicobacter 21:201–217. doi: 10.1111/hel.12265. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Matsukura N, Yokomuro S, Yamada S, Tajiri T, Sundo T, Hadama T, Kamiya S, Naito Z, Fox JG. 2002. Association between Helicobacter bilis in bile and biliary tract malignancies: H. bilis in bile from Japanese and Thai patients with benign and malignant diseases in the biliary tract. Jpn J Cancer Res 93:842–847. doi: 10.1111/j.1349-7006.2002.tb01327.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Huang Y, Tian XF, Fan XG, Fu CY, Zhu C. 2009. The pathological effect of Helicobacter pylori infection on liver tissues in mice. Clin Microbiol Infect 15:843–849. doi: 10.1111/j.1469-0691.2009.02719.x. [DOI] [PubMed] [Google Scholar]
  • 28.Itthitaetrakool U, Pinlaor P, Pinlaor S, Chomvarin C, Dangtakot R, Chaidee A, Wilailuckana C, Sangka A, Lulitanond A, Yongvanit P. 2016. Chronic Opisthorchis viverrini infection changes the liver microbiome and promotes Helicobacter growth. PLoS One 11:e0165798. doi: 10.1371/journal.pone.0165798. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Huang Y, Fan XG, Tang ZS, Liu L, Tian XF, Li N. 2006. Detection of Helicobacter pylori DNA in peripheral blood from patients with peptic ulcer or gastritis. APMIS 114:851–856. doi: 10.1111/j.1600-0463.2006.apm_425.x. [DOI] [PubMed] [Google Scholar]
  • 30.Kimura Y, Takada T, Kawarada Y, Nimura Y, Hirata K, Sekimoto M, Yoshida M, Mayumi T, Wada K, Miura F, Yasuda H, Yamashita Y, Nagino M, Hirota M, Tanaka A, Tsuyuguchi T, Strasberg SM, Gadacz TR. 2007. Definitions, pathophysiology, and epidemiology of acute cholangitis and cholecystitis: Tokyo guidelines. J Hepatobiliary Pancreat Surg 14:15–26. doi: 10.1007/s00534-006-1152-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Shukla HS, Tewari M. 2012. Discovery of Helicobacter pylori in gallbladder. Indian J Gastroenterol 31:55–56. doi: 10.1007/s12664-012-0178-0. [DOI] [PubMed] [Google Scholar]
  • 32.Boonyanugomol W, Chomvarin C, Sripa B, Chau-In S, Pugkhem A, Namwat W, Wongboot W, Khampoosa B. 2012. Molecular analysis of Helicobacter pylori virulent-associated genes in hepatobiliary patients. HPB (Oxford) 14:754–763. doi: 10.1111/j.1477-2574.2012.00533.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.van Doorn LJ, Figueiredo C, Sanna R, Plaisier A, Schneeberger P, de Boer W, Quint W. 1998. Clinical relevance of the cagA, vacA, and iceA status of Helicobacter pylori. Gastroenterology 115:58–66. doi: 10.1016/S0016-5085(98)70365-8. [DOI] [PubMed] [Google Scholar]
  • 34.Lee CW, Rao VP, Rogers AB, Ge Z, Erdman SE, Whary MT, Fox JG. 2007. Wild-type and interleukin-10-deficient regulatory T cells reduce effector T-cell-mediated gastroduodenitis in Rag2−/− mice, but only wild-type regulatory T cells suppress Helicobacter pylori gastritis. Infect Immun 75:2699–2707. doi: 10.1128/IAI.01788-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Kitajima T, Tajima Y, Matsuzaki S, Kuroki T, Fukuda K, Kanematsu T. 2003. Acceleration of spontaneous biliary carcinogenesis in hamsters by bilioenterostomy. Carcinogenesis 24:133–137. doi: 10.1093/carcin/24.1.133. [DOI] [PubMed] [Google Scholar]
  • 36.Goodman ZD. 2007. Grading and staging systems for inflammation and fibrosis in chronic liver diseases. J Hepatol 47:598–607. doi: 10.1016/j.jhep.2007.07.006. [DOI] [PubMed] [Google Scholar]
  • 37.Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental material

Articles from Infection and Immunity are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES