Skip to main content
NCBI home page
Plant Physiology logoLink to Plant Physiology
. 2017 Feb 24;173(4):2138–2147. doi: 10.1104/pp.16.01589

The Non-Mendelian Green Cotyledon Gene in Soybean Encodes a Small Subunit of Photosystem II1

Kaori Kohzuma 1,2,3,4,5,6,7,8,2,3, Yutaka Sato 1,2,3,4,5,6,7,8,2, Hisashi Ito 1,2,3,4,5,6,7,8, Ayako Okuzaki 1,2,3,4,5,6,7,8,4, Mai Watanabe 1,2,3,4,5,6,7,8, Hideki Kobayashi 1,2,3,4,5,6,7,8, Michiharu Nakano 1,2,3,4,5,6,7,8, Hiroshi Yamatani 1,2,3,4,5,6,7,8, Yu Masuda 1,2,3,4,5,6,7,8, Yumi Nagashima 1,2,3,4,5,6,7,8, Hiroyuki Fukuoka 1,2,3,4,5,6,7,8,5, Tetsuya Yamada 1,2,3,4,5,6,7,8, Akira Kanazawa 1,2,3,4,5,6,7,8, Keisuke Kitamura 1,2,3,4,5,6,7,8, Yutaka Tabei 1,2,3,4,5,6,7,8, Masahiko Ikeuchi 1,2,3,4,5,6,7,8, Wataru Sakamoto 1,2,3,4,5,6,7,8, Ayumi Tanaka 1,2,3,4,5,6,7,8, Makoto Kusaba 1,2,3,4,5,6,7,8,*
PMCID: PMC5373049  PMID: 28235890

Molecular cloning of a cytoplasmic stay-green mutant gene revealed that a small subunit of PSII is involved in chlorophyll b degradation.

Abstract

Chlorophyll degradation plays important roles in leaf senescence including regulation of degradation of chlorophyll-binding proteins. Although most genes encoding enzymes of the chlorophyll degradation pathway have been identified, the regulation of their activity has not been fully understood. Green cotyledon mutants in legume are stay-green mutants, in which chlorophyll degradation is impaired during leaf senescence and seed maturation. Among them, the soybean (Glycine max) green cotyledon gene cytG is unique because it is maternally inherited. To isolate cytG, we extensively sequenced the soybean chloroplast genome, and detected a 5-bp insertion causing a frame-shift in psbM, which encodes one of the small subunits of photosystem II. Mutant tobacco plants (Nicotiana tabacum) with a disrupted psbM generated using a chloroplast transformation technique had green senescent leaves, confirming that cytG encodes PsbM. The phenotype of cytG was very similar to that of mutant of chlorophyll b reductase catalyzing the first step of chlorophyll b degradation. In fact, chlorophyll b-degrading activity in dark-grown cytG and psbM-knockout seedlings was significantly lower than that of wild-type plants. Our results suggest that PsbM is a unique protein linking photosynthesis in presenescent leaves with chlorophyll degradation during leaf senescence and seed maturation. Additionally, we discuss the origin of cytG, which may have been selected during domestication of soybean.

The pea (Pisum sativum) green cotyledon gene, which is one of the genes upon which Mendel’s law of heredity was based, is called the I gene (Mendel, 1866). Mutations in this gene result in green mature seeds and senescent leaves because chlorophyll degradation is impaired (i.e. a stay-green mutant; Armstead et al., 2007; Sato et al., 2007). In 1918, Terao described the genetic behavior of a green cotyledon soybean (Glycine max) mutant (Terao, 1918). Surprisingly, although its phenotype was very similar to that of Mendel’s i mutant, the stay-green trait was maternally inherited, indicating that the relevant gene (later named cytG) was a non-Mendelian factor. The nuclear-encoded I gene encodes STAY-GREEN (SGR), which encodes Mg-dechelatase that catalyzes the first step of chlorophyll a (Chla) degradation (Armstead et al., 2007; Park et al., 2007; Sato et al., 2007; Shimoda et al., 2016). Although Terao predicted that cytG is present in the chloroplast, it has not been isolated.

Chlorophyll is essential for harvesting light energy during photosynthesis (Croce and van Amerongen, 2014). Most chlorophyll exists in chlorophyll-protein complexes embedded in thylakoid membranes. Chla is present in all chlorophyll-protein complexes, including photosystem I (PSI) and photosystem II (PSII). Chlorophyll b (Chlb) is contained in the antenna proteins of PSI (light-harvesting complex I [LHCI]) and PSII (LHCII). PSI and II are large complexes that consist of multiple subunits including low Mr subunits. The PSII subunits generally consist of a single transmembrane helix, and a number of subunits are encoded by genes in the chloroplast genome. Several knockout plants involving these genes have been generated and analyzed (Nelson and Yocum, 2006; Schwenkert et al., 2006; Umate et al., 2007; Torabi et al., 2014).

The chlorophyll biosynthetic pathway and its regulation have been thoroughly investigated, while the chlorophyll degradation pathway continues to be studied (Tanaka and Tanaka, 2011). The first step in the degradation of Chla involves dechelation of Mg2+. The resulting pheophytin a is metabolized to pheophorbide a by PHEOPHYTIN PHEOPHORBIDE HYDROLASE/NON-YELLOW COLORING3 (Morita et al., 2009, Schelbert et al., 2009). Pheophorbide a is converted to a red chlorophyll catabolite by PHEOPHORBIDE A OXYGENASE, and is eventually converted to a transparent nonfluorescent chlorophyll catabolite (Hörtensteiner, 2013). Chlb is reduced to 7-hydroxymethyl chlorophyll a by NON-YELLOW COLORING1 (NYC1), and it is further reduced to Chla by 7-HYDROXYMETHYL CHLOROPHYLL A REDUCTASE. The resulting Chla is further metabolized as described.

The stability of chlorophyll-protein complexes is often regulated by chlorophyll degradation during leaf senescence. As mentioned, sgr is a stay-green mutant, which retains chlorophyll and a wide variety of chlorophyll-protein complexes during leaf senescence. The Chlb reductase (CBR) mutant nyc1 also exhibits a stay-green phenotype because Chlb breakdown is impaired. However, a mutant of the other CBR NYC1-like did not exhibit a stay-green phenotype in Arabidopsis (Arabidopsis thaliana), suggesting that NYC1 plays a primary role in Chlb degradation during leaf senescence (Horie et al., 2009). Interestingly, in the nyc1 mutant, LHCII is specifically retained during leaf senescence, suggesting that Chlb breakdown is required for LHCII degradation (Horie et al., 2009; Kusaba et al., 2007).

In this study, we isolated the cytoplasmically inherited green cotyledon/stay-green soybean gene identified by Terao approximately 100 years ago. Unexpectedly, the gene encoded PsbM, which is a low Mr subunit of PSII. This fact suggests a potential linkage between photosynthesis in mature leaves and chlorophyll degradation during seed maturation and leaf senescence. Cytoplasmically inherited mutants are thought to be rarely generated when the mutation is neutral or harmful because the multiplicity of chloroplasts in a single cell and the multiple genome copies in a single chloroplast make achieving a homoplasmic state difficult. This work is also a rare successful identification of a gene responsible for a cytoplasmically inherited mutation.

RESULTS AND DISCUSSION

Genetic and Physiological Characterizations of a Green Cotyledon Soybean Cultivar

Kiyomidori is a soybean cultivar with a cytoplasmically inherited green cotyledon/stay-green trait. Its cotyledon of mature seed is green although that of the wild-type cultivar Fukuyutaka is yellow. In addition, Fukuyutaka leaves turned yellow 6 d after initiating the dark incubation (DAD), whereas Kiyomidori leaves do not turn yellow (Fig. 1A). The F1 progeny produced by crossing Kiyomidori (female) with the wild-type cultivar Fukuyutaka (male) exhibited the stay-green phenotype. In contrast, the F1 progeny produced by a reciprocal cross did not remain green during naturally occurring or dark-induced senescence, suggesting that the trait is maternally inherited (Supplemental Fig. S1). Chlorophyll content measurements confirmed that Chla and Chlb levels were higher in Kiyomidori plants than in Fukuyutaka plants at 6 DAD (Fig. 1B). It is important to note that Chlb degradation was inhibited more than Chla degradation. Additionally, the Chla/b ratio in Kiyomidori plants decreased to approximately 1 at 6 DAD, while that in Fukuyutaka plants remained relatively unchanged (Fig. 1B). Green gel analyses revealed that LHCII proteins were specifically retained during leaf senescence in Kiyomidori plants, while most of the other chlorophyll-binding proteins degraded (Fig. 2A). A detailed analysis of the photosynthetic proteins by western blot and SDS-PAGE revealed that most of the photosynthetic proteins, including PSI and PSII core subunits and Rubisco, were retained until 4 DAD, but degraded almost completely at 6 DAD in both Fukuyutaka and Kiyomidori plants (Fig. 2B). However, LHCII subunits were more stable in Kiyomidori plants during leaf senescence. In Kiyomidori, protein levels of the trimer-type Lhcb proteins Lhcb1, Lhcb2, and Lhcb3 at 6 DAD were 100.0, 50.2, and 85.3%, respectively, relative to those before dark incubation while these proteins were almost completely degraded in Fukuyutaka at 6 DAD (5.0, 2.0, and 0.0%). On the other hand, the monomer-type Lhcb proteins, such as CP24, CP26, and CP29, were less stable than the trimer-type proteins (11.0, 18.2, and 15.2% in Kiyomidori). During incubations of Kiyomidori plants in darkness, the maximum quantum yield of PSII (Fv/Fm) decreased, and the expression of senescence-inducible genes (e.g. GmNYC1 and GmSGR1) was up-regulated (Fig. 3). These observations suggested that Kiyomidori is a nonfunctional (or Type C) stay-green strain (Thomas and Howarth 2000; Kusaba et al., 2013), in which leaf senescence proceeds while chlorophyll is retained. In wild-type Fukuyutaka plants, the grana stacks were reduced and loosened during leaf senescence (Fig. 2, C and E). However, as is often observed for nonfunctional stay-green mutants, large, thick, and dense grana stacks were observed in the senescent chloroplasts of Kiyomidori plants (Fig. 2, D and F).

Figure 1.

Figure 1.

Open in a new tab

Green cotyledon and stay-green phenotype of Kiyomidori plants. A, Upper panel: mature seeds with (upper) and without (lower) seed coats. Lower panels: Changes in leaf color during the incubation in darkness. B, Changes in chlorophyll content in Fukuyutaka (white bars) and Kiyomidori (black bars) plants during the incubation in darkness. Data from the same day after initiating the dark incubation treatment were compared using the Student’s t test (**P < 0.01). Bars indicate sd (n = 3).

Figure 2.

Figure 2.

Open in a new tab

Protein degradation and ultrastructural changes in Fukuyutaka and Kiyomidori chloroplasts during the incubation in darkness. A, Green gel analysis of chlorophyll-protein complexes. B, Changes in photosynthetic protein content. Proteins were detected by western-blot analysis, except for the Rubisco large subunit, which was visualized with Coomassie Brilliant Blue. Protein extract equivalent to the same fresh weight of tissues was loaded on each lane. C to F, Ultrastructural changes in chloroplasts during the incubation in darkness. Presenescent Fukuyutaka leaf (C), presenescent Kiyomidori leaf (D), senescent Fukuyutaka leaf (E), and senescent Kiyomidori leaf (F). Arrowheads indicate grana; S and P, starch granules and plastoglobules, respectively. Bars = 1.0 μm.

Figure 3.

Figure 3.

Open in a new tab

Changes in photosynthetic parameters and gene expression levels in Kiyomidori plants during the incubation in darkness. A, Fv/Fm. Open squares and closed circles correspond to Fukuyutaka and Kiyomidori plants, respectively. Data obtained for Fukuyutaka and Kiyomidori plants during the same incubation period were compared using the Student’s t test (n = 3; *P < 0.05, **P < 0.01). B and C, qRT-PCR analysis of senescence-inducible genes. GmNYC1 (B) and GmSGR1 (C). The provided gene expression levels are relative to the average levels for Fukuyutaka plants at 0 d after initiating the dark incubation treatment (DAD). Open and closed bars correspond to Fukuyutaka and Kiyomidori plants, respectively. GmActin (Glyma15G050200) was used as a reference gene. Bars indicate sd (n = 4 in B and C).

Isolation of the Cytoplasmically Inherited Green Cotyledon Gene from Kiyomidori Plants

Because the green cotyledon/stay-green trait is inherited cytoplasmically, and is related to the degradation of chlorophyll, we extensively analyzed the chloroplast genome sequence of the Hiratokomame soybean cultivar, which also expresses the cytoplasmically inherited green cotyledon trait. We compared its sequence with that of the wild-type strain PI 437654 (Saski et al., 2005). Among the detected differences was a 5-bp insertion in the Hiratokomame psbM open reading frame, which is thought to impair protein function because of a frame-shift (Fig. 4A). Analysis of the Kiyomidori psbM sequence revealed that it carries the same 5-bp insertion. On the other hand, wild-type cultivars Fukuyutaka and Tachiyutaka had the psbM gene identical to that of PI 437654. Soybean chloroplast genomes have been classified into Groups I to III by PCR-RFLP analysis of the rps11 to rpl36 and rps3 noncoding regions (Kanazawa et al., 1998). Hiratokomame and Kiyomidori were assigned to Group II. The nongreen cotyledon Group II strains lacked the 5-bp insertion in psbM. This observation further confirms the association between the 5-bp insertion in psbM and the green cotyledon/stay-green phenotype (Supplemental Table S1).

Figure 4.

Figure 4.

Open in a new tab

cytG encodes PsbM. A, Alignment of psbM sequences from six soybean strains. All of the cytG soybean strains have a 5-bp insertion (indicated in red), which causes a frame shift and the generation of a premature stop codon (*). Underline indicates the predicted transmembrane region (TMHMM server v. 2.0; http://www.cbs.dtu.dk/services/TMHMM/). The region used for the epitope of the PsbM antibody is shown in blue. B, A psbM-knockout tobacco line (ΔPsbM) exhibits the maternally inherited stay-green phenotype. Senescent tobacco leaves are presented. C, Changes in Chla and Chlb contents and the Chla/b ratio in ΔPsbM and NYC1-RNAi tobacco lines during leaf senescence. Open and closed bars indicate presenescent and senescent leaves, respectively. The Chla and Chlb content data of senescent leaves from the ΔPsbM and NYC1-RNAi lines were compared with those from control plants using the Student’s t test (**P < 0.01). The Chla/b ratios were analyzed using the Tukey’s honest significant difference test (P < 0.01). Bars indicate sd (n = 4). D, Distribution of d1d2 and cytG among green cotyledon soybean strains from East Asia. Ratios (%) of d1d2 and cytG are provided in the pie charts.

To confirm that the mutation in psbM is responsible for the stay-green phenotype, we disrupted the tobacco (Nicotiana tabacum) psbM gene using a chloroplast transformation system (Supplemental Fig. S2A; Okuzaki and Tabei, 2012). Leaf senescence was induced by limiting nutrient access for 3 weeks in a hydroponic culturing system. The leaves of control plants turned yellow, but those of the psbM-knockout (ΔPsbM) plants remained green (Fig. 4B). Additionally, this trait was maternally inherited like it is in Kiyomidori plants. The ΔPsbM plants retained more Chla and Chlb than the control plants, and the Chla/b ratio was approximately 1 in senescent leaves (Fig. 4C). Furthermore, green gel and western-blot analyses revealed that trimeric and monomeric LHCII subunits are specifically retained in senescent leaves (Supplemental Fig. S3, A and B). These ΔPsbM characteristics were very similar to those of Kiyomidori, suggesting that impairment of psbM causes the stay-green phenotype. In fact, tobacco plastid transformants that could produce the same PsbM polypeptide as cytG (PsbM-ins) showed stay-green phenotype and specifically retained LHCII during leaf senescence as ΔPsbM tobacco plants (Supplemental Figs. S2, B and D, and S3, A and C). On the other hand, the tobacco plastid transformant with normal psbM (PsbM-nins) did not show stay-green phenotype (Supplemental Figs. S2C and S3C). These observations confirm that the stay-green phenotype in cytG is not caused by the specific function of a possible truncated form of PsbM, but instead by a loss of psbM function.

Analysis of the psbM sequence from the T104 strain carrying the maternally inherited green cotyledon gene analyzed by Terao revealed that this strain has the same 5-bp insertion in psbM that is present in the Hiratokomame and Kiyomidori psbM genes. This suggests that cytG encodes PsbM (Fig. 4A). Some of the Kiyomidori characteristics, such as specific retention of LHCII and severe inhibition of Chlb degradation, were also observed in another cytG strain (a near-isogenic line of cultivar Clark), confirming that cytG encodes PsbM (Guiamét et al., 1991).

In soybean, d1d2 represents another type of green cotyledon mutant, which is a double mutant of the SGR co-orthologs, GmSGR1 and GmSGR2 (Fang et al., 2014; Nakano et al., 2014). d1d2 carries a 1-bp deletion, which results in a frame shift in GmSGR2 and a complex rearrangement associated with a transposon insertion in GmSGR1. Because soybean was domesticated in East Asia, there are ample genetic resources for this crop in this region (Lee et al., 2011; Wang et al., 2016). Large-scale genotyping of GmSGR1/GmSGR2 and psbM from 212 green cotyledon strains collected in East Asia (excluding recently developed strains) revealed that all lines carry d1d2, with the same mutations in GmSGR1/GmSGR2, or cytG, with the 5-bp insertion (Supplemental Table S2). This is in contrast with the pea i mutants. All 12 pea green cotyledon strains were defective in PsSGR, but they involved three independent alleles (Sato et al., 2007). This suggests that naturally occurring double or cytoplasmic mutations are rare, and the d1d2 and cytG alleles have been passed down to current cultivars. The cytG and GmSGR1 (d2) mutations were not identified in a large-scale PCR survey of 263 wild soybean strains collected from China (100 strains), Japan (62 strains), Korea (60 strains), and Russia (41 strains; Shimamoto et al., 1998; Xu et al., 2002). This observation is consistent with the fact that green cotyledon soybean is preferably used for some special dishes but the cytG and d1d2 mutations are not necessarily advantageous in natural environments. It is possible that the cytG and GmSGR1 mutations occurred and were selected during domestication or in the early history of the breeding of soybean. Interestingly, most of the analyzed green cotyledon soybean strains from Japan carried cytG (172 of 173 strains), while all nine of the Chinese green cotyledon strains consisted of d1d2. Both d1d2 and cytG were detected among the Korean strains (7 and 22, respectively; Fig. 4D). These observations suggest that d1d2 and cytG originated in China and Japan, respectively. Alternatively, it is possible that only d1d2 was transmitted to Chinese soybean landraces, while only cytG was transmitted to Japanese soybean landraces.

Chlb Degrading Activity Is Reduced in Kiyomidori and psbM-Knockout Tobacco Plants

The psbM-knockout tobacco plants form PSII dimers almost normally, but their PSII-mediated electron transfer mechanism is impaired (Umate et al., 2007). We determined that the performance of Kiyomidori plants regarding several photosynthetic parameters was lower than that of Fukuyutaka plants (Fig. 3A; Supplemental Fig. S4). Consistent with its function during photosynthesis, the expression of psbM was down-regulated when plants were incubated in darkness, as were the nuclear and chloroplast genes Lhcb1 and psbD, respectively (Fig. 5A; Supplemental Fig. S5). Furthermore, the abundance of PsbM was stable up to 4 DAD, but decreased by 6 DAD, similar to the patterns for the other PSII subunits (Fig. 5B).

Figure 5.

Figure 5.

Open in a new tab

Changes in the accumulation of PsbM mRNA and protein during the incubation in darkness. A, PsbM expression levels during the incubation in darkness. The Fukuyutaka and Kiyomidori cultivars were analyzed by qRT-PCR. The provided values are relative to the average GmPsbM expression level in Fukuyutaka plants at 0 d after initiating the dark incubation treatment (DAD). Bars indicate sd (n = 4). B, Western-blot analysis of PsbM in Fukuyutaka and Kiyomidori plants. No signal was detected for Kiyomidori plants at 0 DAD because of the cytG mutation. The “loading” samples were stained with amido black.

The highly similar stay-green phenotypes of Kiyomidori and nyc1 plants may provide clues regarding the function of PsbM during chlorophyll degradation. In nyc1 plants, Chlb degradation is severely repressed, the Chla/b ratio is close to 1 by the late stages of leaf senescence, and LHCII degradation is specifically inhibited (Kusaba et al., 2007). These observations are similar to those for Kiyomidori plants. Furthermore, changes in the Chla and Chlb contents and photosynthetic proteins in NYC1-RNAi tobacco plants during leaf senescence are very similar to those in ΔPsbM plants (Fig. 4; Supplemental Fig. S3B). NYC1 encodes Chlb reductase, which catalyzes the first step of Chlb degradation, indicating that Chlb degradation is required for the subsequent degradation of LHCII and of the Chla contained within LHCII (Horie et al., 2009; Kusaba et al., 2007). Thus, PsbM may regulate CBR activity during leaf senescence.

Activity of CBR is very high in dark-grown seedlings (Ito et al., 1996). To examine CBR activity, dark-grown soybean and tobacco seedlings were briefly exposed to light to induce chlorophyll synthesis, and then returned to dark conditions. We measured the changes in Chla and Chlb contents. The Chlb level in Fukuyutaka plants was 24.3% of the level before the second incubation in darkness. In contrast, the Chlb level in Kiyomidori was still 90.7% of the level just before the second incubation in darkness. Additionally, there were no significant differences in Chla degradation between Fukuyutaka and Kiyomidori plants (Fig. 6A). In control tobacco plants, the Chlb content was ∼60% of the level before the second incubation in darkness, while there was no decrease in the Chlb levels in the ΔPsbM plants (Fig. 6B). These observations suggest that Chlb degrading activity, which reflects CBR activity, is lower in Kiyomidori and ΔPsbM tobacco plants than in wild-type plants.

Figure 6.

Figure 6.

Open in a new tab

Chlb reductase activity in dark-grown soybean and tobacco seedlings. A, Chlorophyll degradation in Kiyomidori seedlings. Five-day-old dark-grown soybean seedlings were exposed to light for 4 h (white bars) and then incubated in darkness for 24 h (gray bars). The provided values are relative to the average values for seedlings treated with a 4-h illumination. B, Chlorophyll degradation in ΔPsbM tobacco seedlings. Five-day-old dark-grown tobacco seedlings were exposed to light for 3 h (white bars) and then incubated in darkness for 24 h (gray bars). The provided values are relative to the average values for seedlings treated with a 3-h illumination. Data for the Kiyomidori and ΔPsbM seedlings incubated in darkness were compared with those for the Fukuyutaka and control lines, respectively, using the Student’s t test (*P < 0.05, **P < 0.01). Bars indicate sd (n = 4).

psbI-Knockout Tobacco Plants Did Not Exhibit Significantly Decreased Chlb Degrading Activity

To examine whether PsbM is specifically involved in Chlb degradation among PSII subunits, we generated psbI-knockout tobacco plants (ΔPsbI), which were photoautotrophically viable (Schwenkert et al., 2006). PsbI is a small PSII subunit whose gene is located in the chloroplast genome. Similar to PsbM, PsbI consists of a single transmembrane helix. The psbI-knockout plants were sensitive to high intensity light, and had relatively low PSII activity levels (Schwenkert et al., 2006). The fully senescent leaves of ΔPsbI plants were slightly green (Supplemental Fig. S6). Chlorophyll measurements revealed that ΔPsbI plants retained more Chla and Chlb in senescent leaves than the corresponding control tobacco leaves (Fig. 7A). However, the Chla/b ratio for the senescent ΔPsbI leaves was approximately 2, which was higher than that of ΔPsbM leaves (Fig. 7A). Additionally, Chlb degrading activity levels in dark-grown ΔPsbI seedlings were normal (Fig. 7B). These observations suggest that the presence of chlorophyll in senescent ΔPsbI leaves is not because of decreased Chlb degrading activity. They also imply that decreased PSII activity per se usually does not lead to reduced Chlb degrading activity. The regulation of Chlb degrading (CBR) activity may be a function specific to PsbM among the PSII subunits.

Figure 7.

Figure 7.

Open in a new tab

Analyses of psbI-knockout tobacco lines (ΔPsbI). A, Changes in Chla and Chlb contents in ΔPsbI plants during leaf senescence. Open and closed bars indicate presenescent and senescent leaves, respectively. The Chla and Chlb content data from ΔPsbI and ΔPsbM senescent leaves were compared with those from senescent leaves of the control plants using the Student’s t test (**P < 0.01). The Chla/b ratios were analyzed using the Tukey’s honestly significant difference test (P < 0.01). B, Chlorophyll degradation in ΔPsbI tobacco seedlings. Five-day-old dark-grown tobacco seedlings were exposed to light for 4 h (white bars) and then incubated in darkness for 24 h (gray bars). The provided values are relative to the average values for seedlings treated with a 4-h illumination. Bars indicate sd (n = 4). Data of senescent ΔPsbI and ΔPsbM leaves were compared with those of control plants using the Student’s t test (**P < 0.01). Bars indicate sd (n = 4).

CONCLUSION

As observed in this study, PsbM is required for proper PSII activities in presenescent leaves, and for the degradation of Chlb during seed maturation and leaf senescence, suggesting a potential linkage between photosynthesis and chlorophyll degradation. However, it is unclear how this small, single-membrane spanning protein—most of which is embedded in the thylakoid membrane—regulates photosynthesis and chlorophyll degradation. The CBR activity levels were relatively low in Kiyomidori and psbM-knockout tobacco plants, suggesting that PsbM is involved in the regulation of NYC1 activity. PsbM is located at the center of the PSII dimer, while LHCII is positioned at the periphery and contains Chlb, which is the substrate for NYC1. Although it is unclear where and how NYC1 metabolizes Chlb in LHCII, it may be difficult for the membrane protein NYC1 to interact directly with PsbM and LHCII. In wild-type soybean plants, PsbM was degraded during the final leaf senescence stage (Fig. 5B), suggesting that PsbM is not an essential component for CBR activity. Instead, a physiological condition caused by a deficiency in PsbM before (full) senescence may affect NYC1 activity. Kiyomidori plants harbor a functional NYC1 gene, whose expression is normally induced during leaf senescence (Fig. 3B). This suggests that the inhibition of NYC1 function in Kiyomidori plants is a posttranscriptional event. Additionally, it has been reported that NYC1 function is regulated at the protein level (Jia et al., 2015). PsbM may be involved in stabilizing NYC1 protein. Interestingly, a recessive mutation of Y3, which is a nuclear gene, suppresses the cytG phenotype (Bernard and Weiss, 1973; Terao and Nakatomi, 1929). Isolating and functionally analyzing the Y3 gene may reveal the molecular mechanism underlying the regulation of NYC1 activity by PsbM.

MATERIALS AND METHODS

Plant Materials and Growth Conditions

Hiratokomame and Tachiyutaka Glycine max cultivars were obtained from the National Agriculture and Food Research Organization, Japan. The T104 soybean strain was obtained from the Plant Germplasm Inspection Station, U.S. Department of Agriculture. The Fukuyutaka and Kiyomidori cultivars were purchased from the Nakahara-Saishujou Nursery, Japan. The “JP Accession” strains listed in Supplemental Table S2 were obtained from the National Institute of Agrobiological Sciences GenBank, while the “NBRP Accession” strains were from the National BioResource Project (Lotus japonicus and G. max). Wild soybean (G. soja) accession nos. B08019-1, B07007-4, B09020, B08034, and B09003 were collected from natural habitats in Japan and maintained by the Laboratory of Plant Genetics and Evolution, Hokkaido University. ‘Kaina 18’ was provided by National Grassland Research Institute, Japan. For tobacco experiments, Nicotiana tabacum cv Petit Havana SR1-derived transformants were used.

Plants were grown in a growth chamber for 14 d at 27°C under a 16-h-light/8-h-dark cycle (250 μmol photons/m2/s). To induce leaf senescence, shoots were detached from just above the cotyledons and incubated in darkness at 27°C. The third true leaf of each plant was analyzed. Tobacco (N. tabacum) cv Petit Havana SR1 plants were grown for 3 weeks using a hydroponic culturing system (U-ING) and the liquid fertilizer Vegetable Life A (Otsuka Agritechno). The tobacco plants were grown at 27°C under a 16-h-light/8-h-dark cycle (180 μmol photons/m2/s). Leaf senescence was induced by limiting the availability of nutrients for 3 weeks.

To measure chlorophyll degradation in plants incubated in darkness, soybean and tobacco seedlings were grown in the absence of light for 5 d at 25°C. Plants were then illuminated for 4 h under 120 μmol photons/m2/s (soybean) or for 3 or 4 h under 150 μmol photons/m2/s (tobacco), and then returned to the dark for 24 h.

Chlorophyll Measurement

Leaves with identical fresh weights were ground in a mortar using liquid N. The photosynthetic pigments were extracted using 80% acetone. Chlorophyll contents were determined using a U-2900 spectrophotometer (Hitachi) according to a published procedure (Porra et al., 1989).

Transmission Electron Microscopy

Chloroplast ultrastructural details were observed by transmission electron microscopy according to an established procedure (Kusaba et al., 2007).

In Vivo Photosynthetic Measurements

Fv/Fm and linear electron flow were estimated using the JUNIOR-PAM fluorometer (Walz) according to published procedures (Kohzuma et al., 2012). The linear electron flow values were calculated based on the quantum efficiency (ΦII) parameter under a 20-min steady-state exposure from 80 to 1500 μmol photons/m2/s photosynthetically active radiation.

Protein Extraction and SDS-PAGE

To extract membrane proteins, soybean leaves with identical fresh weights were homogenized in an ice-cold mortar containing a buffer solution (50 mm HEPES-KOH, pH 7.8, 0.4 m Suc, 50 mm NaCl, and 2 mm MgCl2). Homogenates were filtered through two layers of gauze, and centrifuged at 5,000g for 10 min at 4°C. Pellets were then washed in a small volume of the same buffer solution. The isolated membrane fractions, including thylakoids, were frozen in liquid nitrogen and stored at −80°C. Membranes were washed with a solution consisting of 50 mm Bis Tris-HCl buffer, pH 7.0, and 0.33 m sorbitol. Samples were centrifuged at 5,000g for 10 min at 4°C. The resulting pellets were dissolved in SDS sample buffer (50 mm Tris-HCl, pH 6.8, 2% SDS, 10 mm β-mercaptoethanol, 10% glycerol, and 0.04% bromophenol blue). Membrane proteins were then separated in a 12% acrylamide gel.

To detect PsbM, membrane proteins were isolated as described and then washed with 90% (v/v) methanol. Pellets were solubilized in SDS sample buffer containing 30% Suc. PsbM proteins were separated in a 16 to 22% acrylamide gradient gel with 7.5 m urea and 5% Suc. The membranes were stained with amido black.

To analyze Rubisco, leaves with identical fresh weights were ground in liquid nitrogen and suspended in a buffer (100 mm Tricine-KOH, pH 7.5, 2 mm MgCl2, 10 mm NaCl, 1 mm EDTA, 1 mm PMSF, and 10 mm β-mercaptoethanol). Samples were centrifuged at 20,000g for 10 min at 4°C. The resulting supernatants were treated with 80% (v/v) acetone, and the pelleted proteins were subsequently dissolved in SDS sample buffer. Proteins were separated in a 12% acrylamide gel and visualized with Coomassie Brilliant Blue.

Western-Blot Analyses

Western-blot analyses were completed as previously described in Kohzuma et al. (2012). The proteins separated as described above were transferred to polyvinyl difluoride membranes (Invitrogen). Antibodies against D2, CP29, CP26, CP24, Lacb1, Lacb2, and Lhcb3 were purchased from Agrisera. Antibodies against D1, CP43, and CP1 were also used (Tanaka et al., 1991; Kato et al., 2012). Professor Kinya Akashi (Tottori University, Japan) provided the antibody specific for the ε-subunit of chloroplast ATP synthase. A rabbit anti-PsbM antibody was produced using a synthetic polypeptide (IYVKTVSQSD) as the antigen. A peroxidase-conjugated antirabbit secondary antibody (Cosmo Bio) was used, and proteins were detected with the ECL+ chemiluminescence kit (GE Healthcare Life Sciences). The Odyssey Fc Imaging System (LI-COR) was used to detect signals. The band intensities were calculated with the software ImageJ (National Institutes of Health).

Green Gel Analysis

Leaves with identical fresh weights were homogenized with a cold blender in a buffer containing 50 mm HEPES-KOH, pH 7.5, 0.33 m sorbitol, 2 mm EDTA, 1 mm MgCl2, 5 mm ascorbate, and 0.05% BSA. The homogenates were filtered through two layers of Miracloth (Calbiochem) and centrifuged at 5,000g for 10 min at 4°C. The pellets were then gently added to an osmotic shock buffer (50 mm HEPES-KOH, pH 7.5, 5 mm sorbitol, and 5 mm MgCl2) and incubated on ice for 5 min. The suspensions were centrifuged at 5,000g for 4 min at 4°C, and the resulting pellets were resuspended in a thylakoid solubilization buffer (25 mm Bis Tris-HCl, pH 7.0, 20% glycerol, 0.25 mg/mL Pefabloc [Merck], 1% dodecyl maltoside, 0.15% sodium deoxycholate, and 1% SDS). The suspensions were centrifuged at 18,000g for 20 min at 4°C after a 2-h incubation on ice in darkness. The pigment-containing mildly solubilized proteins were analyzed in a 5 to 20% acrylamide gradient gel (Wako).

Chloroplast Genome Sequencing

The Hiratokomame chloroplast genome was analyzed by long PCR and shotgun sequencing. An 88,068-bp sequence was obtained, corresponding to ∼87% of the chloroplast genome, excluding the inverted repeat regions. The psbM gene was amplified with the PCR primers GmPsbMseqF (CTCGACGATGAGTCGATTTG) and GmPsbMseqR (ACGGTGATTGTAGTCCGATC). The amplicon was then sequenced and analyzed.

Genotyping of D1D2 and cytG

To genotype D1, GmSGR2 was amplified with the PCR primers CGTTGTTGGGTTTGTCTGATGG and CCTCTGTTTTGTGACAACATCTGC. The amplicon was sequenced and analyzed. To genotype D2, the transposon-inserted GmSGR1 was amplified with the PCR primers CGCAACATGTTTCCTATTGCGTGTGTA and CTTCAACCCAGGCTATATCTTTCTTCCC. To genotype cytG, psbM was amplified with the dCAPS primers GCACTGTTTATTCTAGTTCCTACTGCTTTTTTAGATAT and TATCTGGATTACGGTGATTGTAGTCCG, and then digested with EcoRV.

qRT-PCR

Total RNA was isolated with Isogen and purified using a spin column extraction kit (Nippon Gene). The RNA was quantified using the Qubit 2.0 fluorometer (Invitrogen). cDNA was synthesized from 50 ng total RNA using the ReverTra Ace qPCR RT Master Mix with gDNA Remover (Toyobo). Transcript abundance was determined by qRT-PCR using the KAPA SYBR FAST qPCR kit (Kapa Biosystems) and the Rotor-Gene Q RT-PCR cycler (Qiagen). The primers used for qRT-PCR are listed in Supplemental Table S3.

Production of Transgenic Tobacco Plants

Leaves of tobacco plants grown under sterile conditions were used for transformation experiments. The ΔPsbM transgenic tobacco plants were produced according to an established procedure (Okuzaki and Tabei, 2012). The tobacco chloroplast genome region from 28,823 to 32,817 bp (NC_001879), which was interrupted at position 30,843 bp (26-bp downstream of the psbM initiation codon) by the aadA:gfp3.1 cassette derived from K9:pBSAP:aadA:gfp3.1, was subcloned into the pBluescript II vector (Stratagene) for ΔPsbM transformants (Supplemental Fig. S2A). Similarly, the chloroplast genome region from 28,208 to 32,264 bp, which was interrupted at position 30,670 bp by the same cassette and the sequence TTATA, was inserted at 72 bp downstream of the psbM initiation codon and subcloned into the pBluescript II vector for PsbM-ins transformants (Supplemental Fig. S2, B and D). For ΔPsbI transformants, the chloroplast genome region from 6,563 to 10,153 bp, which is interrupted at position 8,481 (32-bp downstream of the psbI initiation codon) by the same cassette, was also subcloned. These constructs were then introduced into leaves by particle bombardment. We selected spectinomycin-resistant regenerated plants in which the green fluorescence protein was detected uniformly in the leaf. Progenies of the transformants in which homoplasmic state was confirmed was used for the experiments. For PsbM-ins transformants, transformants with the insertion in psbM were selected by PCR and used in the experiments. PsbM-nins is a transformant that does not carry the insertion in psbM (Supplemental Fig. S2C). The pNtag-integrated plastid transformant, which carries the aadA:gfp3.1 cassette between the trnI and trnA genes, was used as a control plan (Okuzaki and Tabei, 2012).

To produce NYC1-RNAi transgenic tobacco plants, a 309-bp NtNYC1 (EU930363) fragment was amplified with the primers NtNYC1-RNAiF (5′-GCAGGCTCCGCGGCCGCGCATGGTCCTAACTGACCT-3′) and NtNYC1-RNAiR (5′-AGCTGGGTCGGCGCGCCTCTCCATGGCATCTGTGAAC-3′) using tobacco leaf cDNA as the template. The amplicon was cloned into the pENTR vector (Invitrogen), and then recombined into the RNAi destination vector pANDA35HK (Miki and Shimamoto, 2004). Transgenic tobacco plants were produced according to a standard Agrobacterium tumefaciens-mediated transformation protocol using the SR1 strain.

Accession Numbers

Sequence data from this article can be found in the GenBank/EMBL data libraries under the following accession numbers: GmNYC1, Glyma09G19200; GmSGR1, Glyma11G027400; GmPsbM, GlmaCp017; GmPsbD, GlmaCp016; GmLhcb1, Glyma16G165500; and GmActin, Glyma15G050200.

Supplemental Data

The following supplemental materials are available.

Supplementary Material

Supplemental Data
supp_173_4_2138__index.html (905B, html)

Acknowledgments

We thank Jun Abe (Hokkaido University) for providing wild soybean DNA samples, Kinya Akashi (Tottori University, Japan) for providing the antibody for the ε-subunit of chloroplast ATP synthase, Yuhi Kono for providing the Hiratokomame soybean plants, Kanae Koike for the ultrastructural analysis of chloroplasts, and Satoshi Okuda for technical assistance.

Footnotes

1

This study was supported by the Core Research for Evolutional Science and Technology program of the Japan Science and Technology Agency (to M.K.) and by KAKENHI grants from the Japan Society for the Promotion of Science (nos. 21658004 and 26292006 to M.K. and no. 25891018 to K.K.).

References

  1. Armstead I, Donnison I, Aubry S, Harper J, Hörtensteiner S, James C, Mani J, Moffet M, Ougham H, Roberts L, et al. (2007) Cross-species identification of Mendel’s I locus. Science 315: 73. [DOI] [PubMed] [Google Scholar]
  2. Bernard RL, Weiss MG (1973) Qualitative genetics. In Caldwell BE, ed, Soybeans: Improvement, Production, and Uses. American Society of Agronomy, Madison, WI, pp. 117–154 [Google Scholar]
  3. Croce R, van Amerongen H (2014) Natural strategies for photosynthetic light harvesting. Nat Chem Biol 10: 492–501 [DOI] [PubMed] [Google Scholar]
  4. Fang C, Li C, Li W, Wang Z, Zhou Z, Shen Y, Wu M, Wu Y, Li G, Kong LA, et al. (2014) Concerted evolution of D1 and D2 to regulate chlorophyll degradation in soybean. Plant J 77: 700–712 [DOI] [PubMed] [Google Scholar]
  5. Guiamét JJ, Schwartz E, Pichersky E, Noodén LD (1991) Characterization of cytoplasmic and nuclear mutations affecting chlorophyll and chlorophyll-binding proteins during senescence in soybean. Plant Physiol 96: 227–231 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Horie Y, Ito H, Kusaba M, Tanaka R, Tanaka A (2009) Participation of chlorophyll b reductase in the initial step of the degradation of light-harvesting chlorophyll a/b-protein complexes in Arabidopsis. J Biol Chem 284: 17449–17456 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Hörtensteiner S. (2013) Update on the biochemistry of chlorophyll breakdown. Plant Mol Biol 82: 505–517 [DOI] [PubMed] [Google Scholar]
  8. Ito H, Ohtsuka T, Tanaka A (1996) Conversion of chlorophyll b to chlorophyll a via 7-hydroxymethyl chlorophyll. J Biol Chem 271: 1475–1479 [DOI] [PubMed] [Google Scholar]
  9. Jia T, Ito H, Hu X, Tanaka A (2015) Accumulation of the NON-YELLOW COLORING1 protein of the chlorophyll cycle requires chlorophyll b in Arabidopsis thaliana. Plant J 81: 586–596 [DOI] [PubMed] [Google Scholar]
  10. Kanazawa A, Tozuka A, Shimamoto Y (1998) Sequence variation of chloroplast DNA that involves EcoRI and ClaI restriction site polymorphisms in soybean. Genes Genet Syst 73: 111–119 [DOI] [PubMed] [Google Scholar]
  11. Kato Y, Sun X, Zhang L, Sakamoto W (2012) Cooperative D1 degradation in the photosystem II repair mediated by chloroplastic proteases in Arabidopsis. Plant Physiol 159: 1428–1439 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Kohzuma K, Dal Bosco C, Kanazawa A, Dhingra A, Nitschke W, Meurer J, Kramer DM (2012) Thioredoxin-insensitive plastid ATP synthase that performs moonlighting functions. Proc Natl Acad Sci USA 109: 3293–3298 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Kusaba M, Ito H, Morita R, Iida S, Sato Y, Fujimoto M, Kawasaki S, Tanaka R, Hirochika H, Nishimura M, Tanaka A (2007) Rice NON-YELLOW COLORING1 is involved in light-harvesting complex II and grana degradation during leaf senescence. Plant Cell 19: 1362–1375 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Kusaba M, Tanaka A, Tanaka R (2013) Stay-green plants: what do they tell us about the molecular mechanism of leaf senescence. Photosynth Res 117: 221–234 [DOI] [PubMed] [Google Scholar]
  15. Lee GA, Crawford GW, Liu L, Sasaki Y, Chen X (2011) Archaeological soybean (Glycine max) in East Asia: does size matter? PLoS One 6: e26720. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Mendel G. (1866) Versuche über Pflanzen-hybriden. Verh Natforsch Ver Brünn 4: 3–47. [Google Scholar]
  17. Miki D, Shimamoto K (2004) Simple RNAi vectors for stable and transient suppression of gene function in rice. Plant Cell Physiol 45: 490–495 [DOI] [PubMed] [Google Scholar]
  18. Morita R, Sato Y, Masuda Y, Nishimura M, Kusaba M (2009) Defect in NON-YELLOW COLORING3, an α/β hydrolase-fold family protein, causes a stay-green phenotype during leaf senescence in rice. Plant J 59: 940–952 [DOI] [PubMed] [Google Scholar]
  19. Nakano M, Yamada T, Masuda Y, Sato Y, Kobayashi H, Ueda H, Morita R, Nishimura M, Kitamura K, Kusaba M (2014) A green-cotyledon/stay-green mutant exemplifies the ancient whole-genome duplications in soybean. Plant Cell Physiol 55: 1763–1771 [DOI] [PubMed] [Google Scholar]
  20. Nelson N, Yocum CF (2006) Structure and function of photosystems I and II. Annu Rev Plant Biol 57: 521–565 [DOI] [PubMed] [Google Scholar]
  21. Okuzaki A, Tabei Y (2012) Improvement of the plastid transformation protocol by modifying tissue treatment at pre- and post-bombardment in tobacco. Plant Biotechnol 29: 3079310 [Google Scholar]
  22. Park SY, Yu JW, Park JS, Li J, Yoo SC, Lee NY, Lee SK, Jeong SW, Seo HS, Koh HJ, et al. (2007) The senescence-induced staygreen protein regulates chlorophyll degradation. Plant Cell 19: 1649–1664 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Porra RJ, Thompson WA, Kriedemann PE (1989) Determination of accurate extinction coefficients and simultaneous equations for assaying chlorophylls a and b extracted with four different solvents: verification of the concentration of chlorophyll standards by atomic absorption spectroscopy. Biochim Biophys Acta 975: 384–394 [Google Scholar]
  24. Saski C, Lee SB, Daniell H, Wood TC, Tomkins J, Kim HG, Jansen RK (2005) Complete chloroplast genome sequence of Glycine max and comparative analyses with other legume genomes. Plant Mol Biol 59: 309–322 [DOI] [PubMed] [Google Scholar]
  25. Sato Y, Morita R, Nishimura M, Yamaguchi H, Kusaba M (2007) Mendel’s green cotyledon gene encodes a positive regulator of the chlorophyll-degrading pathway. Proc Natl Acad Sci USA 104: 14169–14174 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Schelbert S, Aubry S, Burla B, Agne B, Kessler F, Krupinska K, Hörtensteiner S (2009) Pheophytin pheophorbide hydrolase (pheophytinase) is involved in chlorophyll breakdown during leaf senescence in Arabidopsis. Plant Cell 21: 767–785 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Schwenkert S, Umate P, Dal Bosco C, Volz S, Mlçochová L, Zoryan M, Eichacker LA, Ohad I, Herrmann RG, Meurer J (2006) PsbI affects the stability, function, and phosphorylation patterns of photosystem II assemblies in tobacco. J Biol Chem 281: 34227–34238 [DOI] [PubMed] [Google Scholar]
  28. Shimamoto Y, Fukushi H, Abe J, Kanazawa A, Gao Z, Xu D, Gai J (1998) Genetic diversity, geographical differentiation and evolution in the cytoplasmic genome of the wild soybean, Glycine soja, growing in China. Genet Resour Crop Evol 45: 433–439 [Google Scholar]
  29. Shimoda Y, Ito H, Tanaka A (2016) Arabidopsis STAY-GREEN, Mendel’s green cotyledon gene, encodes magnesium-dechelatase. Plant Cell 28: 2147–2160 [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Tanaka A, Yamamoto Y, Tsuji H (1991) Formation of chlorophyll-protein complexes during greening. 2. Redistribution of chlorophyll among apoproteins. Plant Cell Physiol 32: 195–204 [Google Scholar]
  31. Tanaka R, Tanaka A (2011) Chlorophyll cycle regulates the construction and destruction of the light-harvesting complexes. Biochim Biophys Acta 1807: 968–976 [DOI] [PubMed] [Google Scholar]
  32. Terao H. (1918) Maternal inheritance in the soybean. Am Nat 52: 51–56 [Google Scholar]
  33. Terao H, Nakatomi S (1929) On the inheritance of chlorophyll colorations of cotyledons and seedcoats in the soy bean. Jpn J Genet 4: 64–80 [Google Scholar]
  34. Thomas H, Howarth CJ (2000) Five ways to stay green. J Exp Bot (Suppl 1) 51: 329–337 [DOI] [PubMed] [Google Scholar]
  35. Torabi S, Umate P, Manavski N, Plöchinger M, Kleinknecht L, Bogireddi H, Herrmann RG, Wanner G, Schröder WP, Meurer J (2014) PsbN is required for assembly of the photosystem II reaction center in Nicotiana tabacum. Plant Cell 26: 1183–1199 [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Umate P, Schwenkert S, Karbat I, Dal Bosco C, Mlcòchová L, Volz S, Zer H, Herrmann RG, Ohad I, Meurer J (2007) Deletion of PsbM in tobacco alters the QB site properties and the electron flow within photosystem II. J Biol Chem 282: 9758–9767 [DOI] [PubMed] [Google Scholar]
  37. Wang J, Chu S, Zhang H, Zhu Y, Cheng H, Yu D (2016) Development and application of a novel genome-wide SNP array reveals domestication history in soybean. Sci Rep 6: 20728. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Xu H, Abe J, Gai Y, Shimamoto Y (2002) Diversity of chloroplast DNA SSRs in wild and cultivated soybeans: evidence for multiple origins of cultivated soybean. Theor Appl Genet 105: 645–653 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental Data
supp_173_4_2138__index.html (905B, html)
supp_pp.16.01589_01589Supplemental_Figs_for_proof.pdf (694.9KB, pdf)

Articles from Plant Physiology are provided here courtesy of Oxford University Press

RESOURCES