Abstract
Currently, therapy for squamous cancer (SqC) is unsatisfactory. Staphylococcal enterotoxin B (SEB) has strong immune regulatory activity. This study tests the hypothesis that SEB enforces the effect of immunotherapy on SqC growth in a mouse model. C3H/HeN mice and the SqC cell line squamous cell carcinoma VII were used to create an SqC mouse model. Immune cell assessment was performed by flow cytometry. Real-time RT-PCR and western blotting were used to evaluate target molecule expression. An apoptosis assay was used to assess the suppressive effect of T helper-9 (Th9) cells on the SqC cells. The results showed that immunotherapy consisting of SEB plus SqC antigen significantly inhibited SqC growth in the mice. The frequency of Th9 cells was markedly increased in the SqC tissue and mouse spleens after treatment. SEB markedly increased the levels of signal transducer and activator of transcription 5 phosphorylation and the expression of histone deacetylase-1 (HDAC1) and PU.1 (the transcription factor of the interleukin 9 (IL-9) gene) in CD4+ T cells. Exposure to SqC-specific Th9 cells markedly induced SqC cell apoptosis both in vitro and in vivo. In conclusion, the administration of SEB induces Th9 cells in SqC-bearing mice, and theseTh9 cells inhibit SqC growth.
Keywords: histone deacetylase-1, interleukin-9, squamous cancer, staphylococcal enterotoxin B, T helper-9 cell
Introduction
Squamous cancer (SqC) is one of the most common cancers in humans. The squamous cell is a type of epithelial cell. Although SqC is one of the major forms of skin cancer, it also occurs in the mucosa of the digestive tract, lungs, and other areas of the body. It has been reported that 90% of cases of head and neck cancer, including cancer of the mouth, nasal cavity, nasopharynx, throat and associated structures are SqC.1 However, SqC pathogenesis is unclear.2 The early diagnosis of SqC is sometimes difficult; indeed, SqC located in regions such as the rhinosinusesis often diagnosed in its advanced stages.3 Currently, the therapeutic effects on SqC are not satisfactory.4
A number of treatments have been used to treat SqC. Radiotherapy is one of the useful treatments; however, its major drawback is the development of radio resistance.5 Chemotherapy is another common option for SqC treatment. However, drug resistance may also develop in SqC cells.6 Surgical treatment is another option for some SqC patients, but the indications in advanced cases are limited. Immunotherapy has been used for the treatment of SqC in conjunction with other therapeutic treatments.7 The purpose of immunotherapy is to induce antitumor immune cells, such as CD8+ cytotoxic T cells, Th1 cells, Th2 cells, natural killer (NK) cells, and NKT cells. These anti-tumor immune cells induce cancer cell death through apoptosis or the release of antitumor molecules capable of inducing cancer cell death.8 For example, our previous work has indicated that the laryngeal cancer-derived matrix metalloproteinase-9 facilitates the development of a specific anti-laryngeal cancer response.9 However, specific immunotherapy for SqC has not been reported.
A recent finding has indicated that interleukin 9 (IL-9) possesses anti-tumor activity.10 IL-9 is a protein that belongs to the group of ILs and is produced mainly by CD4+ helper T cells. Cumulative evidence has indicated that IL-9 plays a critical role in Th2-dominant immune responses, such as allergic asthma.11 IL-9 in tumor tissues has been reported to contribute to anticancer functions by triggering the activation of dendritic cells (DCs), mast cells, NK cells, and CD8 T cells to mount an antitumor immune response.12 However, the mechanism by which IL-9-producing cells are generated in cancer-bearing subjects has not been elucidated.
Staphylococcal enterotoxin B (SEB), an exotoxin of staphylococcus aureus, is a superantigen. One unique feature of SEB is that it activates T cells via cross-linking the Vβ domain of the T-cell receptor to the major histocompatibility complex II (MHC II) in antigen-presenting cells. This feature can cause massive T-cell activation.13 The basic mechanism of immunotherapy is to induce a specific immune response, including the induction of specific immune effector T cells, to suppress target tissues and cells. By using SEB as an adjuvant, we successfully induced antigen-specific Th2 pattern-inflammation in the intestine.14,15 A previous study has indicated that the Th2-dominant status plays a critical role in the inhibition of cancer growth by immunotherapy.16 Based on the information above, we hypothesized that administration of SEB together with an SqC antigen (Ag) might generate a specific anti-SqC immune response. To test this hypothesis, we created an SqC mouse model. SqC growth was markedly inhibited after treatment with the SEB/SqC Ags,via a mechanism involving the induction of an anti-tumor T helper-9 (Th9) response.
Materials and methods
Reagents
Antibodies targeting signal transducer and activator of transcription 5 (STAT5), phosphorylated STAT5 (pSTAT5), PU.1, histone deacetylase-1 (HDAC1), and IL-9 were purchased from Santa Cruz (Shanghai, China). The neutralizing anti-IL-9 antibody and ELISA kits to detect IL-4, interferon gamma (IFN-γ), IL-9, and IL-10 were purchased from R&D Systems (Shanghai, China). The Foxp3 ELISA kit was purchased from Shanghai Enzyme-linked Biotechnology Co., Ltd (Shanghai, China). Sigma-Aldrich (Shanghai, China). The Chromatin Immunoprecipitation Kit and protein A/G agarose were purchased from Sigma-Aldrich. Trichostatin A (TSA) and JQ1 were purchased from Selleck (Shanghai, China). The reagents for RT-qPCR and western blotting were purchased from Invitrogen (Shanghai, China). The magnetic cell sorting (MACS) kits were purchased from Miltenyi Biotech (Shanghai, China).
Cancer cell culture
Squamous cell carcinoma (SCC) VII cells (a spontaneously arising squamous cell carcinoma cell line from C3H mice; maintained in our laboratory) were cultured in RPMI1640 medium supplemented with 10% fetal bovine serum, 100 U mL−1 penicillin, 0.1 mg mL−1 streptomycin, and 2 mM L-glutamine. The medium was changed every 2 or 3 days. Prior to use in experiments, the viability of the cells was assessed via the trypan blue exclusion assay and determined to be greater than 99%.
The preparation of cancer antigen and the mixture of SEB/antigen
SCC VII cells (a SqC cell line) were harvested from cultures and lysed with a lysis buffer (0.216% beta-glycerophosphate, 0.19% sodium orthovanadate, 0.001% leupeptin, 10% Triton-X-100, 3.15% Tris-HCl, 8.8% sodium chloride, 0.29% sodium ethylenediaminetetraacetic acid, and 1.12% sodium pyrophosphate decahydrate). The proteins in the lysates were quantified with Bio-Rad protein assay reagents and used as the SqC antigens. For the immunotherapy, a mixture of SqC extracts and SEB was prepared at a ratio of 25:1 (50 µg SqC extracts and 2 µg SEB per mouse per dose).
Animal SqC model development
Ninety-six female C3H/HeN mice (6–8 weeks old) were purchased from the Nanjing University Experimental Animal Institute (Nanjing, China). The mice were randomly divided into eight groups as denoted in Figure 1. The animals were housed in sterilized cages in a temperature-controlled room with a 12-h dark–light cycle. The mice were subcutaneously injected with 106 SCC VII cells (SqC cells) into the groin of each mouse. The tumor size of each mouse was measured with a slide caliper and recorded every other day, beginning on day 5 after SqC cell inoculation. The mice were killed on day 20. The blood, spleen, and SqC tissues were collected immediately after killing for additional experiments. The animal experimental procedures were approved by the Animal Ethics Committee at Shenzhen University. The procedures were performed in accordance with the institutional guidelines for the care and use of laboratory animals.
Figure 1.

Tumor size records. SCC VII cells were adoptively transferred by injection into the groins of C3H mice. The tumor sizes were measured with a slide caliper. The bars indicate the tumor size. SEB: 2 μg/mouse/day, ip. SqCAg: SqC antigen (the protein extracts of SCC VII cells; 50 μg/mouse/day mixed with SEB, ip). Ab: Anti-IL-9 neutralizing antibody (100 µg/mouse; ip on day 8, day 12, and day 16). cAb: Control Ab (IgG isotype, 100 µg/mouse; ip on day 8, day 12, and day 16). Th9 cells (or nT cell): the mice were adoptively transferred with Th9 cells (or naïve CD4+ T cells) at a dose of 106 cells/mouse on day 0 and day 10. Each group consisted of 12 mice. The data are presented as the mean ± SD. *P < 0.01 compared with the saline group.
SqC immunotherapy
The SqC-bearing mice were treated (intraperitoneal (ip) injection) with SEB (2 μg/mouse/day) and/or SqCAg (SqC antigen (the protein extracts of SCC VII cells; 50 μg/mouse/day)). A group of SqC-bearing mice were treated with SEB/SqCAg and the anti-IL-9 neutralizing antibody (100 µg/mouse; ip on days 8, 12, and 16). Another group of SqC-bearing mice were treated with SEB/SqCAg and a control antibody (IgG isotype, 100 µg/mouse; ip on days 8, 12, and 16).
Enzyme-linked immunosorbent assay (ELISA)
The cytokine levels of IL-4, IFN-γ, IL-9, IL-10, and Foxp3 were determined by ELISA with commercial reagent kits, following the manufacturer's instructions.
Cell isolation from SqC tissue
The SqC tissue was excised from SqC-bearing mice and cut into small pieces (approximately 2 × 2 × 2 mm) and incubated with collagenase IV (0.5 mg mL−1) for 2 h at 37 °C with mild agitation. The cells were passed through a cell strainer (40 μm) and collected by centrifugation at 1500 rpm for 5 min. A portion of the single cell suspension was analyzed by flow cytometry. For SqC cell isolation, T cells, B cells, DCs, mast cells, eosinophils, fibrocytes, and NK cells were selected by MACS; the remaining cells were used as SqC cells in other experiments.
Flow cytometry
CD4+ T cells(106 cells/sample) were blocked with 1% bovine serum albumin (BSA) for 30 min and incubated with fluorochrome-labeled antibodies of interest or the IgG isotype (used as a negative staining control). For intracellular staining, the cells were fixed and permeabilized for 2 h and then stained with the fluorochrome-labeled antibodies of interest or the IgG isotype. After washing, the cells were analyzed by flow cytometry. At least 100 000 cells were analyzed for each sample. The data were analyzed with the Flowjo software,withthe IgG isotype-stained cells as the gating reference.
T-cell proliferation assay
CD4+CD25− T cells were isolated from the SqC tissue or the spleen by MACS and labeled with carboxyfluorescein succinimidyl amino ester (CFSE). The cells were cultured in the presence of phorbol-12-myristate-13-acetate (PMA; 40 ng mL−1), DCs (T cell: DC = 5:1), and specific antigen (Ag; the SqC cell extracts; 5 μg mL−1). Three days later, the cells were analyzed by the CFSE-dilution assay in a flow cytometer (FACSCanto II, BD Biosciences, Shanghai, China).
Western blotting
The cells were lysed for western blotting in a protein lysis buffer. Nuclear extracts were obtained using a NE-PER cell fractionation kit (Thermo Scientific, Shanghai, China). The cell lysates or nuclear proteins were fractionated on a 12.5% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel and transferred onto a polyvinylidene difluoride (PVDF) membrane. The membrane was blocked with 5% skim milk for 30 min, incubated with the primaryantibodies (0.2 μg mL−1) overnight at 4 °C, and then incubated with the secondary antibodies (labeled with horseradish peroxidase) for 1 h. Washes with Tris-buffered saline with Tween 20 were performed after each incubation. The immunoblots on the membrane were developed with an enhanced chemiluminescence kit. The results were photographed with a KODAK Image Station 4000Pro (KODAK, Shanghai, China).
Co-immunoprecipitation analysis (Co-IP)
The cells were lysed in Co-IP buffer; then, the lysates were precleared with 50 µL of pansorbin cells (Calbiochem, Shanghai, China) for 2 h, and this was followed by centrifugation. The samples were precleared by incubation with protein G agarose beads for 2 h at 4 °C. Two micrograms of anti-PU.1, anti-STAT5, anti-HDAC1, or the IgG isotype (negative control) was added to the precleared lysates in the presence of protein G agarose beads and incubated at 4 °C overnight. The immune complexes on the beads were eluted with an elution buffer and separated by SDS-PAGE, transferred to a PVDF membrane, and immunoblotted with antibodies targeting PU.1, STAT5, or HDAC1. The subsequent analysis followed the western blotting procedures.
Real-time quantitative PCR (RT-qPCR)
Total RNA was extracted from CD4+ T cells using TRIzol reagent. The cDNA was synthesized with a Reverse Transcription Kit according to the manufacturer's instructions. The PCR was performed with a Bio-Rad MiniOpticon Real-Time PCR System using the SYBR Green PCR Master Mixto to obtain the Ct values. The results were calculated using the 2−ΔΔCt method. The relative expression levels of the target genes were calculated against the control group. The primers included: IL-9 (cttgcctgttttccatcgggandtctgtcttcatggtcggctt) and β-actin (gtgggaatgggtcagaagga and tcatcttttcacggttggcc).
Chromatin immunoprecipitation (ChIP)
CD4+CD25− T cells were purified by MACS. The cells were cultured under conditions to induce Th9 polarization (Supplementary Figure S1). The ChIP assay was performed with a commercial reagent kit following the manufacturer's instructions. Th9 cells or control cells (3 × 106 cells per sample) were treated with 1% formaldehyde to fix the protein–DNA complexes. Fixation was stopped by incubation with 1.25 M glycine for 5 min. The cells were lysed in a lysis buffer containing protease inhibitors and sonicated to shear the DNA into approximately 200- to 1000-bp DNA fragments. The samples were precleared with a protein G agarose/salmon sperm DNA slurry, and the immunoprecipitation analysis was performed at 4 °C overnight using an anti-PU.1 Ab or the IgG isotype (negative control) in the presence of protein G agarose beads. The immune complexes on the beads were eluted with an elution buffer. The DNA in the precipitated samples was recovered by reverse cross-linking at 65 °C for 4 h and analyzed by qPCR with primers targeting the Il9 promoter: forward, GGATCCTCAAGGCCAATGCT and reverse, ACACCTCTGAGAAGTCGCTC.17
Apoptosis assay
Apoptosis was assessed using Annexin V/propidium iodide (PI) staining and flow cytometry. The cells were stained with Annexin V (125 ng mL−1) following the manufacturer's instructions and PI (5 µg mL−1) for 15 min at room temperature. After washing with phosphate-buffered saline (PBS), the cells were analyzed with a flow cytometer. The Annexin V+ cells or Annexin V+ and PI+ cells were regarded as apoptotic cells.
Assessment of IL-9 receptor (IL-9R) expression in cancer cells
The mouse cancer cell line SCC VII (SqC) was cultured in Dulbecco's modified Eagle medium. The expression of IL-9R in these cells was analyzed by flow cytometry (by surface staining) and western blotting. To test whether other cancer cells in addition to the SqC cells also expressed IL-9R, GL261 cells (glioma cells), and CT26 cells (colon cancer cells) were purchased from ATCC (Beijing, China). The cells were cultured and analyzed by flow cytometry and western blotting to detect the expression of IL-9R.
Statistics
The data are presented as the mean ± SD. The difference between groups was determined by Student's t-test or analysis of variance if the analysis included more than two groups. A P < 0.05 was set as the criterion for significance.
Results
Administration of SEB together with SqC Ag (SqCAg) inhibits SqC growth
A mouse SqC model was developed. The mice were treated with SEB and/or SqCAg daily starting from the SqC inoculation. The tumor size was recorded every other day. The results showed that the administration of SEB/SqCAg significantly inhibited tumor growth, but this inhibition did not occur in the mice treated with either SEB or SqCAg alone (Figure 1). The results suggest that the co-administration of SEB and SqCAg is capable of inhibiting SqC growth in mice.
Co-administration of SEB and SqCAg increases serum IL-9
The results of Figure 1 imply that the co-administration of SEB/SqCAg induces an antitumor immune response. To test this inference, we killed the SqC-bearing mice on day 20, collected their blood and isolated the sera. The sera were analyzed by ELISA. The results showed that the levels of IL-4, IFN-γ, IL-10, and Foxp3 were slightly increased in the mice treated with SEB/SqCAg compared to the sera collected from the control mice (SqC-bearing mice treated with saline).However, the IL-9 levels were significantly increased (Figure 2). The IL-17 and IL-21 levels were below the limit of detection (not shown). The results suggest that treatment with SEB/SqCAg may induce a Th9 response in the mice.
Figure 2.

SqC-bearing mouse serum cytokine levels. The blood samples were collected from each mouse at killing; the sera were isolated and analyzed by ELISA. The bars indicate the serum levels of cytokines as denoted on the right side. SEB: 2 μg/mouse/day, ip. SqCAg: SqC antigen (the protein extracts of SCC VII cells; 50 μg/mouse/day, mixed with the SEB, ip). Ab: Anti-IL-9 neutralizing antibody (100 µg/mouse; ip on day 8, day 12, and day 16). cAb: Control Ab (IgGisotype, 100 µg/mouse; ip on day 8, day 12, and day 16). Th9 cells (or nT cells): the mice were adoptively transferred with Th9 cells (or naïve CD4+ T cells) at a dose of 106 cells/mouse on day 0 and day 10. Each group consisted of 12 mice. The data are presented as the mean ± SD. *P < 0.01 compared with the saline group.
Co-administration of SEB and SqCAg increases IL-9+ T cells in the SqC tissue and spleen in SqC-bearing mice
We isolated CD4+ T cells from the SqC tissues and spleens of the mice after killing. The cells were analyzed by flow cytometry. The results showed that the frequency of IL-9+ T cells was significantly higher in mice treated with SEB/SqCAg than in mice treated with saline, SEB alone, or SqCAg alone. However, the frequency of IL-4 and IFN-γ in mice treated with SEB/SqCAg was only slightly increased compared with that of mice treated with saline (P > 0.05). Moreover, the frequencies of IL-10+ T cells and Foxp3+ T cells were higher in the SqC tissues of mice treated with saline than in mice treated with SEB/SqCAg (Figure 3). The results support the inference that treatment with SEB/SqCAg induces Th9 cells in SqC-bearing mice.
Figure 3.

Assessment of CD4+ T-cell phenotypes in SqC and spleen tissues. CD4+ T cells were isolated by MACS from SqC tissues and the spleens of each mouse. The cells were analyzed by flow cytometry. (a–d), the dot plots show the frequency of CD4+ T cells. (e–x), the histograms indicate the frequency of the phenotypes of CD4+ T cells gated in panels a–d (indicated by arrows). The bar graphs show the summarized data of the histogram columns (the labels of the x-axis are the same as those in the dot plots and histograms). Each group consists of 12 mice. Samples from individual mice were processed separately. The data are presented as the mean ± SD. *P < 0.01 compared with the SEB/SqCAg group.
The IL-9+ T cells induced by SEB/SqCAg are SqC-specific
To elucidate whether the induced Th9 cells in SqC-bearing mice were SqCAg-specific, we performed a CFSE dilution assay with CD4+ cells isolated from the SqC-bearing mice. The results showed that only the CD4+ T cells from mice treated with SEB/SqCAg exhibited marked proliferation in the presence of SqCAg and DCs. In contrast, the CD4+ T cells from mice treated with either SEB, SqCAg, or saline did not exhibit apparent proliferation. The presence of an irrelevant Ag (BSA) instead of SqCAg did not induce the proliferation of the CD4+ T cells from mice treated with SEB/SqCAg. The results suggest that the treatment with SEB/SqCAg induces SqCAg-specific CD4+ T cells. Then, we analyzed the phenotypes of the proliferating cells. The results showed that close to 90% of the proliferating cells were IL-9-positive, but not IL-17- or IL-21-positive (Figure 4). Thus, treatment with SEB/SqCAg induced SqCAg-specific Th9 cells in the SqC-bearing mice. To verify the results shown in Figure 1, we performed an additional experiment in which the SqC-bearing mice were treated with SEB/SqCAg in combination with a neutralizing anti-IL-9 antibody and found that the inhibitory effect on SqC growth was abolished (Figure 1).
Figure 4.

Assessment of SqC-specific Th9 cells from SqC tissue. CD4+ T cells were isolated from the SqC tissues (the mouse group and treatment were denoted above each histogram); SqCAg (5 µg mL−1), PMA (20 ng mL−1), and DCs (DC: T cells = 103–104/well) were added to the culture. The cells were analyzed by flow cytometry. (a–e), the histograms indicate the frequency of proliferating cells. (f), the bars indicate the summarized data of (a–e) (mean ± SD; *P < 0.01 compared with group A. (g–h), the histograms indicate the frequency of IL-9+ T cells (g), IL-17+ T cells (h), and IL-21+ T cells (i) in the proliferating T cells of panel (d). The CD4+ T cells isolated from four mice were pooled into one sample; each group consisted of three pooled samples.
Inhibitory effects of Th9 cells on SEB/SqCAg-induced SqC growth
To test the effect of Th9 cells on the inhibition of SqC growth, we re-performed the experiment depicted in Figure 1. The SqC-bearing mice were treated with SEB/SqC Ag plus a neutralizing anti-IL-9 antibody (ip). As expected, the inhibition of SqC growth was abolished. To strengthen the results, a group of SqC-bearing mice were adoptively transferred with in vitro-generated SqC-specific Th9 cells (Supplementary Figure S1), which also inhibited SqC growth (Figure 1).
SEB induces IL-9 expression in CD4+ T cells
SEB can activate STAT518 and HDAC1.19 We inferred that STAT5 phosphorylation might be induced during the process of SEB-induced IL-9 expression in CD4+ T cells. To test this inference, we assessed the levels of STAT5 and pSTAT5 in CD4+ T cells. The results showed that both STAT5 and pSTAT5 could be detected in CD4+ T cells. Exposure to SEB did not significantly alter the levels of STAT5, but pSTAT5 was markedly increased in an SEB dose-dependent manner.
A previous study has indicated that STAT5 interacts with HDAC1 to regulate target gene transcription.20 Thus, we inferred that the SEB-activated STAT5 might bind HDAC1 and the IL-9 transcription factor PU.1 to form a complex. To test this hypothesis, we performed an immunoprecipitation assay with the CD4+ T-cell extracts after exposure to SEB. The results showed the detection of a triple complex of STAT5, HDAC1, and PU.1 (Figure 5b).
Figure 5.

SEB induces IL-9 expression in CD4+ T cells. Naïve CD4+ T cells were isolated by MACS from mouse spleen. The cells were cultured in anti-CD3 bound plates for 9 days in the presence of anti-CD28 (5 µg mL−1), TGF-β1 (3 ng mL−1), IL-4 (10 ng mL−1), SEB (the doses are denoted in the figure), SqCAg (5 µg mL−1), IL-2 (40 ng mL−1), and DCs (DC: T cells = 104:105/well). The cells were collected at the end of culture. Total RNA and proteins were extracted. (a), the western blots indicate the levels of STAT5 and pSTAT5 in the cell extracts. (b), the cell extracts were analyzed by immunoprecipitation. The western blots indicate the levels of PU.1, STAT5, and HDAC1. IsoIgG: IgG Isotype. (c), The bars indicate the rate of PU.1 binding to the il9 promoter (using the IgG isotype to replace the anti-PU.1 Ab did not result in binding; data not shown). (d), the bars indicate the mRNA levels of IL-9 in the cells (by RT-qPCR). (e), the western blots indicate the IL-9 protein levels in the cells. The table above the plots indicates the integrated density of the blots. (a), in the presence of the HDAC1 inhibitor (TSA; 300 nM). (b), in the presence of the STAT5 inhibitor (JQ1, 1 μM). The data are presented as the mean ± SD. *P <0.01 compared with the dose ‘0' group. The data are representative of three independent experiments.
Next, we investigated whether this complex (Figure 5b) bound to the il9 promoter. As shown by the ChIP assay, the IL-9 transcription factor PU.1 bound to the il9 promoter in an SEB dose-dependent manner. Because STAT5 and HDAC1 form a complex with PU.1 after exposure to SEB, we inferred that STAT5 and HDAC1 are required for the SEB-induced binding of PU.1 to the il9 promoter. To test this inference, we added a STAT5 inhibitor or HDAC1 inhibitor to the culture in addition to SEB. Indeed, the il9 promoter-binding activity of PU.1 was abolished by either the STAT5 or HDAC1 inhibitor (Figure 5c).
We also assessed the effect of SEB on the regulation of IL-9 expression in CD4+ T cells by RT-qPCR and western blotting. The results showed that exposure to SEB markedly induced IL-9 expression by the cells at both the mRNA and protein levels; this increase was inhibited by the presence of either the STAT5 or HDAC1 inhibitor (Figure 5d and e).
Ag-specific Th9 cells induce SqC cell apoptosis
To test the inhibitory effect of the Ag-specific Th9 cells on the SqC cells, we generated Ag-specific Th9 cells (Supplementary Figure S1). The Th9 cells were cultured with the SqC cells for 24 h. As analyzed by flow cytometry, the Th9 cells markedly induced SqC cell apoptosis (Figure 6a, b, and g). The apoptosis was abolished by the presence of a neutralizing anti-IL-9 antibody (Figure 6c–g) and was mimicked by ip injection with recombinant IL-9 (Figure 6d–g). In contrast, naïve CD4+ T cells did not induce SqC cell apoptosis (Figure 6e–g). Additionally, the SqC-specific Th9 cells were not capable of inducing apoptosis in other cancer cells (CT26 colon cancer cell line) (Figure 6f and g). These results were enforced by the finding that the SqC cells (SCC VII cells) expressed the IL-9R (Figure 6h–k). Although other cancer cell lines (CT26 cells and GL261 cells) also expressed the IL-9R (Figure 6h–k), these cell lines did not induce the release of IL-9 into the culture supernatant by SqC-specific Th9 cells (Figure 6l).
Figure 6.

Ag-specific Th9 cells induce SqC cell apoptosis. SqC-specific Th9 cells were generated (Supplementary Figure S1). The cells were cultured for 24 h in the presence of DCs (Th9: DC = 5:1). The additional treatment is denoted above each subpanel. The SqC cells were negatively selected by MACS, stained with Annexin V and PI, and analyzed by flow cytometry. (a–f), the gated dot plots indicate the frequency of apoptotic cells. SqC: SqC cells (SCC VII cells; 106 cell mL−1). Th9: SqC-specific Th9 cells (106 cells mL−1). Anti-IL-9 Ab: 1 µg mL−1. IL-9: 1 µg mL−1. CT26 cells (a colon cancer cell line). GL261 cells: a glioma cell line. G, the bars indicate the summarized data of a–f. (h–j), the gated dot plots indicate the frequency of IL-9R+ cells. (k), the western blots indicate the IL-9R protein levels in the cell lines. (l), the bars indicate the IL-9 levels in the culture supernatants after coculture with SqC-specific Th9 cells. The data and bars represent the mean ± SD. *P <0.01 compared with group A. The data are representative of three independent experiments.
Discussion
Although cancer research has rapidly advanced over the last few decades, the therapeutic efficacy of cancer treatments is currently still poor. Thus, finding an efficient therapeutic treatment is of significance. The present data show that SEB may function as a potential agent to facilitate specific immunotherapy for SqC. The data indicate that co-administration of SEB and SqCAg dramatically inhibits SqC growth in a mouse model. The underlying mechanism involves the induction of SqC-specific Th9 cells by SEB and SqCAg, the latter of which is capable of inducing SqC cell apoptosis.
Th9 cells belong to the effect or T cells and release cytokines (i.e., IL-9) to regulate immune responses. Dardalhon et al. have indicated that Th9 cells do not have a suppressive function but promote tissue inflammation, such as colitis and neuritis.21 Staudt et al. have reported that Th9 cells are involved in the pathogenesis of asthma.22 Vegran's study has shown that Th9 cells are capable of inhibiting cancer growth.23 Our data are in line with Vegran's report because we show that Th9 cells inhibit SqC growth and induce SqC cell apoptosis. Importantly, the results show that the induced Th9 cells are SqC-specific. These Th9 cells are activated by exposure to the specific Ag (SqC cell extracts) or SqC cells. Moreover, the results suggest that cancer-specific Th9 cells can be generated in vitro and can be adoptively transferred into cancer-bearing subjects. The cancer tissue is a source of the cancer-specific Ag that is needed to activate the transferred Ag-specific Th9 cells. This inference is supported by the data that adoptively transferred SqC-specific Th9 cells markedly inhibit SqC growth.
The generation of Th9 cells has been investigated. Veldhoen et al. have indicated that although exposure to TGF-β can induce regulatory T cells, concurrent exposure to TGF-β and IL-4 induces Th9 cells.24 Staudt et al. have indicated that interferon-regulatory factor 4 is essential for the developmental program of Th9 cells.22 Liao et al. have indicated that IL-2-JAK3-STAT5 signaling is required for Th9 differentiation.25 Our data describe a novel pathway to generate Th9 cells by exposing CD4+ T cells to SEB. SEB is a superantigen that can activate T cells via cross-linking the T-cell receptors of effector T cells and MHC II on DCs. Dhaliwal et al. have indicated that SEB increases the expression of defensin, thus strengthening innate immunity.26 Our data reveal that SEB can also inhibit SqC growth in mice. Additionally, the data show that Th9 cell differentiation can be induced by SEB without the presence of TGF-β and IL-4.
Our results reveal the signal transduction pathway by which SEB induces the differentiation of Th9 cells. STAT5, HDAC1, and PU.1 are important molecules that mediate the SEB signal to induce Th9 cell induction. Lee et al. have indicated that STAT5 is important for Th9 cell differentiation.25 Our data also show that STAT5 is required for the induction of Th9 cells. Additionally, HDAC1 is required for Th9 cell differentiation, and the transcription factor PU.1 is important for Th9 cell induction in our study.
The data show that SEB enforces the development of anti-SqC immune responses. Previous reports have also indicated that SEB is associated with the pathogenesis of allergic disorders. The clinical study of Liu et al. has shown that SEB is associated with patients with allergic asthma and allergic rhinitis.27 Orfali et al. have indicated that Staphylococcus aureus is present in 80%–100% of skin samples from atopic patients and is related to worsening of the disease by the action of enterotoxins.28 Our previous work has indicated that SEB acts as an adjuvant in the development of a food allergy mouse model.14 We have also found that SEB is decomposed into small peptides in the digestive tracts of patients with food allergies, and then the SEB peptides act as haptens, facilitating the development of food allergies.15 These studies suggest that the use of SEB as an adjuvant may evoke a severe allergic reaction. To avoid a possible adverse reaction and maintain the immune system to ensure the efficacy of the immunotherapy, we reduced the dose of SEB from 10 μg/mouse in the food allergy study14 to 2 μg/mouse in the present study. Indeed, no severe allergic reactions were observed in the mice. This strategy may be used in the design of future clinical studies.
In summary, the present data show that SEB can facilitate the induction of SqC-specific Th9 cells in SqC-bearing mice. Exposure to SqCAg or SqC cells induces SqC-specific Th9 cells to release IL-9; the IL-9 also mediates the induction of SqC cell apoptosis. The data suggest that SEB has the potential for use in the treatment of SqC.
Authors' Contributions
BPM, RSZ, HJS, YPY, TC, LL, JQL, and JL performed the experiments, analyzed data, and reviewed the manuscript. ZGL and PCY organized the study and supervised the experiments. PCY designed the project and wrote the manuscript.
Acknowledgments
This study was supported by grants from the Innovation of Science and Technology Commission of Shenzhen Municipality (JCYJ20140418095735538; JCYJ20120613161724279; JCYJ20120613172559904; JCYJ20130329110735981; JCYJ20120613173233810); International Collaboration Project (GJHZ20130408174112021); and the National Nature Science Foundation and China (81373176).
Footnotes
Supplementary information of this article can be found on the Cellular & Molecular Immunology's website (http://www.nature.com/cmi).
None to declare.
Supplementary Information
References
- Winquist E, Al-Rasheedy I, Nichols AC, Palma DA, Stitt L. Temporal changes in the efficacy of chemotherapy for recurrent or metastatic squamous cell carcinoma of the head and neck: a systematic review and meta-analysis. Cancer Treat Rev 2014; 40: 1073–1079. [DOI] [PubMed] [Google Scholar]
- Cai Y, Li J, Lu A, Zhong W, Gao J, Zheng Y et al. Increased serum levels of macrophage inflammatory protein-3 alpha and cystatin a predict a poor prognosis of nasopharyngeal carcinoma. Medicine (Baltimore) 2014; 93: e123. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Homma A, Hayashi R, Matsuura K, Kato K, Kawabata K, Monden N et al. Lymph node metastasis in t4 maxillary sinus squamous cell carcinoma: incidence and treatment outcome. Ann Surg Oncol 2014; 21: 1706–1710. [DOI] [PubMed] [Google Scholar]
- Mahalingappa YB, Khalil HS. Sinonasal malignancy: presentation and outcomes. J Laryngol Otol 2014; 128: 654–657. [DOI] [PubMed] [Google Scholar]
- Denaro N, Merlano MC, Russi EG, Lo Nigro C. Non coding RNAs in head and neck squamous cell carcinoma (HNSCC): a clinical perspective. Anticancer Res 2014; 34: 6887–6896. [PubMed] [Google Scholar]
- Viet CT, Dang D, Achdjian S, Ye Y, Katz SG, Schmidt BL. Decitabine rescues cisplatin resistance in head and neck squamous cell carcinoma. PLoS One 2014; 9: e112880. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tewari KS, Monk BJ. New strategies in advanced cervical cancer: from angiogenesis blockade to immunotherapy. Clin Cancer Res 2014; 20: 5349–5358. [DOI] [PubMed] [Google Scholar]
- Lee AS. Glucose-regulated proteins in cancer: molecular mechanisms and therapeutic potential. Nat Rev Cancer 2014; 14: 263–276. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang BQ, Zhang CM, Gao W, Wang XF, Zhang HL, Yang PC. Cancer-derived matrix metalloproteinase-9 contributes to tumor tolerance. J Cancer Res Clin Oncol 2011; 137: 1525–1533. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Purwar R, Schlapbach C, Xiao S, Kang HS, Elyaman W, Jiang X et al. Robust tumor immunity to melanoma mediated by interleukin-9-producing T cells. Nat Med 2012; 18: 1248–1253. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Farahani R, Sherkat R, Hakemi MG, Eskandari N, Yazdani R. Cytokines (interleukin-9, IL-17, IL-22, IL-25 and IL-33) and asthma. Adv Biomed Res 2014; 3: 127. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Vegran F, Apetoh L, Ghiringhelli F. Th9 cells: a novel CD4 T-cell subset in the immune war against cancer. Cancer Res 2015; 75: 475–479. [DOI] [PubMed] [Google Scholar]
- Sharma P, Wang N, Kranz DM. Soluble T cell receptor Vβ domains engineered for high-affinity binding to staphylococcal or streptococcal superantigens. Toxins (Basel) 2014; 6: 556–574. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yang PC, Xing Z, Berin CM, Soderholm JD, Feng BS, Wu L et al. TIM-4 expressed by mucosal dendritic cells plays a critical role in food antigen-specific Th2 differentiation and intestinal allergy. Gastroenterology 2007; 133: 1522–1533. [DOI] [PubMed] [Google Scholar]
- Yang SB, Li TL, Chen X, An YF, Zhao CQ, Wen JB et al. Staphylococcal enterotoxin B-derived haptens promote sensitization. Cell Mol Immunol 2013; 10: 78–83. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhao P, Bu X, Wei X, Sun W, Xie X, Li C et al. Dendritic cell immunotherapy combined with cytokine-induced killer cells promotes skewing toward Th2 cytokine profile in patients with metastatic non-small cell lung cancer. Int Immunopharmacol 2015; 25: 450–456. [DOI] [PubMed] [Google Scholar]
- Bassil R, Orent W, Olah M, Kurdi AT, Frangieh M, Buttrick T et al. BCL6 controls Th9 cell development by repressing Il9 transcription. J Immunol 2014; 193: 198–207. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Nielsen M, Svejgaard A, Ropke C, Nordahl M, Odum N. Staphylococcal enterotoxins modulate interleukin 2 receptor expression and ligand-induced tyrosine phosphorylation of the Janus protein-tyrosine kinase 3 (Jak3) and signal transducers and activators of transcription (Stat proteins). Proc Natl Acad Sci USA 1995; 92: 10995–10999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Busbee PB, Nagarkatti M, Nagarkatti PS. Natural indoles, indole-3-carbinol and 3,3′-diindolymethane, inhibit T cell activation by staphylococcal enterotoxin B through epigenetic regulation involving HDAC expression. Toxicol Appl Pharmacol 2014; 274: 7–16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Xu M, Nie L, Kim SH, Sun XH. STAT5-induced Id-1 transcription involves recruitment of HDAC1 and deacetylation of C/EBPbeta. EMBO J 2003; 22: 893–904. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dardalhon V, Awasthi A, Kwon H, Galileos G, Gao W, Sobel RA et al. IL-4 inhibits TGF-beta-induced Foxp3+ T cells and, together with TGF-beta, generates IL-9+ IL-10+ Foxp3(-) effector T cells. Nat Immunol 2008; 9: 1347–1355. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Staudt V, Bothur E, Klein M, Lingnau K, Reuter S, Grebe N et al. Interferon-regulatory factor 4 is essential for the developmental program of T helper 9 cells. Immunity 2010; 33: 192–202. [DOI] [PubMed] [Google Scholar]
- Vegran F, Berger H, Boidot R, Mignot G, Bruchard M, Dosset M et al. The transcription factor IRF1 dictates the IL-21-dependent anticancer functions of TH9 cells. Nat Immunol 2014; 15: 758–766. [DOI] [PubMed] [Google Scholar]
- Veldhoen M, Uyttenhove C, van Snick J, Helmby H, Westendorf A, Buer J et al.Transforming growth factor-beta ‘reprograms' the differentiation of T helper 2 cells and promotes an interleukin 9-producing subset. Nat Immunol 2008; 9: 1341–1346. [DOI] [PubMed] [Google Scholar]
- Liao W, Spolski R, Li P, Du N, West EE, Ren M et al. Opposing actions of IL-2 and IL-21 on Th9 differentiation correlate with their differential regulation of BCL6 expression. Proc Natl Acad Sci USA 2014; 111: 3508–3513. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dhaliwal W, Kelly P, Bajaj-Elliott M. Differential effects of Staphylococcal enterotoxin B-mediated immune activation on intestinal defensins. Clin Exp Immunol 2009; 156: 263–270. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liu JN, Shin YS, Yoo HS, Nam YH, Jin HJ, Ye YM et al. The prevalence of serum specific IgE to superantigens in asthma and allergic rhinitis patients. Allergy Asthma Immunol Res 2014; 6: 263–266. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Orfali RL, Sato MN, Santos VG, Titz TO, Brito CA, Duarte AJ et al. Staphylococcal enterotoxin B induces specific IgG4 and IgE antibody serum levels in atopic dermatitis. Int J Dermatol 2015; 54: 898–904. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
