Skip to main content
Scientific Reports logoLink to Scientific Reports
. 2017 Mar 31;7:45720. doi: 10.1038/srep45720

Prion-like characteristics of the bacterial protein Microcin E492

Mohammad Shahnawaz 1, Kyung-Won Park 1, Abhisek Mukherjee 1, Rodrigo Diaz-Espinoza, Claudio Soto a
PMCID: PMC5374632  PMID: 28361921

Abstract

Microcin E492 (Mcc) is a pore-forming bacteriotoxin. Mcc activity is inhibited at the stationary phase by formation of amyloid-like aggregates in the culture. Here we report that, in a similar manner as prions, Mcc naturally exists as two conformers: a β-sheet-rich, protease-resistant, aggregated, inactive form (Mccia), and a soluble, protease-sensitive, active form (Mcca). The exogenous addition of culture medium containing Mccia or purified in vitro-generated Mccia into the culture induces the rapid and efficient conversion of Mcca into Mccia, which is maintained indefinitely after passaging, changing the bacterial phenotype. Mccia prion-like activity is conformation-dependent and could be reduced by immunodepleting Mccia. Interestingly, an internal region of Mcc shares sequence similarity with the central domain of the prion protein, which is key to the formation of mammalian prions. A synthetic peptide spanning this sequence forms amyloid-like fibrils in vitro and is capable of inducing the conversion of Mcca into Mccia in vivo, suggesting that this region corresponds to the prion domain of Mcc. Our findings suggest that Mcc is the first prokaryotic protein with prion properties which harnesses prion-like transmission to regulate protein function, suggesting that propagation of biological information using a prion-based conformational switch is an evolutionary conserved mechanism.


Prions are the infectious agents responsible for a group of neurodegenerative diseases, termed prion diseases or transmissible spongiform encephalopathies (TSEs), including scrapie, chronic wasting disease, bovine spongiform encephalopathy, and Creutzfeldt-Jakob disease1,2,3. The main component of a prion is a misfolded form of the normal host-encoded prion protein (PrPC) capable of self-perpetuating by converting PrPC into the pathological, infectious form (PrPSc). Although the molecular mechanism through which conversion of PrPC to PrPSc occurs is poorly understood, the experimental evidence suggests a direct interaction of PrPC with pre-existing oligomeric PrPSc, which acts as a seed to induce the recruitment of the normal protein into the aggregate, templating the conformational conversion of PrPC into PrPSc (ref. 4). The conversion is associated with an increase in β-sheet structure, insolubility in ionic detergents, resistance to proteolytic degradation, and the formation of amyloid-like aggregates5,6. In vitro, prion protein polymerizes through a nucleation-dependent process, which is composed of a lag phase followed by an extension phase7,8,9. The lag phase can be reduced or removed either by increasing protein concentration or by the addition of preformed aggregates. In vivo, injection or ingestion of purified PrPSc or tissue extracts containing PrPSc from infected animals leads to the pathological conversion of host PrPC into PrPSc and the development of prion disease. Thus, the seeding/nucleation mechanism offers a plausible model for the infectious nature of prions8.

Analogous to mammalian prions, a number of self-perpetuating prions have been identified in the yeast Saccharomyces cerevisiae, which are responsible for heritable changes in phenotype10,11,12,13. The [PSI+], [URE+] and [RNQ+] are extensively characterized prions of Sup35p, Ure2, and Rnq1 proteins, respectively. The [PSI+] is an inactive aggregated form of Sup35p, a subunit of a translation termination factor, whereas the [psi] is an active soluble form of Sup35p. The Sup35 protein consists of three domains; an N-terminal region (N), which corresponds to the prion-forming domain (PrD) and is required for induction and propagation of the prion form. The C-terminal domain (C) is necessary for translation termination, whereas the highly charged middle domain (M) increases the solubility of the protein. The prion domain of yeast is modular and can confer the ability to form prions when fused to other proteins. The heat-shock protein 104 (Hsp104) plays a key role in yeast prion propagation by fragmenting large polymers, and inhibition of its activity by guanidine hydrochloride cures yeast prions. Unlike mammalian prions, yeast prions are not generally considered pathogenic, although this is still a subject under debate14. Rather, they appear to provide a fitness advantage under adverse conditions8,15,16,17. Prion-like phenomena have also been shown for several other proteins in diverse organisms. For example, the neuronal isoform of Aplysia cytoplasmic polyadenylation element binding protein (CPEB) has been shown to undergo prion-like conformational changes that help to stabilize long term memory18. The human mitochondrial antiviral signaling (MAVS) protein has been described to use the prion-like mechanism to activate and propagate antiviral innate immune signals19. These reports provide evidence that the prion-like self-replication of conformational changes in a protein is not always pathogenic; rather, such conformational changes may regulate protein function and provide a selectable advantage in extreme conditions.

In this study, we show prion-like, self-propagation of conformational changes in the bacteriotoxin Mcc that modulate the biological activity of the protein. Mcc is a low molecular weight (~7.8 kDa) antibiotic produced by Klebsiella pneumoniae RYC492, which is active against many Enterobacteriaceae species that compete with Klebsiella20,21,22. Mcc kills sensitive bacteria by forming ion-channels on the cell membrane22,23,24. Active Mcc is produced only during the exponential phase of growth21,25. Loss of activity of Mcc in the stationary phase is neither due to differences in amounts of protein secreted, nor degradation or posttranslational modifications26. Rather, the loss of Mcc activity appears to be due to the conversion of soluble protein into amyloid-like fibrils, similar to those associated with many human diseases including Alzheimer’s, Parkinson’s, Diabetes type II, and prion diseases27. Mcc aggregates formed in vitro or in vivo share typical characteristics with disease-associated protein aggregates, including β-sheet rich secondary structure, ultrastructural morphology of the aggregates as long unbranched amyloid fibrils, binding to amyloid specific dyes and partial resistance to proteolysis27.

Results

Two forms of Mcc are functionally, biochemically, and structurally distinct

Two distinct forms of Mcc have been observed during the growth phase of Klebsiella pneumoniae RYC492 strain21,25. The active form of Mcc (hereafter designated as Mcca) is produced during the exponential phase of growth, while the inactive form of Mcc (hereafter termed Mccia) appears during the stationary phase (Fig. 1A). Such a phenomenon could easily be replicated by growing Mcc producing E. coli VCS257 cells harboring the pJEM15 plasmid in M9 minimal medium at 37 °C. Mcc activity was determined by the critical dilution method (CDM), as described in “Materials and Methods” (Fig. 1B). The activity of Mcc increased exponentially, peaking at 9 h in the exponential phase. The activity started to decline around 12 h, becoming undetectable at 24 h in the stationary phase (Fig. 1C). The loss of Mcc activity in the stationary phase was paralleled by the formation of an altered conformation of Mcc that resulted in an increase in protease resistance. For this experiment, aliquots of culture medium from stationary and exponential phases were subjected to limited proteolysis with proteinase K (PK; 1–1000 μg/ml) for 30 min at 37 °C. The aliquots coming from the stationary phase, containing mostly Mccia, showed a remarkable resistance to proteolysis compared to Mcca, coming from the exponential phase, as shown by immunoblot analysis (Fig. 1D). Strikingly, a large proportion of Mccia remained undigested even after incubation with a very high concentration of PK (1000 μg/ml), resembling the behavior of PrPSc.

Figure 1. Two functionally and biochemically distinct forms of Mcc.

Figure 1

(A) A schematic diagram of the natural production of two forms of microcin at different stages of the bacterial growth phase; Mcca (active form of Mcc) and Mccia (inactive form of Mcc). (B) A scheme of the critical dilution method (CDM) to measure Mcc bacteriotoxin activity. In brief, samples were centrifuged and supernatants were laid onto LB agar plates overlaid with Mcc-sensitive E.coli. After 16 h of incubation at 37 °C, the activity of Mcc in the last dilution that gave detectable inhibition (signal approximately 2-times above the background levels as indicated by an arrow) was determined and expressed in arbitrary units(AU)/ml. C: Typical changes on Mcc activity during different stages of culture growth. Mcc producing bacteria were grown in minimal medium at 37 °C. Aliquots were removed periodically, and activity was measured by CDM (see “Materials and Methods”). Activity was measured in duplicate samples and error bars indicate standard deviation (S.D). (D) Structural changes of Mcc reflected by differences on resistance to proteolytic degradation. Immunoblots of PK-treated aliquots of culture at the exponential and stationary phase, containing Mcca (9 h in culture) and Mccia (24 h in culture), respectively. Samples in Lanes 2-5 and 7–10, were treated with increasing concentrations of PK (1, 10, 100 and 1000 μg/ml). Samples in lanes 1 and 6 were left untreated. E: The activity of purified Mcca (400 μg/ml) before and after aggregation into Mccia at 37 °C for 24 h was measured by CDM. Error bars indicate S.D. The differences were statistically analyzed by the student t-test (** P = 0.0052). F: Acquisition of protease-resistance upon in vitro conversion of Mcca into Mccia. Aliquots of purified Mcca (t = 0 h) and after conversion into Mccia (t = 24 h) were subjected to the same treatment with PK as described in panel D. Mcca (lanes 1-5) and Mccia (lanes 6-10). Samples in Lanes 2-5 and 7-10, were treated with increasing concentrations of PK (1, 10, 100 and 1000 μg/ml). Samples in lanes 1 and 6 were left untreated.

The conversion of Mcca into Mccia that occurs in vivo during the bacteria culture growth was reproduced in vitro using purified Mcc. The highly purified Mcca (400 μg/ml) from the exponential phase (9 h) of Mcc producing bacteria was allowed to aggregate in 50 mM PIPES, pH 6.5 containing 500 mM NaCl at 37 °C and the activity of Mcc before (0 h) and after 24 h of incubation was determined by CDM. Purified Mcca before aggregation was highly active, whereas after 24 h of incubation, Mcc activity diminished substantially (P = 0.0052), resembling the in vivo conversion of Mcca into Mccia (Fig. 1E). The change in bacteriotoxin activity by in vitro aggregation was associated with the acquisition of protease resistance. An immunoblot analysis before and after PK digestion clearly showed that Mcca was sensitive to PK, whereas in vitro-generated Mccia (by 24 h of incubation) exhibited remarkable resistance to PK (Fig. 1F). These findings indicate that Mcc structural changes, in the absence of any other factor, are responsible for the functional changes in biological activity.

Mccia is a β-sheet rich, amyloid-like aggregate

One of the hallmark properties of mammalian and yeasts prions is the formation of β-sheet rich amyloid-like structures by a seeding/nucleation mechanism8,28. Interestingly, the conversion of Mcca into Mccia is also associated with the formation of amyloid-like structures, which bind to the amyloid-specific dyes: Thioflavin T (ThT) and Congo red (CR). Incubation of purified Mcca in vitro led to the formation of amyloid-like structures through a nucleation-dependent mechanism as illustrated by the ThT binding assay (Fig. 2A). The amyloid nature of the aggregates was further confirmed by a CR binding assay, in which CR bound to Mccia displayed a characteristic increase in absorption and a spectral shift to reach a peak at ~540 nm compared to Mcca (Fig. 2B). Analysis by fourier-transformed infrared spectroscopy (FTIR) revealed a maximum absorption at ~1654 cm−1 for Mcca, consistent with a predominance of α-helix/random coil structure. However, Mccia exhibited the maximum absorption at ~1639 cm−1 indicating that β-sheets are the predominant structure (Fig. 2C)29. Further evidence for the structural differences between Mcca and Mccia was the recognition with the conformational antibody A11. This antibody has been shown to specifically recognize β-sheet-rich oligomers produced during the process of amyloid formation of many different proteins30. Using a dot blot assay, we found that while Mccia was readily recognized by A11, Mcca was not (Fig. 2D). Finally, while no detectable polymeric structures were seen for Mcca under electron microscopy, an aliquot of Mccia was greatly enriched in unbranched amyloid-like fibrils of variable length (Fig. 2E).

Figure 2. Mccia is a β-sheet rich amyloid aggregate.

Figure 2

(A) Purified Mcca (400 μg/ml) was allowed to aggregate at 37 °C for 48 h and the extent of amyloid formation was monitored by the ThT binding assay. Experiment was done in duplicate and data correspond to the average ± S.D. (B) Absorption spectra of bound CR in the presence of purified Mcca (green line) and Mccia (red line) produced after aggregation of Mcca for 24 h at 37 °C. Black line represents CR alone. (C) FTIR spectra of purified Mcca (top panel) and Mccia (bottom panel). The black line represents the experimental spectra and the colored lines are the deconvoluted components corresponding to the various structural motifs as obtained by computer analysis. The peak assignments was as following: ~1639 and ~1691 cm−1 for β sheets; ~1654 cm−1 for α-helix; ~1648 cm−1 for random structure; ~1667,~1675 and ~1680 cm−1 for β turns29. (D) Dot blot analysis for the interaction of Mcca and Mccia with the A11 conformational antibody that recognizes β-sheet-rich soluble oligomers. (E) Ultrastructural morphologies of Mcca and Mccia under TEM after negative staining. The bars represent 100 nm. (F) Known amyloid inhibitors delay conversion of Mcca into Mccia. Mcc producing bacteria were grown in minimal medium at 37 °C until 48 h either in the absence (control), or in the presence of Curcumin (25 μM) and CR (50 μM). Aliquots were removed periodically and activity of Mcc was measured by the critical dilution method. Activity was measured in duplicate samples and error bars indicate S.D. The differences in Mcc activity between control and treated samples were highly significant (P < 0.0001) in both variables (time and treatment, as well as the interaction between them) as measured by two-way ANOVA. Post-hoc analysis by the Bonferroni test revealed also significant differences between treatment and controls at times 9, 12 and 18 h (*P < 0.05; ***P < 0.001). (G) Immunoblots of aliquots removed at different times from cultures used in panel F before (−) and after treatment (+) with PK (3 μg/ml).

To further investigate whether conversion of Mcca into Mccia amyloid aggregates is the key event in changing the activity of the protein, we studied the effect of known and general inhibitors of amyloid formation on Mcc activity. For this purpose, we used curcumin and CR, which have been shown in several reports to prevent protein misfolding and aggregation into amyloid-like structures formed by diverse proteins31,32,33. Mcc producing bacteria were grown in the absence (control) or presence of either 25 μM curcumin or 50 μM CR. Aliquots of culture medium were subjected to Mcc activity assay and limited proteolysis. The addition of curcumin or CR significantly increased the time in which Mcc was active, suggesting an inhibitory effect of these molecules on the conversion of Mcca into Mccia (Fig. 2F). This effect was not due to a change on bacterial growth, since under these conditions the rate of growth was the same in the presence or the absence of these molecules (data not shown). The influence of these molecules on the Mcc conformational change could be further monitored by studying the rate of proteolytic degradation of Mcc by PK. Both CR and curcumin completely inhibited the conversion of PK-sensitive Mcca into PK-resistant Mccia until 12 h as compared to the control, where complete acquisition of PK-resistance was observed at that time point (Fig. 2G). Altogether, these results demonstrate that formation of Mccia amyloid fibrils sequesters functional Mcca into the aggregates, leading to the loss of bacteriotoxin activity.

The exogenous addition of culture medium containing Mccia induces the prion-like conversion of Mcca into Mccia in vivo

The hallmark feature of prions is that the pathological, infectious form (PrPSc) interacts with endogenous PrPC and catalyzes its conformational change to produce more PrPSc. To test whether Mccia is capable of catalyzing the Mcca to Mccia conversion, Mcc producing bacteria were grown in minimal media at 37 °C in the absence (control) or in the presence of 10% (v/v) whole culture or 5–20% (v/v) culture supernatant, both taken from the stationary phase of the culture when Mccia is naturally produced (see “Materials and Methods”). Small aliquots were periodically removed and subjected to the Mcc activity assay by CDM and proteolysis by PK (3 μg/ml). As expected, the aliquots from Mcc producing bacteria grown in the absence of Mccia showed maximum activity at 9 h that started to decline at 12 h, and was undetectable by 24 h (Fig. 3A). The loss of activity correlated with the appearance of PK-resistant Mcc at 12 h, whereas Mcc was completely sensitive to PK until 9 h (Fig. 3D). The addition of 5 to 20% (v/v) culture supernatant containing Mccia significantly diminished the amount of active Mcc present in the bacteria culture in a dose-dependent manner, reaching a complete effect when 10% of the material was added (Fig. 3A). Consistently, the loss of activity was paralleled with the production of PK-resistant Mcc (Fig. 3D). To exclude the possibility that the loss of Mcc activity after addition of bacterial culture medium was due to another factor present in the medium rather than the prion-like activity of Mccia, we conducted a control experiment in which culture medium from the stationary phase of bacteria devoid of Mcc plasmid was exogenously added. The addition of either whole culture [10% (v/v)] or culture supernatant [20% (v/v)] into Mcc producing bacteria had no significant effect on Mcc activity (Fig. 3B) or in the appearance of PK-resistant Mcc (Fig. 3D), as compared to the control. To further show that Mccia promotes the conversion of Mcca into Mccia, we depleted Mccia from the medium by using a Mcc-specific antibody. Unfortunately, immunodepletion only partially removed Mccia from the samples, as determined by immunoblotting (Supplementary Figure 1). Nevertheless, the addition of culture supernatant containing Mccia [20% (v/v)] after immunodepletion partially prevented the inactivation of the bacteriotoxin (9 h, P < 0.001; 12 h, P < 0.01; Fig. 3C), which was also paralleled by the partial reduction of acquisition of PK resistance (Fig. 3D, bottom panel). These results suggest that Mccia released by bacteria at the stationary phase of the culture is able to catalyze the conversion of Mcca into Mccia, leading to the permanent loss of bacteriotoxin activity by changing the phenotype of the bacteria.

Figure 3. Exogenous addition of Mccia induces the conversion of Mcca into Mccia in vivo.

Figure 3

(A) E. coli VCS257pJEM15 was grown in minimal medium at 37 °C until 36 h either in the absence (control) or in the presence of 5–20% (v/v) culture supernatant (S) or 10% (v/v) whole (W) culture containing Mccia. Aliquots were removed at indicated times and activity of Mcc was measured by CDM. The differences in Mcc activity between control and the various treatments were highly significant (P < 0.0001) in both variables (time and treatment, as well as the interaction between them) as measured by two-way ANOVA. Post-hoc analysis by the Bonferroni test revealed also significant differences between treatment and controls at times 9 and 12 h (***P < 0.001). (B) Mcc producing bacteria were grown in minimal medium in the presence of 20% (v/v) culture supernatant (S) and or 10% (v/v) whole (W) culture of E. coli VCS257 deprived of Mcc plasmid (Mcc-). Activity of Mcc was measured by critical dilution. In this case the differences between control and treatments were not significant as analyzed by two-way ANOVA. (C) Mcc producing bacteria were grown in minimal medium at 37 °C either in the absence (control) or in the presence of 20% (v/v) culture supernatant (S) after immunodepletion using an antibody specific for the sequence of Mcc. Aliquots were removed at indicated times and activity of Mcc was measured by CDM. In this experiment the treatment produced significant differences compared to the untreated control (used the same as panel A, top graph). Individual differences were analyzed by the Bonferroni post-test (*P < 0.05; **P < 0.01; ***P < 0.001). In panels A, B and C, activity was measured in duplicate samples and error bars indicate S.D. D: Immunoblots of aliquots removed from culture used in panels A, B and C before (−) after treatment (+) with PK (3 μg/ml) at indicated time points.

The results shown above indicate that the conversion of Mcca into Mccia is dependent on the presence and concentration of Mccia seeds. Next, we sought to investigate the optimum time for the addition of exogenous Mccia. For this purpose, we added 20% (v/v) culture supernatant containing Mccia at different time points (0, 3, and 6 h) during the growth phase of Mcc producing bacteria (Supplementary Figure 2A). The addition of Mccia until 3 h of the growth phase, completely abolished Mcc activity, however, when added at 6 h it was only partially effective in catalyzing Mcca into Mccia conversion (P < 0.001; Supplementary Figure 2B).

Another important feature of prions is that once PrPSc is formed, it can self-perpetuate indefinitely by serial passages in infected animals. Thus, we wanted to explore whether this also happens with Mccia after its first cycle of conversion. For this purpose, Mcc producing bacteria were grown until 48 h (stationary phase; P0). After 48 h, 10% (v/v) of whole culture was added into the fresh culture medium of Mcc producing bacteria and grown for a subsequent 48 h (P1). This cycle was repeated up to 3 passages (Supplementary Figure 3A). Aliquots from all passages were removed, and Mcc activity was analyzed as described before. In P0, where no Mccia was added, Mcc activity showed a typical trend; increase and then decrease in activity at the stationary phase. However, in all passages P1 to P3, Mcc activity was undetectable at any time point (Supplementary Figure 3B), suggesting that after the first conversion of Mcca into Mccia, Mccia propagates its conformation by catalyzing Mcca conversion (Supplementary Figure 3B). This experiment shows that the presence of small amounts of Mccia effectively and permanently changes the phenotype of the bacteria culture from able to unable to induce the death of competing bacteria.

The exogenous addition of in vitro-generated, purified Mccia induces the prion-like conversion of Mcca into Mccia in vivo

To provide evidence that conversion of Mcca into Mccia in vivo is a protein-only phenomenon, similar to what has been shown for mammalian and yeast prions, we studied whether in vitro produced Mccia aggregates can catalyze Mcc conversion in the bacterial culture. For this purpose, highly purified Mcca (400 μg/ml) was allowed to aggregate into Mccia in vitro in minimal medium at 37 °C for 48 h with vigorous shaking. After 48 h, the amyloid formation was confirmed by a ThT binding assay (data not shown), and the in vitro generated Mccia was used to induce conversion of Mcca into Mccia in vivo. Mcc producing bacteria were grown in the absence (control) or presence of various concentrations of Mccia (2.5–10 μg/ml) for 48 h at 37 °C. Aliquots were removed at different time points and subjected to Mcc activity assay and proteolysis by PK. The addition of Mccia significantly diminished the activity of Mcc produced by bacteria in a dose-dependent manner (P < 0.001; Fig. 4A). No detectable bacteriotoxin activity was observed in the presence of 5 or 10 μg/ml of Mccia, whereas a lower concentration of Mccia (2.5 μg/ml) was only partially effective (Fig. 4A). Consistently, the loss of activity of Mcc correlated with the emergence of PK-resistant Mcc as shown by immunoblot analysis (Fig. 4B). This result clearly indicates that Mccia prepared in vitro from highly purified Mcca in the absence of any other factors is capable of self-propagating in culture by catalyzing the conversion of endogenous Mcca into Mccia.

Figure 4. Purified in vitro-generated Mccia induces the conversion of Mcca into Mccia in vivo.

Figure 4

(A) E. coli VCS257pJEM15 was grown in minimal medium at 37 °C either in the absence (control) or in the presence of purified Mccia (2.5, 5 and 10 μg/ml, final concentration; see “Materials and Methods”). Aliquots were removed at indicated time points and Mcc activity was measured by CDM. Activity was measured in duplicate samples and error bars indicate S.D. The differences in Mcc activity between control and treated samples were highly significant (P < 0.0001) in both variables (time and treatment, as well as the interaction between them) as measured by two-way ANOVA. Post-hoc analysis by the Bonferroni test revealed also significant differences between treatment and controls at times 9 and 12 h (***P < 0.001). (B) Immunoblots of aliquots removed from culture used in panel A before (−) and after treatment ( + ) with PK (3 μg/ml) at indicated time points.

Prion-like activity of Mccia is conformation dependent

Although the prion activity of mammalian and yeast prions is resistant to harsh procedures that destroy nucleic acids, it is sensitive to agents that alter protein conformation34. To gain insight into whether the conversion of Mcca into Mccia is conformation dependent, Mcc producing bacteria were exposed to Mccia untreated or subjected to heat or chemical denaturation. For this purpose, Mccia seeds either produced in vivo or generated in vitro were denatured by boiling for 15 min, or by incubating with 6 M guanidine hydrochloride (GdnHCl) for 2 h at room temperature (see “Materials and Methods”). Both procedures disrupted the conformation of Mccia, as evaluated by dot blot using the A11 conformational antibody (Fig. 5A). However, Mcc could be easily detected by an antibody specific for the C-terminal sequence of Mcc.

Figure 5. Mccia prion-like activity is conformation dependent.

Figure 5

(A) To analyze whether heat and chemical denaturation altered Mccia conformation, purified Mccia was subjected to heat or GdnHCl treatment as indicated in “Materials and Methods” and reactivity with the A11 conformational antibody was studied. Samples were spotted onto nitrocellulose membrane and probed with the A11 oligomer specific antibody and anti-Mcc antibody. (B) E. coli VCS257pJEM15 was grown in minimal medium at 37 °C either in the absence (control) or in the presence of 20% (v/v) culture supernatant (S) that was untreated, treated with heat, or treated with GdnHCl. Aliquots were removed at indicated times and Mcc activity was measured by CDM. C: Immunoblots of aliquots removed from culture used in panel B before (−) and after treatment (+) with PK (3 μg/ml) at indicated time points. (D) Similarly, Mcc producing bacteria were grown in minimal medium either in the absence (control) or in the presence of purified Mccia (5 μg/ml) that was untreated, treated with heat, or treated with GdnHCl. Aliquots were removed at indicated times and activity of Mcc was measured by CDM. In experiments shown in panels B and D activity was measured in duplicate samples and error bars indicate S.D. E: Immunoblots of aliquots removed from culture used in panel D before (−) and after treatment (+) with PK (3 μg/ml) at indicated time points. The differences in Mcc activity between control and treated samples at 9 and 12 h in panels B and D were analyzed by two-way ANOVA with Bonferroni post-test (ns, P > 0.05; *P < 0.05; #P < 0.001).

Mcc producing bacteria were grown in the absence (control) or presence of culture supernatant containing Mccia [20% (v/v)] or in vitro-generated, purified Mccia (5 μg/ml) as such or after denaturation either by boiling or by treatment with 6 M GdnHCl. Aliquots from the culture were periodically removed, and Mcc activity and its resistance to PK were tested. The addition of untreated purified, in vitro-generated Mccia or culture containing Mccia consistently resulted in loss of Mcc activity and early formation of PK resistant Mcc (Fig. 5B–E); however, the addition of purified Mccia or culture containing Mccia after exposure to boiling and to GdnHCl had no effect either on Mcc activity or on the formation of the PK resistant Mcc as compared to the control (Fig. 5B–E). These results suggest that destruction of Mccia conformation abolishes its ability to self-propagate and induce the phenotypic changes to the bacterial culture.

Mcc behaves as a prion in a yeast prion reporter assay

To further explore the prion-like behavior of Mcc, we used a well-established prion reporter assay in yeast, based on [psi-] and [PSI+] states of the translation termination factor Sup35p35. The prion domains in yeast prions including Sup35p are modular and can transfer the prion behaviors to heterologous proteins36. We used this feature of yeast prions to generate Mcc-Sup35MC fusion protein, by replacing the N-terminal prion domain of Sup35 with full-length mature Mcc which was fused to the functional MC domain of Sup35p (see “Materials and Methods” for details) (Fig. 6A). The fusion protein was tested for heritable [PSI+] state using the ADE1 gene containing a premature stop codon. In [PSI+] cells, Sup35p is assembled into an inactive self-perpetuating prion form which does not take part in premature translation termination and thus cells are able to grow on adenine-deficient medium and produce white colonies (Fig. 6B). Whereas in the case of [psi] state, cells do not make functional Ade1, and red colonies appear due to the accumulation of red by-product. Surprisingly, like other yeast prions, Mcc conferred prion behavior to Sup35MC. Indeed, cells expressing Mcc-Sup35MC fusion protein gave rise to white colonies on YEPD plates, which were maintained after repeated streaking (Fig. 6B) in a similar manner as Sup35p in the [PSI+] state (positive control). The propagation of a prion phenotype for all known yeast prions is dependent on the activity of the heat shock protein 104 (Hsp104)37; therefore, yeast prions can be cured by inhibiting Hsp104 either by chemical inhibition or by genetic manipulation38,39. Similar to Sup35p (used as a positive control), the prion form of Mcc-Sup35MC fusion protein could also be cured by transferring a white colony to YEPD plates containing 3 mM of GdnHCl, a known inhibitor of Hsp104 (Fig. 6B). These results clearly suggest that Mcc confers to Sup35MC the ability to exist in two distinct physical and functional states, which are interconvertible and heritable by the prion mechanism.

Figure 6. Mcc confers prion behaviors to Sup35 in a prion reporter assay in yeast.

Figure 6

(A) Schematic representation of full length Sup35p containing the N, M and C domains and Mcc-Sup35MC fusion protein containing the full-length mature Mcc sequence (1–84) instead of its endogenous N region prion-forming domain (1–123 amino acids). (B) The color based assay that measures distinct heritable phenotypes of Sup35p and Mcc-Sup35MC fusion protein are shown after cells expressing Sup35p (as a positive control) and Mcc-Sup35MC fusion protein were plated onto YEPD and YEPD plates supplemented with 3 mM GdnHCl. (C) The sedimentation analysis of total cell extracts of cells expressing Sup35p and Mcc-Sup35MC grown on either YEPD alone or on YEPD supplemented with 3 mM GdnHCl. Total cell extracts (T) were centrifuged at 40,000 rpm for 30 min, resulting in supernatant (S) and pellet (P) that were separated on SDS-PAGE, immunoblotted, and probed with anti-Mcc and anti-Sup35p antibodies.

To further confirm the prion behavior of Mcc-Sup35MC in yeasts, we studied the formation of aggregates by a sedimentation assay. The prion form exists in high assemblies and can be pelleted by high-speed centrifugation, whereas non-prion forms mostly exist in a soluble state40. The white colonies expressing Mcc-Sup35MC or Sup35p (positive control) were grown in YEPD medium, whereas red colonies from Mcc-Sup35MC or Sup35p were grown in YEPD medium supplemented with 3 mM GdnHCl. The total cell extracts (T) were fractionated by high-speed centrifugation, and supernatant (S) and pellet (P) fractions were probed with anti-Mcc as well as with anti-Sup35p. Most of the Mcc-Sup35MC fusion protein was present in an insoluble form when cells were grown in YEPD, which indicates formation of large assemblies similar to Sup35p in [PSI+] state. However, when cells were grown on YEPD plates containing 3 mM GdnHCl, most of the Mcc-Sup35MC fusion protein was present in the soluble fraction, as the case for Sup35p in the [psi] state (Fig. 6C). These results clearly suggest that change in heritable phenotype is, indeed, due to the distinct physical states of Mcc-Sup35MC fusion protein in yeast.

Identification of the Mcc prion domain (PrD)

To study the region of Mcc responsible for its prion-like activity, we compared the sequence of Mcc with that of human PrP. As shown in Fig. 7A, a remarkable sequence similarity was found between the central region of mature Mcc (amino acids 16–37) with the internal hydrophobic core region of PrP (amino acids 111–133). Indeed, a 57% sequence identity and a 74% similarity was observed in these regions between these proteins from two greatly distant organisms. Importantly, various pieces of evidence suggest that this region of PrP plays an important role in the formation of PrPSc (refs 41 and 42). To analyze whether this region of Mcc might be the domain responsible for prion activity, we investigated if this sequence can form self-replicating amyloid aggregates that can induce the conversion of full-length Mcca into Mccia in vitro and in vivo. For this purpose, we used a synthetic peptide comprising the residues 12–37 of mature Mcc. The reason for using this sequence instead of Mcc (16–37) was to increase the peptide solubility and easiness to handling. To examine whether Mcc(12-37) forms amyloid aggregates in vitro, we performed a ThT binding assay and analyzed the aggregates’ morphology by electron microscopy. Purified synthetic Mcc(12-37) at a concentration of 228 μg/ml was allowed to aggregate and aliquots were tested for ThT binding. As shown in Fig. 7B, Mcc(12-37) formed amyloid following a nucleation-dependent mechanism, characterized by a 12 h lag phase. Interestingly, preformed aggregates of Mcc(12-37) were capable of seeding the aggregation of both soluble Mcc(12-37) and full-length purified Mcca, reducing their lag phase (Fig. 7B). The amyloid nature of Mcc(12-37) aggregates was confirmed by transmission electron microscopy (Fig. 7C).

Figure 7. Identification of a prion domain in Mcc with sequence similarity to human PrP.

Figure 7

(A) Sequence similarity between mature Mcc (residues 16–37) and human PrP (amino acids 111–133) (upper panel). Amino acid sequence of a synthetic peptide spanning residues 12–37 of mature Mcc used to model the PrD. (B) Synthetic Mcc(12-37) (228 μg/ml) and purified soluble Mcca (400 μg/ml) were incubated in the absence (⦁) or in the presence (▪) of preformed aggregates (seeds) of Mcc(12-37) (11 μg/ml) in aggregation buffer until 60 h at 37 °C. (C) The morphological analysis by TEM of soluble Mcc(12-37) (left panel) and aggregated Mcc(12-37) (right panel). The bars represent 100 nm. (D) Mcc producing bacteria were grown in minimal medium at 37 °C either in the absence (control) or in the presence of preformed Mcc(12-37) aggregates. Aliquots were removed at indicated times and Mcc activity was measured by CDM. Activity was measured in duplicate samples and error bars indicate S.D. The differences in Mcc activity between control and treated samples at 9 and 12 h were analyzed by two-way ANOVA with Bonferroni post-test (ns, P > 0.05; #P < 0.001).

We next examined whether Mcc(12-37) aggregates are able to induce the conversion of Mcca into Mccia in vivo. Preformed Mcc(12-37) aggregates (10 μg/ml) were exogenously added to a fresh culture of Mcc producing bacteria, and bacteriotoxin activity was determined by CDM. The addition of exogenous Mcc(12-37) seeds in vivo partially inhibited the activity of Mcc which is indicative of induced conversion of Mcca into Mccia (Fig. 7D). These results clearly suggest that the region spanning residues 12-37 of Mcc, sharing similarity with the central region of PrP, might be the prion-forming domain of Mcc.

Discussion

The capability of proteins to self-propagate and transmit biological information in a similar manner as genetic material is a recently recognized concept. Prions were first identified as proteinaceous infectious agents responsible for various catastrophic neurodegenerative disorders known as prion diseases or TSEs4. In TSEs, a naturally occurring protein undergoes conformational changes leading to the formation of a misfolded and aggregated form, termed PrPSc. Like a typical infectious micro-organism, PrPSc can be transferred from individual-to-individual by various routes of administration and replicate in the new host forming more PrPSc. PrPSc self-replication involves the catalytic conversion of the normal isoform of the prion protein (PrPC) through a seeding/nucleation mechanism, in which the PrPSc aggregate binds PrPC and promotes its misfolding by incorporation into the growing polymer8. Initially, the prion phenomenon was thought to be exclusive for TSEs, but in recent years several other neurological and systemic disorders have been proposed to spread by the prion principle8. More importantly, the prion mechanism of transmission of biological information by propagation of protein conformational changes has been shown not to be restricted to diseases, but to operate in diverse organisms to modulate the biological function of certain proteins8,17. The seminal discovery of self-perpetuating prion proteins in yeast and other fungus has proven that prion-like conformational changes can also have a beneficial outcome16. Unlike prion protein, yeast prions are generally nonpathogenic and produce distinct phenotypes with different physiological functions, providing a competitive advantage in adverse conditions11. Later, several other beneficial prions have been discovered that use prion-like conformational changes to propagate biological signals. For example, the self-perpetuating fiber-like polymers of MAVS regulate mammalian antiviral immune defense19 and a translation regulator of the invertebrate Aplysia forms self-perpetuating polymers that help to maintain long-term potentiation in sensory neurons18. These findings clearly suggest that diverse organisms harness prion-like conformational changes in several unrelated proteins to regulate biological function. However, it is currently unclear how frequent and universal the use of the prion principle is for modulating the biological activity of proteins.

Here, we report a bacterial protein that exhibits prion-like characteristics and could be considered as the first example of a prokaryotic prion. Mcc possesses several hallmark features of authentic prions, namely: (1) The protein exists in two structurally and functionally different forms, Mcca and Mccia; (2) Mccia is the prion form that adopts a β-sheet-rich amyloid-like conformation that is formed by a seeding/nucleation mechanism; (3) Like PrPSc, Mccia is highly resistance to digestion by large concentrations of proteases, whereas Mcca (like PrPC) is readily digested; (4) Exogenous administration of Mccia to the culture of Mcc-producing bacteria induces the rapid conversion of Mcca into Mccia, leading to the loss of bacteriotoxin activity and the change of the phenotype of the bacteria; (5) Like PrPSc, Mccia can be maintained self-propagating in vivo by multiple passages of experimental infection; (6) The prion-like activity of Mccia can be abolished by treatments that destroy protein conformation and by inhibitors of amyloid formation; (7) The conversion of Mcca to Mccia can be reproduced in vitro using purified protein, and the in vitro-generated Mccia is able to self-replicate in vivo and change the bacterial phenotype; (8) Mcc can replace the PrD of Sup35p, and induce [PSI+] phenotype in yeasts when fused to the functional domain of Sup35p. However, in contrast with mammalian prions, the prion form of Mcc is not toxic and the non-prion form is the toxic one. This apparent discrepancy may not be so, because evidence accumulated in the past several years have shown that the formation of large amyloid aggregates in TSEs as well as other amyloid-related disorders (e.g. Alzheimer’s or Parkinson’s diseases) may actually be a protective mechanism to decrease the amount of small oligomers which are the real toxic species43. Another contrasting feature that differentiates Mcc from other prions is that Mccia is located in the extracellular space and thus the conformational information inherent to Mcc is dissociated from the organism and not passed on to neighboring or daughter cells. Because of this, the biological changes are not transmitted to another organism, but to the environment in which bacteria live. Currently, the definition of prions is changing in the field thanks to many reports showing prion-like properties of various other proteins. Thus, at this time is yet unclear whether prions need to be associated to cells or changing the biological properties of cells upon transmission. For example, many reports have provided evidences for the Alzheimer’s amyloid-beta protein behaving like a prion44,45,46, and this is also an extracellular protein which arguably changes the environment in the brain (not necessarily the cells). Bacteria living in the gut and releasing Mcc into the medium may produce a very similar result as amyloid-beta in the brain of Alzheimer’s patients.

One of the surprising features of the Mcc prion behavior is its sequence similarity with the central region of PrP. The sequence 16–37 of Mcc shows 57% identity and 74% similarity with the PrP sequence spanning residues 111–133 (Fig. 7A). Various pieces of evidence have shown that this region of PrP plays an essential role in PrP conversion and its pathological properties, including: (a) The synthetic peptide comprising the sequence 106–126 of PrP has been widely used to model prion neurotoxicity47,48,49; (b) Deletion of the fragment 114–121 results in a protein that cannot be converted into PrPSc (ref. 42); (c) Synthetic peptides spanning the sequence 109–141 of PrP undergo conformational changes that mimic the conversion of PrPC into PrPSc (ref. 50); (d) Synthetic peptides harboring the sequence 109–141 or 106–128 of PrP can effectively inhibit the interaction of PrPC and PrPSc (ref. 50); (e) The region 115–130 has been used to produce β-sheet breaker peptides able to reverse the PrPSc pathological conformation and reduce infectivity in vivo51; (f) The central region of PrP is highly conserved among mammals and many of the pathological mutations linked with inherited TSEs are located in this region3. The similarity of Mcc with this important region of PrP suggests that this sequence could be key to the prion properties of both PrP and Mcc. Indeed, synthetic Mcc(12-37) forms amyloid fibrils through a nucleation-dependent mechanism and is able to seed itself and full-length Mcc in vitro. Moreover, aggregates of Mcc(12-37) can induce the conversion of Mcca into Mccia in vivo. More experiments are needed to determine the minimum sequence of the Mcc prion domain.

Our findings indicate that Mcc exhibits several characteristics of prions; however, the functional relevance of the Mcc prion mechanism is unclear. Mcc producing bacteria secrete Mcca that kills competing bacteria, helping them to occupy a spatial niche in a given ecosystem. However, when Mcc producing bacteria have prevailed, Mcca is no longer needed. We can speculate that under these conditions, the prion-like mechanism may operate to encapsulate Mcca into Mccia, protease resistant aggregates that may serve as a reservoir for Mcca. Later if the conditions of the ecosystem change and competition arise, Mccia aggregates may undergo conformational changes that release Mcca thus providing a competitive advantage. We have previously shown that Mccia amyloid aggregates can indeed release Mcca upon changing environmental conditions52. In summary, our findings indicate that the prion mechanism is not restricted to eukaryotic organisms, but is likely an ancient process of regulation of protein function by rapid self-propagation of changes in protein conformation. Thus, the prion principle is a conserved process occurring all the way from bacteria to humans.

Materials and Methods

Chemicals were obtained from Sigma (St. Louis, Mo), unless otherwise stated.

Purification of Microcin E492 (Mcc)

Mcc was purified from the culture supernatants as described earlier27. In brief, E. coli VCS257 cells harboring pJEM15 plasmid were grown in M9 minimal medium containing 0.2% glucose, 0.2% sodium citrate, 1 g/liter casamino acid, 1 mg/liter thiamine and 100 mg/liter ampicillin to an optical density of 1.2 at 600 nm at 37 °C with shaking. Bacterial cells and debris were removed by centrifugation at 4000 rpm for 10 min. The resultant supernatant was passed through a Sep-Pak C18 cartridge (Waters). The cartridge was sequentially washed with 65% methanol, and 25% acetonitrile. Finally, the bound Mcc was eluted with 50% acetonitrile, and lyophilized. Lyophilized powder of Mcc (purified active Mcc) was stored at −20 °C until used. Under these conditions, the preparation contains highly purified Mcc ( > 90%) as evaluated by silver stained gels53.

Aggregation of purified Mcca and synthetic Mcc(12-37), and seeding in vitro

To start Mcc aggregation, purified Mcca powder was dissolved in sterile 10 mM NaOH solution, and filtered through a 30 kDa cutoff filter to remove aggregates. The fragment 12-37 of Mcc was synthesized in solid phase and purified by reverse phase chromatography. Lyophilized powder of synthetic Mcc(12-37) was dissolved in 0.1% NH4OH at a concentration of 2 mg/ml, centrifuged at 16,500 × g for 10 min to remove any aggregates. Purified Mcca (400 μg/ml) and soluble Mcc(12-37) (228 μg/ml) were incubated in aggregation buffer (50 mM PIPES-NaOH, pH 6.5, 0.5 M NaCl) for 48 h at 37 °C with vigorous shaking. For seeding of Mcc(12-37) and full length Mcca in vitro, 48 h aggregated Mcc(12-37) was used as a seed. Mcca (400 μg/ml) and Mcc(12-37) (228 μg/ml) were incubated in aggregation buffer in the absence or in the presence of pre-aggregated Mcc(12-37) seed (11 μg/ml) until 60 h at 37 °C with vigorous shaking.

Preparation of purified Mccia and culture containing Mccia for seeding in vivo

To isolate Mccia from the culture of Mcc producing bacteria, a 1:1000 dilution of overnight culture of Mcc producing bacteria was allowed to grow for 48 h, until reaching the stationary phase, at 37 °C with shaking. After 48 h, either whole bacterial culture (W) or culture supernatant (S) after removing bacterial cells by centrifuging at 4000 rpm for 10 min was used for seeding in vivo (Supplementary Figure 4). Mccia can also be produced in vitro by inducing the aggregation of Mcca, as described before.

Denaturation of Mccia

To denature Mccia, purified Mccia prepared in vitro and culture supernatant containing Mccia were either boiled for 15 min or incubated with 6 M GdnHCl for 2 h at room temperature followed by dialysis to remove GdnHCl, and used for in vivo seeding.

Thioflavin T (ThT) binding assay

The kinetics of Mcc aggregation was monitored by ThT binding assay, as described54. Mcc (400 μg/ml) and Mcc(12-37) (228 μg/ml) were allowed to aggregate in 50 mM PIPES (pH 6.5) containing 500 mM NaCl at 37 °C with vigorous shaking for different times. At the end of the reaction, 20 μl of the mixture was mixed with 80 μl of 6 μM ThT in 1X PBS (Phosphate Buffer Saline), and fluorescence was measured immediately at excitation of 435 nm and emission of 485 nm, respectively, using a microplate spectrofluorometer Gemini-EM (Molecular Devices, Sunnyvale, CA).

Transmission electron microscopy (TEM)

An aliquot of 10 μl of reaction sample was placed onto Formvar-coated 200-mesh copper grids for 5 min, washed at least three times with distilled water, and then negatively stained with 2% uranyl acetate for 1 min. Grids were examined by electron microscopy (H-7600, Hitachi, Japan) operated at an accelerating voltage of 80 kV.

Congo red (CR) binding

Amyloid-like nature of Mccia was examined by binding of the amyloid specific dye Congo red by the spectroscopic band shift assay27. Purified Mcca was allowed to aggregate in 50 mM PIPES (pH 6.5) containing 500 mM NaCl at 37 °C with vigorous shaking for 24 h. An aliquot was incubated with 12.5 μM CR for 30 min at 37 °C. The absorbance spectrum was recorded from 400 nm to 700 nm.

Proteinase K (PK) digestion and Immunoblotting

Samples were incubated with the indicated concentrations of PK at 37 °C for 30 min. The reaction was stopped by boiling of the sample in NuPAGE LDS buffer at 100 °C for 10 min. Then, samples were resolved by NuPAGE 4–12% Bis-Tris gels (Invitrogen). Proteins were electrophoretically transferred to nitrocellulose membranes (Amersham Biosciences, Germany). Membranes were blocked with 5% w/v nonfat dry milk in Tris-buffered saline-Tween 20 (TBS-T, 20 mM Tris, pH 7.2, 150 mM NaCl and 0.05% (v/v) Tween 20) at room temperature for 2 h. After blocking, the membranes were probed with anti-Mcc antibody (1:3000) and the anti-rabbit horseradish peroxidase-conjugated secondary antibodies (1:5000). The blots were visualized using enhanced chemiluminescence plus western blotting detection kit (Amersham Biosciences, Piscataway, NJ).

Dot blot analysis

Five μl of each reaction was spotted onto nitrocellulose membranes (Amersham Biosciences, Germany), and air dried for 30 min at room temperature. Finally, blots were blocked and visualized as described above (see PK digestion and Immunoblotting).

Mcc activity assay

Activity of Mcc in each sample was measured by critical dilution method (CDM) as described previously55. In brief, samples were centrifuged at 16,500 × g for 10 min at room temperature. The resultant supernatant was serially diluted in minimal medium, and 5 μl aliquots were laid onto Luria Broth (LB) agar plates overlaid with Mcc-sensitive E.coli BL21 (DE3) p11α2 cells. After 16 h of incubation at 37 °C, the activity of Mcc in the last dilution that gave detectable inhibition (approximately 2-times above the background levels) was determined and expressed in arbitrary units/ml55.

Immunodepletion of Mccia

Dynabeads sheep anti-rabbit antibody (Life Technologies, Oslo, Norway) were conjugated with anti-Mcc antibody overnight at 4 °C as per manufacturer’s instructions. Following conjugation, beads were washed and incubated with culture supernatant containing Mccia overnight at 4 °C, beads were removed with a magnet and the resulting supernatants were used for seeding.

Fourier-Transform Infrared spectroscopy (FTIR)

FTIR experiments were conducted in an FT/IR-4100 spectrometer from JASCO. Purified Mcca (400 μg/ml) was used as such or aggregated for 24 h, as described previously. Protein slurry was then placed on the top of a diamond PRO450-S Attenuated Total Reflectance unit from JASCO adapted to the FT/IR-4100 system. System parameters included 4.0 cm−1 resolution and an accumulation of 80 scans per sample. The data was processed using Cosine anodization and Mertz phase correction. The data was also corrected for ATR and carbon dioxide vapor absorption. Data fitting and secondary structure calculations of samples were analyzed, after buffer subtraction, by the Secondary Structure Estimation 4000 software from JASCO. Each sample was measured in triplicates to confirm the secondary structure.

Yeast strain and Plasmid construction

To construct pJ528-MCC (Leu), the Microcin open rading frame was obtained by a polymerase chain reaction (PCR) using pJEM15 plasmid harboring Mcc gene, as the template, 5′ GCGCGGACGTCATGGGAGAGACC GATCCAAATACT 3′ as the forward primer, and 5′ GCGCGggatccCTACCACTACC GGAACTGG 3′ as the reverse primer. After digestion with AatII and BamHI, the PCR fragment was ligated to pJ528 (Leu) that was predigested with AatII and BamHI. Yeast strain 780-1D (MATα kar1-1 SUQ5 ade2-1 his3 leu2 trp1 ura3 sup35) with the SUP35 maintainer plasmid pJ533 (URA3) was transformed with pJ528-MCC. The resulting transformants were grown on media containing 5-fluoroorotic acid to eliminate pJ533 (URA3). pJ528 (Leu), pJ533, and 780-1D were kindly provided by Dr. Dan Masison.

Sedimentation assay

A single colony of each strain expressing Sup35p or Mcc-Sup35MC was inoculated in 3 ml liquid YEPD alone or supplemented with 3 mM GdnHCl, and grown overnight at 30 °C with shaking. Cultures grown overnight were diluted into fresh media to a density of OD600 = 0.05 and grown to OD600 = 0.6 before harvesting. Cells were resuspended in buffer A (50 mM Tris-Hcl, pH 7.5; 50 mM KCl; 10 mM MgCl2) containing 10 mM PMSF and protease inhibitor (Roche). Cells were lysed with a bead beater using glass beads and were briefly spun at 3,000 rpm for 3 min to sediment cell debris. Lysates were incubated with SDS (final SDS concentration 1%) and triton X-100 (final concentration 0.5%) and centrifuged for 1 h at 40,000 rpm. Supernatant and pellet fractions were recovered. The total cell extracts, soluble, and pellet fractions of each sample were analyzed by SDS–PAGE and immunoblot analysis using an antibody, anti-Sup35C and C-terminal specific Mcc antibody.

Statistical Analysis

The significance of differences between the Mcc bacteriotoxic activity under different conditions was analyzed by two-way analysis of variance (ANOVA) using time and treatment as the variables. To assess differences in specific time points the data was analyzed by the Bonferroni post-test. Student’s t-test was used to analyze differences of activity between untreated, purified Mcca and Mccia (Fig. 1E). The level of significance was set at P < 0.05.

Additional Information

How to cite this article: Shahnawaz, M. et al. Prion-like characteristics of the bacterial protein MICROCIN E492. Sci. Rep. 7, 45720; doi: 10.1038/srep45720 (2017).

Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Material

Supplementary Materials
srep45720-s1.pdf (118.1KB, pdf)

Acknowledgments

We would like to thank Dr. Charles Mays (University of Texas, Medical School, Houston) for detailed editing of the manuscript.

Footnotes

The authors declare no competing financial interests.

Author Contributions M.S. designed the experiments, carried out the majority of the experiments, analyzed the results, prepared the final version of the figures and wrote the draft of the manuscript. K.W.P. collaborated in the experiments using the yeast prion reporter; R.D.E. and A.M. collaborated in the experiments analyzing the secondary structure of Mcc by FTIR; C.S. is the principal investigator on the project and was responsible for coordinating research activity, analyzing the data, funding, writing the manuscript and producing the final version of the article.

References

  1. Griffith J. S. Self-replication and scrapie. Nature 215, 1043–1044 (1967). [DOI] [PubMed] [Google Scholar]
  2. Prusiner S. B. Novel proteinaceous infectious particles cause scrapie. Science 216, 136–144 (1982). [DOI] [PubMed] [Google Scholar]
  3. Collinge J. Prion diseases of humans and animals: their causes and molecular basis. Annu. Rev. Neurosci. 24, 519–550 (2001). [DOI] [PubMed] [Google Scholar]
  4. Prusiner S. B. Prions. Proc. Natl. Acad. Sci. USA 95, 13363–13383 (1998). [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Soto C. Unfolding the role of protein misfolding in neurodegenerative diseases. Nat. Rev. Neurosci. 4, 49–60 (2003). [DOI] [PubMed] [Google Scholar]
  6. Chiti F. & Dobson C. M. Protein misfolding, functional amyloid, and human disease. Annu. Rev. Biochem. 75, 333–366 (2006). [DOI] [PubMed] [Google Scholar]
  7. Soto C., Estrada L. & Castilla J. Amyloids, prions and the inherent infectious nature of misfolded protein aggregates. Trends Biochem. Sci. 31, 150–155 (2006). [DOI] [PubMed] [Google Scholar]
  8. Soto C. Transmissible proteins: expanding the prion heresy. Cell 149, 968–977 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Jarrett J. T. & Lansbury P. T. Jr. Seeding “one-dimensional crystallization” of amyloid: a pathogenic mechanism in Alzheimer’s disease and scrapie? Cell 73, 1055–1058 (1993). [DOI] [PubMed] [Google Scholar]
  10. Wickner R. B. [URE3] as an altered URE2 protein: evidence for a prion analog in Saccharomyces cerevisiae. Science 264, 566–569 (1994). [DOI] [PubMed] [Google Scholar]
  11. Lindquist S. Mad cows meet psi-chotic yeast: the expansion of the prion hypothesis. Cell 89, 495–498 (1997). [DOI] [PubMed] [Google Scholar]
  12. Wickner R. B., Edskes H. K., Maddelein M. L., Taylor K. L. & Moriyama H. Prions of yeast and fungi. Proteins as genetic material. J. Biol. Chem. 274, 555–558 (1999). [DOI] [PubMed] [Google Scholar]
  13. Derkatch I. L., Bradley M. E., Hong J. Y. & Liebman S. W. Prions affect the appearance of other prions: the story of [PIN(+)]. Cell 106, 171–182 (2001). [DOI] [PubMed] [Google Scholar]
  14. Nakayashiki T., Kurtzman C. P., Edskes H. K. & Wickner R. B. Yeast prions [URE3] and [PSI + ] are diseases. Proc. Natl. Acad. Sci. USA 102, 10575–10580 (2005). [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Eaglestone S. S., Cox B. S. & Tuite M. F. Translation termination efficiency can be regulated in Saccharomyces cerevisiae by environmental stress through a prion-mediated mechanism. EMBO J. 18, 1974–1981 (1999). [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. True H. L. & Lindquist S. L. A yeast prion provides a mechanism for genetic variation and phenotypic diversity. Nature 407, 477–483 (2000). [DOI] [PubMed] [Google Scholar]
  17. Halfmann R., Alberti S. & Lindquist S. Prions, protein homeostasis, and phenotypic diversity. Trends Cell Biol. 20, 125–133 (2010). [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Si K., Lindquist S. & Kandel E. R. A neuronal isoform of the aplysia CPEB has prion-like properties. Cell 115, 879–891 (2003). [DOI] [PubMed] [Google Scholar]
  19. Hou F. et al. MAVS forms functional prion-like aggregates to activate and propagate antiviral innate immune response. Cell 146, 448–461 (2011). [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. de Lorenzo V. Isolation and characterization of microcin E492 from Klebsiella pneumoniae. Arch. Microbiol. 139, 72–75 (1984). [DOI] [PubMed] [Google Scholar]
  21. de Lorenzo V., Martinez J. L. & Asensio C. Microcin-mediated interactions between Klebsiella pneumoniae and Escherichia coli strains. J. Gen. Microbiol. 130 (Pt 2), 391–400 (1984). [DOI] [PubMed] [Google Scholar]
  22. Destoumieux-Garzon D. et al. Microcin E492 antibacterial activity: evidence for a TonB-dependent inner membrane permeabilization on Escherichia coli. Mol. Microbiol. 49, 1031–1041 (2003). [DOI] [PubMed] [Google Scholar]
  23. de Lorenzo V. & Pugsley A. P. Microcin E492, a low-molecular-weight peptide antibiotic which causes depolarization of the Escherichia coli cytoplasmic membrane. Antimicrob. Agents Chemother. 27, 666–669 (1985). [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Lagos R., Wilkens M., Vergara C., Cecchi X. & Monasterio O. Microcin E492 forms ion channels in phospholipid bilayer membrane. FEBS Lett. 321, 145–148 (1993). [DOI] [PubMed] [Google Scholar]
  25. de Lorenzo V. Factors affecting microcin E492 production. J. Antibiot. 38, 340–345 (1985). [DOI] [PubMed] [Google Scholar]
  26. Corsini G., Baeza M., Monasterio O. & Lagos R. The expression of genes involved in microcin maturation regulates the production of active microcin E492. Biochimie 84, 539–544 (2002). [DOI] [PubMed] [Google Scholar]
  27. Bieler S. et al. Amyloid formation modulates the biological activity of a bacterial protein. J. Biol. Chem. 280, 26880–26885 (2005). [DOI] [PubMed] [Google Scholar]
  28. Ghetti B. et al. Prion protein amyloidosis. Brain Pathol. 6, 127–145 (1996). [DOI] [PubMed] [Google Scholar]
  29. Yang H., Yang S., Kong J., Dong A. & Yu S. Obtaining information about protein secondary structures in aqueous solution using Fourier transform IR spectroscopy. Nat. Protoc. 10, 382–396 (2015). [DOI] [PubMed] [Google Scholar]
  30. Kayed R. et al. Common structure of soluble amyloid oligomers implies common mechanism of pathogenesis. Science 300, 486–489 (2003). [DOI] [PubMed] [Google Scholar]
  31. Lorenzo A. & Yankner B. A. Beta-amyloid neurotoxicity requires fibril formation and is inhibited by congo red. Proc. Natl. Acad. Sci. USA 91, 12243–12247 (1994). [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Porat Y., Abramowitz A. & Gazit E. Inhibition of amyloid fibril formation by polyphenols: structural similarity and aromatic interactions as a common inhibition mechanism. Chem. Biol. Drug Des 67, 27–37 (2006). [DOI] [PubMed] [Google Scholar]
  33. Yang F. et al. Curcumin inhibits formation of amyloid beta oligomers and fibrils, binds plaques, and reduces amyloid in vivo. J. Biol. Chem. 280, 5892–5901 (2005). [DOI] [PubMed] [Google Scholar]
  34. Caughey B., Raymond G. J., Kocisko D. A. & Lansbury P. T. Jr. Scrapie infectivity correlates with converting activity, protease resistance, and aggregation of scrapie-associated prion protein in guanidine denaturation studies. J. Virol. 71, 4107–4110 (1997). [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Li L. & Lindquist S. Creating a protein-based element of inheritance. Science 287, 661–664 (2000). [DOI] [PubMed] [Google Scholar]
  36. Osherovich L. Z., Cox B. S., Tuite M. F. & Weissman J. S. Dissection and design of yeast prions. PLoS. Biol. 2, E86 (2004). [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Chernoff Y. O., Lindquist S. L., Ono B., Inge-Vechtomov S. G. & Liebman S. W. Role of the chaperone protein Hsp104 in propagation of the yeast prion-like factor [psi+]. Science 268, 880–884 (1995). [DOI] [PubMed] [Google Scholar]
  38. Ferreira P. C., Ness F., Edwards S. R., Cox B. S. & Tuite M. F. The elimination of the yeast [PSI+] prion by guanidine hydrochloride is the result of Hsp104 inactivation. Mol. Microbiol. 40, 1357–1369 (2001). [DOI] [PubMed] [Google Scholar]
  39. Jung G. & Masison D. C. Guanidine hydrochloride inhibits Hsp104 activity in vivo: a possible explanation for its effect in curing yeast prions. Curr. Microbiol. 43, 7–10 (2001). [DOI] [PubMed] [Google Scholar]
  40. Patino M. M., Liu J. J., Glover J. R. & Lindquist S. Support for the prion hypothesis for inheritance of a phenotypic trait in yeast. Science 273, 622–626 (1996). [DOI] [PubMed] [Google Scholar]
  41. Tagliavini F., Forloni G., D’Ursi P., Bugiani O. & Salmona M. Studies on peptide fragments of prion proteins. Adv. Protein Chem. 57, 171–201 (2001). [DOI] [PubMed] [Google Scholar]
  42. Holscher C., Delius H. & Burkle A. Overexpression of nonconvertible PrPc delta114-121 in scrapie-infected mouse neuroblastoma cells leads to trans-dominant inhibition of wild-type PrP(Sc) accumulation. J. Virol. 72, 1153–1159 (1998). [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Caughey B. & Lansbury P. T. Protofibrils, pores, fibrils, and neurodegeneration: separating the responsible protein aggregates from the innocent bystanders. Annu. Rev. Neurosci. 26, 267–298 (2003). [DOI] [PubMed] [Google Scholar]
  44. Kane M. D. et al. Evidence for seeding of beta -amyloid by intracerebral infusion of Alzheimer brain extracts in beta -amyloid precursor protein-transgenic mice. J. Neurosci. 20, 3606–3611 (2000). [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Meyer-Luehmann M. et al. Exogenous induction of cerebral beta-amyloidogenesis is governed by agent and host. Science 313, 1781–1784 (2006). [DOI] [PubMed] [Google Scholar]
  46. Morales R., Duran-Aniotz C., Castilla J., Estrada L. D. & Soto C. De novo induction of amyloid-beta deposition in vivo. Mol. Psychiatry 17, 1347–1353 (2012). [DOI] [PubMed] [Google Scholar]
  47. Rymer D. L. & Good T. A. The role of prion peptide structure and aggregation in toxicity and membrane binding. J. Neurochem. 75, 2536–2545 (2000). [DOI] [PubMed] [Google Scholar]
  48. Ettaiche M., Pichot R., Vincent J. P. & Chabry J. In vivo cytotoxicity of the prion protein fragment 106-126. J. Biol. Chem. 275, 36487–36490 (2000). [DOI] [PubMed] [Google Scholar]
  49. Brown D. R. PrPSc-like prion protein peptide inhibits the function of cellular prion protein. Biochem. J. 352 Pt 2, 511–518 (2000). [PMC free article] [PubMed] [Google Scholar]
  50. Chabry J., Caughey B. & Chesebro B. Specific inhibition of in vitro formation of protease-resistant prion protein by synthetic peptides. J. Biol. Chem. 273, 13203–13207 (1998). [DOI] [PubMed] [Google Scholar]
  51. Soto C. et al. Reversion of prion protein conformational changes by synthetic beta-sheet breaker peptides. Lancet 355, 192–197 (2000). [DOI] [PubMed] [Google Scholar]
  52. Shahnawaz M. & Soto C. Microcin amyloid fibrils A are reservoir of toxic oligomeric species. J. Biol. Chem. 287, 11665–11676 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Wray W., Boulikas T., Wray V. P. & Hancock R. Silver staining of proteins in polyacrylamide gels. Anal. Biochem. 118, 197–203 (1981). [DOI] [PubMed] [Google Scholar]
  54. LeVine H. III Thioflavine T interaction with synthetic Alzheimer’s disease beta-amyloid peptides: detection of amyloid aggregation in solution. Protein Sci. 2, 404–410 (1993). [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Mayr-Harting A., Hedges A. J. & Berkeley R. C. W. Methods for studying bacteriocins. Methods Microbiol. 7A, 315–422 (1972). [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary Materials
srep45720-s1.pdf (118.1KB, pdf)

Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

RESOURCES