6-Cyclohexylmethyl-3-hydroxypyrimidine-2,4-dione as an Inhibitor Scaffold of HIV Reverase Transcriptase: Impacts of the 3-OH on Inhibiting RNase H and Polymerase

Abstract

3-Hydroxypyrimidine-2,4-dione (HPD) represents a versatile chemical core in the design of inhibitors of human immunodeficiency virus (HIV) reverse transcriptase (RT)-associated RNase H and integrase strand transfer (INST). We report herein the design, synthesis and biological evaluation of an HPD subtype (4) featuring a cyclohexylmethyl group at the C-6 position. Antiviral testing showed that most analogues of 4 inhibited HIV-1 in the low nanomolar to submicromolar range, without cytotoxicity at concentrations up to 100 μM. Biochemically, these analogues dually inhibited both the polymerase (pol) and the RNase H functions of RT, but not INST. Co-crystal structure of 4a with RT revealed a nonnucleoside RT inhibitor (NNRTI) binding mode. Interestingly, chemotype 11, the synthetic precursor of 4 lacking the 3-OH group, did not inhibit RNase H while potently inhibiting pol. By virtue of the potent antiviral activity and biochemical RNase H inhibition, HPD subtype 4 could provide a viable platform for eventually achieving potent and selective RNase H inhibition through further medicinal chemistry.

Graphical Abstract

1. Introduction

HIV-1 infection is clinically managed [1] by highly active antiretroviral therapy (HAART) [1] which comprises four major classes of drugs: the nucleoside RT inhibitors (NRTIs) [2], NNRTIs [3], protease inhibitors (PIs) [4], and INST inhibitors (INSTIs) [5]. Long term HAART can be plagued by toxicity and the emergence of drug resistance. Structurally novel HIV inhibitors, particularly those with a distinct mechanism of action, could add significantly to the existing HAART repertoire. We have long been interested in exploring chemotypes amenable to structural elaboration toward inhibiting different targets of HIV-1 [6–12]. One such chemotype is the versatile HPD core (Figure 1) which was initially designed to dually inhibit RT pol and INST (subtype 1) [12]. Removal of the N-1 and C5 substituents and redesign of the C6 moiety led to subtype 2 which selectively inhibited the RNase H function of RT [8]. Introduction of a C-5 carboxamide moiety and replacement of the C-6 aryl with a small alkyl group resulted in subtype 3, which potently inhibited both RNase H and INST [9]. Among other viable modifications for the HPD core, the replacement of the phenyl ring at the C-6 position of subtype 1 with a cyclohexyl group generated a new subtype 4 (Figure 1b) which conferred highly potent antiviral activity with dual biochemical inhibition against HIV-1 RT pol and RNase H functions. We report herein the synthesis, antiviral, biochemical and biophysical characterizations of subtype 4. The key medicinal chemistry observation was that most analogues potently inhibited HIV in cell culture and that the biochemical inhibitory profile of RT hinges largely on the 3-OH group. The synthetic precursor of subtype 4, chemotype 11 which lacks the 3-OH group, did not inhibit the RNase H function of RT, though the higher potency against RT pol conferred better antiviral activity against HIV-1 when compared to 4.

Figure 1.

Variants of the HPD chemotype. (a) HPD subtypes 1—3 have been reported to inhibit RT and/or INST of HIV-1; (b) replacement of the C-6 phenyl ring of subtype 1 led to subtype 4 with substantially different biological activity profiles.

2. Results and Discussion

2.1 Chemistry

The synthesis of HPD subtype 4 is described in Scheme 1. The overall approach was adapted from the route reported for the synthesis of subtype 1 [12]. The synthesis entails a β-ketoester intermediate 6 which was previously prepared via a Blaise reaction between cyclohexylacetonitrile (7) and a bromoester (8) [13]. However, it turned out that the cost of starting material 7 is too high to allow the preparation of 6 at the scale necessary for analogue synthesis. In our synthesis, an alternative method starting from the much cheaper cyclohexylacetic acid (5) was used [14]. Acid 5 was first activated by treating with carbonyldiimidazole (CDI) and then reacted with the mono potassium salt of a substituted malonate. This procedure proved to be highly efficient in delivering β-ketoester intermediate 6 in large scale. Cyclization of 6 with thiourea yielded the 2-thioxopyrimidine-4-one intermediate 9, which upon S-alkylation and hydrolysis was converted to the key pyrimidine-2,4-dione intermediate 10. Subsequent selective N-1 alkylation of 10 via a bis-silylated pyrimidine intermediate with an in situ generated chloromethyl ether produced 11. Finally, the key N-3 OH group was introduced via a base-mediated oxidation with meta-chloroperoxybenzoic acid (mCPBA) to complete the synthesis of subtype 4.

Scheme 1^a. Synthesis of HPD subtype 4.

^aReagents and conditions: a) CDI, CH₃CN, rt, 30 min, R¹CH(CO₂Et)(CO₂K), Et₃N–MgCl₂, rt, overnight; b) Zn, THF; c) thiourea, EtONa, EtOH, refluxing for 8h; d) ClCH₂COOH, AcOH, H₂O, refluxing, overnight; e) CH₃C(OTMS)=NTMS (BSA), substituted benzyl alcohol, (HCHO)_n, TMSCl, TBAI ( cat.), CH₂Cl₂, rt, 70–90%; f) NaH, mCPBA, THF, rt.

2.2. Biology

All analogues of subtype 4 were tested in a MAGI antiviral assay[[15, 16]] in dose response fashion, as well as three biochemical assays against RT pol, RT RNase H and INST. The results are described in Table 1.

Table 1.

Biochemical and antiviral assay results of subtype 4

Compd	Structure	RT IC50 a(μM)		INST IC50 a (μM)	MAGI Antiviral
		RNase H	Pol		EC50b (μM)	CC50c (μM)
4ad		5.2 ± 0.8	0.45± 0.07	>100	0.026 ± 0.002	>100
4b		2.7 ± 2	9.9 ± 0.04	>100	2.4 ± 0.2	>100
4c		5.5 ± 0.2	2.3 ± 2	>100	0.059 ± 0.004	>100
4d		5.8 ± 0.2	1.5 ± 0.5	>100	0.039 ± 0.008	>100
4e		1.1 ± 0.3	6.5 ± 0.2	>100	0.42 ± 0.1	>100
4f		1.7 ± 0.5	>10	>100	4.1 ± 0.5	>100
4g		10	7.0 ± 2	>100	2.4 ± 0.3	>100
4h		2.1 ± 1	6.5 ± 1	>100	0.43 ± 0.06	>100
4i		3.1 ± 1	>10	>100	>15	>100
4j		2.2 ± 0.9	>10	>100	>15	>100
4k		4.6 ± 0.4	10	>100	>15	>100
4l		7.6 ± 0.6	10	>100	>15	>100
4m		3.9 ± 0.2	>10	>100	10 ± 1.1	>100
14	--	>10	0.42 ± 0.2	--	0.011 ± 0.0001	58 ± 2

^aConcentration of compound inhibiting the target enzyme by 50%.

^bConcentration of compound inhibiting virus replication by 50%.

^cConcentration of compound resulting in 50% cell death. All assay results expressed as mean ± standard deviation from at least two independent experiments.

^dNo pol inhibition was observed against RT mutants Y181C or K103N at concentrations up to 10 μM.

HPD 4 potently inhibited HIV-1

In the antiviral assays, all analogues with an isopropyl or ethyl group at the C5 position (4a–4h) showed strong inhibition against HIV-1 in the low nanomolar to low micromolar range, whereas those with a methyl substituent (4i–4m) did not inhibit HIV-1 at concentrations up to 15 μM (Table 1). Among the active analogues, 4a (EC₅₀ = 26 nM), 4c (EC₅₀ = 59 nM) and 4d (EC₅₀ = 39 nM) exhibited antiviral potencies comparable to that of 14 (EC₅₀ = 11 nM), a potent NNRTI. In addition, while 14 showed modest cytotoxicity (CC₅₀ = 58 μM), toxicity was not observed with any of the subtype 4 analogues at concentrations up to 100 μM, suggesting that our new compounds possess a favorable therapeutic profile in cell culture. Importantly, the antiviral potency observed from the MAGI assay was confirmed in a distinct cytoprotection assay[16, 17] in which cytopathic effect of HIV-1 was measured. In this assay, 4c (EC₅₀ = 0.56 μM), 4d (EC₅₀ = 0.32 μM) and 4e (EC₅₀ = 1.8 μM) all showed potent antiviral activity (data not listed in Table 1).

Subtype 4 dually inhibited RT pol and RNase H

Biochemical evaluations of our compounds resulted in a few major observations. First of all, none of the analogues inhibited INST at concentrations up to 100 μM (Table 1), whereas subtype 1 was previously reported to confer low micromolar inhibition against INST[12]. This is not surprising as inhibition of INST minimally requires a chelating triad and a hydrophobic aromatic group, typically a fluorobenzyl group[18]. In subtype 4 the benzyl group is replaced with a cyclohexylmethyl group, thus the lack of anti-INST activity. It is noteworthy that achieving selective RNase H inhibition over INST inhibition could be a challenge due to their similarity in active site fold and mechanism of catalysis[19]. By abrogating the inhibitory activity against INST, substituting the cyclohexyl group for the phenyl ring provides a distinct advantage toward achieving selective RNase H inhibition. Second, all analogues with an isopropyl or ethyl group at the C5 position (4a–4h) showed dual inhibition against RT pol and RNase H, except for compound 4f which did not inhibit RT pol. By contrast, analogues with a methyl substituent (4i–4m) only inhibited RT RNase H (Table 1). Importantly, with most compounds the RT pol inhibition appeared to correlate very well with the observed antiviral activity. As mentioned earlier, the methyl substitution at the C5 position conferred no antiviral activity at 15 μM and weak or no pol inhibition as observed with compounds 4i–4l, whereas the three most active analogues (4a, 4c and 4d) from the antiviral assay also exhibited the highest potency against RT pol. In addition, compound 4a inhibited RT pol with an IC₅₀ (0.45 μM) similar to 14 (IC₅₀ = 0.42 μM) and conferred a comparable antiviral activity (EC₅₀ = 26 nM) to 14 (EC₅₀ = 11 nM). Furthermore, significant inhibition was not observed with compound 4a at concentrations up to 10 μM against the Y181C or K103N mutants of RT (data not shown). All these findings strongly indicate that the observed antiviral activity is most likely via RT pol inhibition. The exceptions are compounds 4f and 4m with which the antiviral activity correlated with only the RNase H inhibition as no inhibition against RT pol was observed.

Subtype 4 binds to NNRTI binding pocket

To confirm the antiviral mechanism of action through RT pol inhibition, we solved a crystal structure of analogue 4a bound to RT at 2.7 Å. The structure revealed that analogue 4a binds at the NNRTI binding pocket of RT, reminiscent to that of the 1-[(2-Hydroxyethoxy)methyl]-6-(phenylthio)thymine (HEPT) type of NNRTIs [20, 21]. HEPT (12)[22, 23] was among the earliest NNRTIs and a few variants (Figure 3), such as MKC-442 (13)[20, 24] and TNK-651(14)[20] and TNK-6123 (15)[21], have been reported to inhibit HIV-1 with exceptional potencies.

Figure 3.

Structures of reported HEPT-based NNRTIs 12–15. Precursor 11 closely mimics 14 and could be a scaffold for novel NNRTIs.

The precursor 11 potently inhibited HIV-1 and RT pol

The immediate synthetic precursor of subtype 4, chemotype 11, closely mimics the HEPT variants, particularly 14. Therefore, we were prompted to test all analogues of 11. We first tested chemotype 11 in the MAGI antiviral assay. Remarkably, with the single exception of 11m, all analogues inhibited HIV-1 in low nanomolar to submicromolar range (Table 2). Particularly potent are 11a–d, 11f and 11h, which exhibited antiviral potencies (EC₅₀ = 5.2–14 nM) comparable to or better than that observed with 14 (EC₅₀ = 11 nM). Since 14 was among the most potent NNRTIs of the HEPT family, the exceptional antiviral potency may render 11 a suitable chemotype for antiviral development.

Table 2.

Biochemical and antiviral assay results of 3-deoxy precursor 11

Compd	Structure	RT IC50 a (μM)		MAGI Antiviral
		RNH	Pol	EC50b (μM)	CC50c (μM)
11a		>10	0.085 ± 0.034	0.0052 ± 0.0024	23 ± 0.74
11b		>10	0.30 ± 0.034	0.0072 ± 0.0029	31 ± 1.4
11c		>10	0.22 ± 0.12	0.0062 ± 0.00020	>50
11d		>10	0.48 ± 0.089	0.0075 ± 0.0010	42 ± 2.7
11e		>10	1.5 ± 0.50	0.048 ± 0.029	32 ± 0.67
11f		>10	0.82 ± 0.014	0.014 ± 0.0058	29 ± 0.78
11g		>10	0.81 ± 0.59	0.039 ± 0.012	28 ± 0.81
11h		>10	0.36 ± 0.17	0.011 ± 0.0035	30 ± 1.30
11i		>10	6.8 ± 2.0	0.065 ± 0.017	>100
11j		>10	10	0.83 ± 0.020	38 ± 3.2
11k		>10	10	0.21 ± 0.062	65 ± 3.5
11l		>10	10	0.80 ± 0.11	>100
11m		>10	>10	5.3 ± 0.43	56 ± 0.83
14	--	>10	0.42 ± 0.24	0.011 ± 0.00010	58 ± 2.4

^aConcentration of compound inhibiting the target enzyme by 50%.

^bConcentration of compound inhibiting virus replication by 50%.

^cConcentration of compound resulting in 50% cell death. All assay results expressed as mean ± standard deviation from at least two independent experiments.

Biochemically, analogues of 11 did not inhibit RNase H at concentrations up to 10 μM, presumably due to the lack of chelating triad required for RNase H active site inhibitors [25]. This is in stark contrast to subtype 4 with which the 3-OH group forms a chelating triad with the two flanking carbonyls, resulting in the observed consistent inhibition of RNase H. However, the precursor scaffold 11 conferred substantially stronger inhibition against RT pol than chemotype 4. As shown in Table 2, all analogues with an isopropyl or ethyl group at the C5 position (11a–11h) showed nanomolar inhibition against RT pol, with the exception of compound 11e which inhibited RT pol with an IC₅₀ of 1.5 μM. By contrast, analogues with a methyl substituent (11i–11m) did not inhibit RT pol. This structure-activity-relationship (SAR) trend is similar to that observed with chemotype 4 and consistent with the binding mode of HEPT NNRTIs which typically require a bulkier isopropyl or ethyl group at C5 position ¹.[20] Furthermore, the crystal structure of HIV RT in complex with 4a provides a structural basis for the observed higher potency of 11a (5.2 nM) vs. 4a (26 nM). In the structure, the 3-hydroxy group of 4a is in close proximity to the protein backbone in the NNRTI binding pocket (main chain of K101, Figure 2), providing some steric hindrance for inhibitor binding. Compounds without the 3-hydroxy group, such as 11a, should be able to bind at the NNRTI binding pocket without this interference, similar to the previously reported crystal structures of HIV RT in complex with HEPT compounds 13[20] and 15[21]. It is also noteworthy that the correlation between pol inhibition and antiviral potency of 11 appeared to be as strong as it is with 14, suggesting that the antiviral potency of 11 is most likely due to the RT pol inhibition.

Figure 2.

Crystal structure of HIV-1 RT in complex with 4a (PDB ID: 5TUQ). Analogue 4a (cyan sticks) binds at the NNRTI binding pocket of RT (Fingers, blue; Palm, red; Thumb, green; Connection, yellow; RNase H, orange; p51, gray). Inset: cross-eyed stereo view of 4a at the NNRTI binding pocket with a 2.7 Å 2F_o-F_c electron density map at σ=1.0 in light blue.

3. Conclusion

By replacing the phenyl ring with a cyclohexyl group at the C-6 position of HPD subtype 1, we have generated an HPD subtype 4 which potently inhibited HIV-1. Biochemically, subtype 4 demonstrated dual inhibition against both the RNase H and the pol functions of RT without inhibiting INST. The antiviral SAR was found to better correlate with that of RT pol inhibition. Crystal structure of 4a bound RT and the lack of biochemical inhibition of 4a against Y181C and K103N RT mutants further corroborate an antiviral mechanism of action of 4 via RT pol inhibition. Interestingly, the synthetic precursor 11 inhibited HIV-1 and RT pol substantially better than subtype 4 without inhibiting INST or RNase H. The crystal structure of 4a bound to RT provided a structural basis for the observed increase in potency of chemotype 11 over 4. The best compounds of chemotypes 4 and 11 exhibited antiviral potencies comparable to that of 14, a well-known and highly potent NNRTI, and hence provide valuable additions to NNRTIs. Most importantly, the consistent biochemical inhibition against RNase H, the potent antiviral activity and the close correlation between antiviral potency and RNase H inhibition with analogues 4f and 4m render chemotype 4 a valuable platform for achieving potent antiviral phenotype through selective RNase H inhibition.

4. Experimental

4.1. General-Chemistry

All commercial chemicals were used as supplied unless otherwise indicated. Dry solvents were either purchased (CH₃CN and EtOH) or dispensed under argon from an anhydrous solvent system with two packed columns of neutral alumina or molecular sieves (CH₂Cl₂, THF), Flash chromatography was performed on a Teledyne Combiflash RF-200 with RediSep columns (silica) and indicated mobile phase. All moisture sensitive reactions were performed under an inert atmosphere of ultra-pure argon with oven-dried glassware. ¹H and ¹³C NMR spectra were recorded on a Varian 600 MHz spectrometer. Mass data were acquired on an Agilent TOF II TOS/MS spectrometer capable of ESI and APCI ion sources. Analysis of sample purity was performed on a Varian Prepstar SD-1 HPLC system with a Phenomenex Gemini, 5 micron C18 column (250mm × 4.6 mm). HPLC conditions: solvent A = H₂O, solvent B = MeCN; flow rate = 1.0 mL/min; compounds were eluted with a gradient of 20% MeCN/H₂O to 90% MeCN for 20 min. Purity was determined by total absorbance at 254 nm. All tested compounds have a purity ≥ 96%. In addition, all tested compounds were examined for potential pan assay interference and none was deemed prone to any of the potential mechanisms of interference: aggregation, redox activity, fluorescence, protein reactivity, singlet-oxygen quenching, member disruption, and decomposition in assay buffer to form reactive compound.

4.1.1. General Procedures for synthesis of 11a–11m

to a suspension of paraformaldehyde (17 mg, 0.57 mmol, 1.3 equiv) in TMSCl (1.0 mL) was added substituted benzyl alcohol (0.57 mmol, 1.3 equiv) at room temperature. The resulting suspension was stirred until a clear solution was achieved, removed solvent to give substituted aryl chloromethyl ether as oil, which can be used for next step directly. To the solution of 10a (110 mg, 0.44 mmol, 1.0 equiv) in anhydrous DCM (5mL), was added BSA ( 235 μM, 0.96 mmol, 2.2 equiv). The resulting reaction mixture was stirred at rt for 1 h. Then the fresh made substituted chloro-methyl-pheny ether and catalytic amount TBAI was added. This reaction was stirred at rt overnight, quenched by adding saturated NaHCO₃ solution and extracted with CH₂Cl₂ (3 × 10 mL). Combined the organic phase, dried over Na₂SO₄, removed the solvent to give the crude product which purified by combiflash (Hex/EtOAc, 3:1) to give compound as white solid.

4.1.1.1.1-((Benzyloxy)methyl)-6-(cyclohexylmethyl)-5-isopropylpyrimidine-2,4(1H,3H)-dione (11a)

Yield: 90%; ¹H NMR (600 MHz, CDCl₃) δ 8.77 (s, 1H), 7.30 (m, 5H), 5.36 (s, 2H), 4.57 (s, 2H), 2.72 (m, 1H), 2.52 (d, J = 7.2 Hz, 2H), 1.66 (m, 5H), 1.38 (m, 1H), 1.22 (d, J = 6.0 Hz, 6H), 1.12 (m, 5H); ¹³C NMR (150 MHz, CDCl₃) δ 162.3, 152.2, 150.0, 137.3, 128.4, 127.9, 127.8, 118.9, 72.2, 71.9, 40.8, 37.1, 35.2, 30.8, 28.5, 28.2, 22.4; HRMS (ESI+) calcd. for C₂₂H₃₁N₂O₃ [M+H]⁺ 371.2356, found 371.2354.

4.1.1.2. 6-(Cyclohexylmethyl)-1-(((4-fluorobenzyl)oxy)methyl)-5-isopropylpyrimidine-2,4(1H,3H)-dione (11b)

This compound was prepared as white solid following the procedure described for the preparation of 11a, Yield: 81%; ¹H NMR (600 MHz, CDCl₃) δ 8.84 (s, 1H), 7.22 (m, 2H), 6.96 (m, 2H), 5.40 (s, 2H), 4.53 (s, 2H), 2.72 (m, 1H), 2.52 (d, J = 6.0 Hz, 2H), 2.20 (m, 5H), 1.40 (m, 1H), 1.23 (d, J = 6.0 Hz, 6H), 1.12(m, 3H), 0.98 (m, 2H); HRMS (ESI+) calcd. for C₂₂H₃₀FN₂O₃ [M+H]⁺ 389.4723, found 389.4725.

4.1.1.3. 1-((Benzyloxy)methyl)-6-(cyclohexylmethyl)-5-ethylpyrimidine-2,4(1H,3H)-dione (11c)

This compound was prepared as a white solid following the procedure described for the preparation of 11a. Yield: 73%; ¹HNMR (600 MHz, CDCl₃) δ 7.34 (m, 5H), 5.43 (s, 2H), 4.64 (s, 2H), 2.58 (d, J = 6.0 Hz, 2H), 2.83 (t, J = 7.2 Hz, 2H), 2.43 (q, J = 7.2 Hz, 2H), 1.72 (m, 6H), 1.49 (m, 1H), 1.27 (m, 4H), 1.06 (t, J = 7.8 Hz, 3H); ¹³C NMR (150 MHz, CDCl₃) δ 163.4, 152.3, 150.4, 137.3, 128.4, 127.9, 127.8, 116.2, 72.9, 71.8, 38.5, 35.1, 33.2, 26.2, 26.0, 19.4, 13.6; HRMS (ESI+) calcd. for C₂₁H₂₉N₂O₃ [M+H]⁺ 357.2229, found 357.2228.

4.1.1.4. 6-(Cyclohexylmethyl)-5-ethyl-1-(((4-fluorobenzyl)oxy)methyl)pyrimidine-2,4(1H,3H)-dione (11d)

This compound was prepared as a white solid following the procedure described for the preparation of 11a. Yield: 63%; ¹H NMR (600 MHz, CDCl₃) δ 8.76 (s, 1H), 7.15 (t, J = 8.4 Hz, 2H), 6.88 (t, J = 8.4 Hz, 2H), 5.25 (s, 2H), 4.45 (s, 2H), 2.42 (d, J = 7.2 Hz, 2H), 2.27 (q, J = 6.6 Hz, 2H), 1.59 (m, 6 H), 1.38 (m, 1H), 1.03 (m, 4H), 0.91 (t, J = 6.6 Hz, 3H); ¹³C NMR (150 MHz, CDCl₃) δ 163.1, 152.1, 150.4, 133.0, 129.6, 116.2, 115.4, 115.2, 72.8, 71.0, 38.6, 35.1, 33.2, 26.3, 26.0, 19.4, 13.6; HRMS (ESI+) calcd. for C₂₁H₂₈FN₂O₃ [M+H]⁺ 375.2110, found 375.2109.

4.1.1.5. 6-(Cyclohexylmethyl)-1-((4-fluorophenethoxy)methyl)-3-hydroxy-5-methylpyrimidine-2,4(1H,3H)-dione (11e)

This compound was prepared as a white solid following the procedure described for the preparation of 11a. Yield: 53%; ¹HNMR (600 MHz, CDCl₃) δ 8.60 (s, 1H), 7.29 (t, J = 6.6 Hz, 1H), 7.21 (m, 1H), 7.01 (t, J = 7.8 Hz, 1H), 5.37 (s, 2H), 4.63 (s, 2H), 2.51 (d, J = 6.0 Hz, 2H), 2.36 (q, J = 7.2 Hz, 2H), 1.67 (m, 5H), 1.41 (m, 1H), 1.12 (m, 3H), 0.99 (m, 5H); ¹³C NMR (150 MHz, CDCl₃) δ 162.1, 154.5, 151.1, 149.4, 129.5, 127.5, 125.1, 123.5, 120.2, 115.3, 72.0, 64.5, 37.6, 34.1, 32.2, 25.3, 25.0, 18.5, 12.6; HRMS (ESI+) calcd. for C₂₁H₂₇FClN₂O₃ [M+H]⁺ 409.1727, found 409.1725.

4.1.1.6. 6-(Cyclohexylmethyl)-1-(((3,4-difluorobenzyl)oxy)methyl)-5-ethylpyrimidine-2,4(1H,3H)-dione (11f)

This compound was prepared as a white solid following the procedure described for the preparation of 11a. Yield: 70%; ¹H NMR (600 MHz, CDCl₃) δ 8.43 (s, 1H), δ 7.09 (m, 2H), 6.96 (m, 1H), 5.34 (s, 2H), 4.52 (s, 2H), 2.52 (d, J =7.2 Hz, 2H), 2.37 (q, J =7.2 Hz, 2H), 1.68 (m, 5H), 1.43 (m, 1H), 1.13 (m, 5H), 1.09 (t, J =7.2 Hz, 3H); ¹³C NMR (150 MHz, CDCl₃) δ 163.3, 152.4, 150.2, 134.5, 123.6, 117.2, 117.1, 116.7, 116.5, 116.4, 72.7, 70.4, 38.5, 35.1, 33.2, 26.3, 26.0, 19.4, 13.5; HRMS (ESI+) calcd. for C₂₁H₂₇F₂N₂O₃ [M+H]⁺ 393.2019, found 393.2022.

4.1.1.7. 6-(Cyclohexylmethyl)-5-ethyl-1-(((4-(trifluoromethyl)benzyl)oxy)methyl)-pyrimidine-2,4(1H,3H)-dione (11g)

This compound was prepared as a white solid following the procedure described for the preparation of 11a. Yield: 47%; ¹H NMR (600 MHz, CDCl₃ δ 8.22 (s, 1H), 7.53(d, J =8.4 Hz,, 2H), 7.37 (d, J =8.4 Hz, 2H), 5.36 (s, 2H), 4.63 (s, 2H), 2.52 (d, J =7.2 Hz 2H), 2.53 (q, J = 7.2 Hz, 2H), 1.67 (m, 5H), 1.44 (m, 1H), 1.12 (m, 5H), 0.98 (t, J =7.8 Hz, 3H); ¹³C NMR (150 MHz, CDCl₃) δ 162.3, 151.4, 149.2, 140.4, 126.8, 124.3, 115.4, 71.9, 70.0, 37.6, 34.1, 25.3, 25.0, 18.4, 12.6; HRMS (ESI+) calcd. for C₂₂H₂₈F₃N₂O₃ [M+H]⁺ 425.2117, found 425.2115.

4.1.1.8. 6-(Cyclohexylmethyl)-5-ethyl-1-(((4-methylbenzyl)oxy)methyl)pyrimidine-2,4(1H,3H)-dione (11h)

This compound was prepared as a white solid following the procedure described for the preparation of 11a. Yield: 65%; ¹HNMR (600 MHz, CDCl₃) δ 8.01 (s, 1H), 7.13 (d, J = 7.8 Hz, 2H), 7.07 (d, J = 7.8 Hz, 2H), 5.31 (s, 2H), 4.52 (s, 2H), 2.49 (d, J = 7.2 Hz, 2H), 2.32 (q, J = 6.6 Hz, 2H), 2.26 (s, 3H), 1.65 (m, 6H), 1.41 (m, 1H), 1.09 (m, 4H), 0.99 (t, J =7.2 Hz, 3H); ¹³C NMR (150 MHz, CDCl₃) δ 163.4, 152.3, 150.4, 137.7, 134.2, 129.1, 128.0, 116.2, 72.7, 71.6, 38.6, 35.0, 33.1, 26.3, 26.0, 21.1, 19.4, 13.6; HRMS (ESI+) calcd. for C₂₂H₃₁N₂O₃ [M+H]⁺ 371.2390, found 371.2387.

4.1.1.9. 1-((Benzyloxy)methyl)-6-(cyclohexylmethyl)-5-methylpyrimidine-2,4(1H,3H)-dione (11i)

This compound was prepared as a white solid following the procedure described for the preparation of 11a. Yield: 33%; ¹HNMR (600 MHz, CDCl₃) 8.58 (s, 1H), 7.27 (m, 5H), 5.34 (s, 2H), 4.56 (s, 2H), 2.53 (d, J = 7.2 Hz, 2H), 1.85 (s, 3H), 1.65 (m, 7H), 1.43 (m, 1H), 1.11 (m, 3H), 0.98 (m, 3H); ¹³C NMR (150 MHz, CDCl₃) δ 160.8, 149.2, 148.4, 134.6, 125.8, 125.4, 125.2, 107.6, 70.1, 69.0, 35.9, 33.1, 30.7, 23.6, 23.4, 9.2; HRMS (ESI+) calcd. for C₂₀H₂₇N₂O₃ [M+H]⁺ 343.2059, found 343.2066.

4.1.1.10. 1-(((3-Chloro-2-fluorobenzyl)oxy)methyl)-6-(cyclohexylmethyl)-5-methylpyrimidine-2,4(1H,3H)-dione (11j)

This compound was prepared as a white solid following the procedure described for the preparation of 11a.¹Yield: 62%; HNMR (600 MHz, CDCl₃) δ 8.10 (s, 1H), 7.29 (m, 1H), 7.21 (m, 1H), 7.01 (t, J = 7.2 Hz, 1H), 5.37 (s, 2H), 4.62 (s, 2H), 2.53 (d, J = 7.2 Hz, 2H), 1.87 (s, 3H), 1.67 (m, 5H), 1.44 (m, 1H), 1.12 (m, 3H), 1.00 (m, 2H); ¹³C NMR (150 MHz, CDCl₃) δ 162.7, 151.2, 149.8, 129.4, 127.5, 125.0, 123.5, 120.0 109.4, 71.8, 64.4, 37.4, 34.6, 32.2, 25.2, 25.0, 10.8; HRMS (ESI+) calcd. for C₂₀H₂₅FClN₂O₃ [M+H]⁺ 395.1599, found 395.1589.

4.1.1.11. 6-(Cyclohexylmethyl)-1-(((3,4-difluorobenzyl)oxy)methyl)-5-methylpyrimidine-2,4(1H,3H)-dione (11k)

This compound was prepared as a white solid following the procedure described for the preparation of 11a. ¹Yield: 52%; HNMR (600 MHz, CDCl₃) δ8.82 (s, 1H), 7.08 (m, 2H), 6.97 (s, 1H), 5.35 (s, 2H), 4.41 (s, 2H), 2.54 (d, J = 7.2 Hz, 2H), 1.89 (s, 3H), 1.67 (m, 6H), 1.48 (m, 1H), 1.13 (m, 4H); HRMS (ESI+) calcd. for C₂₀H₂₅F₂N₂O₃ [M+H]⁺ 379.1888, found 379.1880.

4.1.1.12. 6-(Cyclohexylmethyl)-5-methyl-1-(((4-(trifluoromethyl)benzyl)oxy)methyl) pyrimidine-2,4(1H,3H)-dione (11l)

Yield: 43%; This compound was prepared as a white solid following the procedure described for the preparation of 11a; ¹HNMR (600 MHz, CDCl₃) δ 8.42 (s, 1H), 7.54 (d, J = 8.4 Hz, 2H), 7.37 (d, J = 7.2 Hz, 2H), 5.36 (s, 2H), 4.62 (s, 2H), 2.54 (d, J = 7.2 Hz, 2H), 1.87 (s, 3H), 1.67 (m, 5H), 1.42 (m, 1H), 1.13 (m, 5H); HRMS (ESI+) calcd. for for C₂₁H₂₆F₃N₂O₃ [M+H]⁺ 411.1955, found 411.1954.

4.1.1.3. 6-(Cyclohexylmethyl)-1-((4-fluorophenethoxy)methyl)-5-methylpyrimidine-2,4(1H,3H)-dione (11m)

Yield: 50%; This compound was prepared as a white solid following the procedure described for the preparation of 11a; ¹HNMR (600 MHz, CDCl₃) δ 8.20 (s, 1H), 7.18 (t, J = 7.2 Hz, 2H), 6.95 (J = 8.4 Hz, 2H), 5.24 (s, 2H), 3.70 (t, J = 6.0 Hz, 2H), 2.75 (t, J = 6.0 Hz, 2H), 2.40 (d, J = 6.6 Hz, 2H), 1.84 (s, 3H), 1.67 (m, 2H), 1.61 (m, 4H), 1.41 (m, 1H), 1.15 (m, 2H), 0.99 (m, 2H); HRMS (ESI+) calcd. for for C₂₁H₂₈FN₂O₃ [M+H]⁺ 375.2140, found 375.2141.

4.1.2. General Procedures for synthesis of 4a–4m

To a solution of 11a (60 mg, 0.162 mmol ) in 3 mL of THF was added NaH (60% dispension in merinal oil) (65 mg, 1.62 mmol) at 0 °C. This reaction mixture was allowed to warm to room temperature over 1h., and then cooled to 0 °C followed by the addition of m-CPBA (223 mg, 1.3 mmol). After stirring for 0.5 h, this reaction mixture was stirred at rt overnight. The reaction was quenched by adding 10 mL of H₂O, the aqueous phase was then extracted with ethyl acetate (10 mL × 3). The combined organic extracts were dried over Na₂SO₄ and concentrated under reduced pressure. The resultant residue was subjected to combiflash (Hex/EtOAc, 1:1) to give compound 4a (42 mg, 70 %).

4.1.2.1. 1-((Benzyloxy)methyl)-6-(cyclohexylmethyl)-3-hydroxy-5-isopropylpyrimidine-2,4(1H,3H)-dione (4a)

Yield: 70 %; ¹H NMR (600 MHz, CDCl₃) δ 7.22 (m, 5H), 5.41 (s, 2H), 4.57 (s, 2H), 2.72 (m, 1H), 2.53 (d, J = 6.0 Hz, 2H), 1.63 (m, 5H), 1.37 (m, 1H), 1.24 (d, J = 6.0 Hz, 6H), 1.39 (m, 3H), 0.94 (m, 2H); ¹³C NMR (150 MHz, CDCl₃) δ 162.2, 152.2. 150.0. 137.3, 128.4, 127.9, 127.8, 118.9, 72.9, 71.7, 38.6, 34.9, 33.0, 28.6, 26.3, 26.0, 20.2; HRMS (ESI+) calcd. for C₂₂H₃₁N₂O₄ [M+H]⁺ 387.2269, found 387.2272.

4.1.2.2. 6-(Cyclohexylmethyl)-1-(((4-fluorobenzyl)oxy)methyl)-3-hydroxy-5-isopropylpyrimidine-2,4(1H,3H)-dione (4b)

This compound was prepared following the procedure described for the preparation of 4a. Yield: 70%; ¹H NMR (600 MHz, CDCl₃) δ 7.31 (t, J = 6.6 Hz, 2H), 7.03 (t, J = 8.4 Hz, 2H), 5.50 (s, 2H), 4.62 (s, 2H), 2.88 (m, 1H), 2.63 (d, J = 7.2 Hz, 2H), 1.75 (m, 2H), 1.68 (m, 3H), 1.46 (m, 1H), 1.31 (d, J = 6.6 Hz, 6H), 1.20 (m, 3H), 1.06 (m, 2H); HRMS (ESI+) calcd. for C₂₂H₃₀FN₂O₄ [M+H]⁺ 405.2227, found 405.2237.

4.1.2.3. 1-((Benzyloxy)methyl)-6-(cyclohexylmethyl)-5-ethyl-3-hydroxypyrimidine-2,4(1H,3H)-dione (4c)

This compound was prepared following the procedure described for the preparation of 4a. Yield: 74%; ¹HNMR (600 MHz, CDCl₃) δ 7.22 (m, 5H), 5.39 (s, 2H), 4.57 (s, 2H), 2.51 (d, J = 6.6 Hz, 2H), 2.34 (q, J = 7.2 Hz, 2H), 1.64 (m, 6H), 1.42 (m, 1H), 1.09 (m, 3H), 0.98 (m, 4H); HRMS (ESI+) calcd. for C₂₁H₂₉N₂O₄ [M+H]⁺ 373.4580, found 373.4586.

4.1.2.4. 6-(Cyclohexylmethyl)-5-ethyl-1-(((4-fluorobenzyl)oxy)methyl)-3-hydroxypyrimidine-2,4(1H,3H)-dione (4d)

This compound was prepared following the procedure described for the preparation of 4a. Yield: 66%; ¹H NMR (600 MHz, CDCl₃) δ 8.84 (s, 1H), 7.22 (t, J = 6.6 Hz, 2H), 6.94 (m, 2H), 5.39 (s, 2H), 4.53 (s, 2H), 2.50 (d, J = 6.0 Hz, 2H), 2.36 (m, 2H), 1.65 (m, 5H), 1.40 (m, 1H), 1.12 (m, 5H), 0.98 (t, J = 7.2 Hz, 3H); HRMS (ESI+) calcd. for C₂₁H₂₈FN₂O₄ [M+H]⁺ 391.4485, found 391.4469.

4.1.2.5. 1-(((3-Chloro-2-fluorobenzyl)oxy)methyl)-6-(cyclohexylmethyl)-5-ethyl-3-hydroxypyrimidine-2,4(1H,3H)-dione (4e)

This compound was following the procedure described for the preparation of 4a. Yield: 68%; ¹HNMR (600 MHz, CDCl₃) δ 7.26 (m, 1H), 7.19 (m, 1H), 6.98 (m, 1H), 5.42 (s, 2H), 4.63 (s, 2H), 2.51 (d, J = 7.2 Hz, 2H), 2.36 (m, 2H), 1.64 (m, 5H), 1.41 (m, 1H), 1.11 (m, 3H), 0.99 (m, 5H); ¹³C NMR (150 MHz, CDCl₃) δ 162.0, 156.1, 151.0, 149.4, 129.5, 127.5, 125.1, 123.5, 120.1, 115.3, 72.0, 64.5, 37.6, 34.0, 32.2, 25.3, 25.0, 18.5, 12.6, HRMS (ESI+) calcd. for C₂₁H₂₇FClN₂O₄ [M+H]⁺ 425.1680, found 425.1681.

4.1.2.6. 6-(Cyclohexylmethyl)-1-(((3,4-difluorobenzyl)oxy)methyl)-5-ethyl-3-hydroxypyrimidine-2,4(1H,3H)-dione (4f)

This compound was prepared as a white solid following the procedure described for the preparation of 4a. ¹Yield: 63%; HNMR (600 MHz, CDCl₃) δ 7.03 (m, 2H), 6.96 (m,1H), 5.41 (s, 2H), 4.54 (s, 2H), 2.52 (m, 2H), 2.39 (m, 2H), 1.65 (m, 2H), 1.60 (m, 3H), 1.42 (m, 1H), 1.09 (m, 3H), 1.00 (m, 5H); HRMS (ESI+) calcd. for C₂₁H₂₇F₂N₂O₄ [M+H]⁺ 409.4389, found 409.4394.

4.1.2.7. 6-(Cyclohexylmethyl)-5-ethyl-3-hydroxy-1-(((4-(trifluoromethyl)benzyl)oxy) methyl)pyrimidine-2,4(1H,3H)-dione (4g)

This compound was prepared following the procedure described for the preparation of 4a. Yield: 60%; ¹H NMR (600 MHz, CDCl₃) δ 7.52 (d, J =7.8 Hz,, 2H), 7.37 (d, J =8.4 Hz, 2H), 5.45 (s, 2H), 4.66 (s, 2H), 2.54 (d, J =7.2 Hz 2H), 2.41 (q, J = 7.8 Hz, 2H), 1.66 (m, 5H), 1.41 (m, 1H), 1.09 (m, 5H), 0.98 (t, J =7.8 Hz, 3H); HRMS (ESI-) calcd. for C₂₂H₂₆F₃N₂O₄ [M-H]⁻ 439.1744, found 439.1745.

4.1.2.8. 6-(Cyclohexylmethyl)-5-ethyl-3-hydroxy-1-(((4-methylbenzyl)oxy)methyl) pyrimidine-2,4(1H,3H)-dione (4h)

This compound was prepared following the procedure described for the preparation of 4a. Yield: 71%; 1HNMR (600 MHz, CDCl₃) δ 7.11 (d, J = 7.2 Hz, 2H), 7.03 (d, J = 7.2 Hz, 2H), 5.36 (s, 2H), 4.52 (s, 2H), 2.45 (d, J = 7.2 Hz, 2H), 2.28 (q, J = 6.6 Hz, 2H), 2.23 (s, 3H), 1.65 (m, 6H), 1.35 (m, 1H), 1.06 (m, 3H), 0.91 (m, 4H); ¹³C NMR (150 MHz, CDCl₃) δ 160.2, 148.3, 137.5, 134.3, 133.6, 129.0, 128.0, 114.5, 73.7, 71.6, 38.4, 35.0, 33.1, 26.2, 26.0, 21.1, 19.9, 13.2; HRMS (ESI+) calcd. for C₂₂H₃₁N₂O₄ [M+H]⁺ 387.4846, found 387.4852.

4.1.2.9. 1-((Benzyloxy)methyl)-6-(cyclohexylmethyl)-3-hydroxy-5-methylpyrimidine-2,4(1H,3H)-dione (4i)

This compound was prepared following the procedure described for the preparation of 4a. Yield: 77%; ¹HNMR (600 MHz, CDCl₃) 7.23 (m, 5H), 5.43 (s, 2H), 4.57 (s, 2H), 2.53 (d, J = 6.0 Hz, 2H), 1.90 (s, 3H), 1.64 (m, 5H), 1.41 (m, 1H), 1.10 (m, 3H), 0.96 (m, 2H); HRMS (ESI+) calcd. for C₂₀H₂₇N₂O₄ [M+H] ⁻ 358.2022, found 358.2025.

4.1.2.10. 1-(((3-Chloro-2-fluorobenzyl)oxy)methyl)-6-(cyclohexylmethyl)-3-hydroxy-5-methylpyrimidine-2,4(1H,3H)-dione (4j)

This compound was prepared following the procedure described for the preparation of 4a. Yield: 62%; ¹HNMR (600 MHz, CDCl₃) δ 7.29 (t, J = 7.2 Hz, 1H), 7.21 (m, 1H), 6.99 (t, J = 7.2 Hz, 1H), 5.44 (s, 2H), 4.64 (s, 2H), 2.54 (d, J = 6.6 Hz, 2H), 1.93 (s, 3H), 1.65 (m, 5H), 1.42 (m, 1H), 1.11 (m, 5H); ¹³C NMR (150 MHz, CDCl₃) δ 159.2, 157.2, 155.5, 148.7, 148.3, 130.6, 128.5, 125.9, 124.5, 108.3, 73.7, 65.9, 38.5, 35.5, 33.2, 26.2, 25.9, 12.1; HRMS (ESI+) calcd. for C₂₀H₂₅ClFN₂O₄ [M+H]⁺ 411.1542, found 411.1550.

4.1.2.11. 6-(Cyclohexylmethyl)-1-(((3,4-difluorobenzyl)oxy)methyl)-3-hydroxy-5-methyl pyrimidine-2,4(1H,3H)-dione (4k)

This compound was prepared following the procedure described for the preparation of 4a. Yield: 65%; ¹HNMR (600 MHz, CDCl₃) δ 7.10 (m, 2H), 6.97 (m, 2H), 5.41 (s, 2H), 4.53 (s, 2H), 2.54 (d, J = 6.0 Hz, 2H), 1.94 (s, 3H), 1.67 (m, 6H), 1.44 (m, 1H), 1.18 (m, 4H); HRMS (ESI+) calcd. for C₂₀H₂₅F₂N₂O₄ [M+H]⁺ 395.1832, found 395.1838.

4.1.2.12. 6-(Cyclohexylmethyl)-3-hydroxy-5-methyl-1-(((4-(trifluoromethyl)benzyl)oxy) methyl)pyrimidine-2,4(1H,3H)-dione (4l)

This compound was prepared following the procedure described for the preparation of 4a. Yield: 58%; ¹HNMR (600 MHz, CDCl₃) δ 8.64 (s, 1H), 7.52 (d, J = 7.2 Hz, 2H), 7.37 (d, J = 7.8 Hz, 2H), 5.45 (s, 2H), 4.64 (s, 2H), 2.56 (d, J = 6.6 Hz, 2H), 1.94 (s, 3H), 1.65 (m, 2H), 1.61 (m, 2H), 1.46 (m, 1H), 1.11 (m, 4H), 0.99 (m, 2H); HRMS (ESI+) calcd. for C₂₁H₂₆FN₂O₄ [M+H]⁺ 427.1733, found 427.1735.

4.1.2.13. 6-(Cyclohexylmethyl)-1-((4-fluorophenethoxy)methyl)-3-hydroxy-5-methyl pyrimidine-2,4(1H,3H)-dione (4m)

This compound was prepared following the procedure described for the preparation of 4a. Yield: 68%; ¹HNMR (600 MHz, CDCl₃) δ 7.03 (m, 2H), 6.87 (t, J = 7.2 Hz, 2H), 5.32 (s, 2H), 3.72 (t, J = 6.0 Hz, 2H), 2.73 (t, J = 6.0 Hz, 2H), 2.41 (d, J = 6.0 Hz, 2H), 1.91 (s, 3H), 1.65 (m, 5H), 1.40 (m, 1H), 1.06 (m, 3H), 0.96 (m, 2H); HRMS (ESI+) calcd. for C₂₁H₂₈FN₂O₄ [M+H]⁺ 391.2089, found 391.2093.

4.2. Biology

4.2.1. RNase H assay

RNase H activity was measured essentially as previously described [26]. Full-length HIV RT was incubated with the RNA/DNA duplex substrate HTS-1 (RNA 5′-gaucugagccugggagcu-3′-fluorescein annealed to DNA 3′-CTAGACTCGGACCCTCGA-5′-Dabcyl), a high sensitivity duplex that assesses non-specific internal cleavage of the RNA strand. Results were analyzed using GraphPad Prism (GraphPad Software, San Diego, CA) for nonlinear regression to fit dose-response data to logistic curve models.

4.2.2. RT pol assay

RT pol assays were carried out in 96-well plates by measuring the extension of an 18 nucleotide DNA primer (5′-GTCACTGTTCGAGCACA-3′) annealed to a 100 nucleotide DNA template (5′-ATGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCC TTTTAGTCAGTGTGGAATATCTCATAGCTTGGTGCTCGAACAGTGAC-3′). Reactions containing 20 nM RT, 40 nM template/primer, and 10 μM deoxynucleotide triphosphates (dNTPs) in a buffer containing 50 mM Tris (pH 7.8) and 50 mM NaCl were initiated by the addition of 6 mM MgCl₂. Reactions contained 1% DMSO and increasing concentrations of compounds. DNA synthesis was carried out for 30 min at 37 °C, and reactions were arrested by the addition of 100 mM EDTA. The QuantiFluor dsDNA System (Promega) was used to quantify the amount of formed double-stranded DNA. Reactions were read at ex/em 504/531 nm in a PerkinElmer EnSpire Multilabel plate reader. Results were analyzed using “Prism” software (GraphPad Software, San Diego, CA) for nonlinear regression to fit dose-response data to logistic curve models.

4.2.3. INST assay

HIV integrase was expressed and purified as previously reported [10]. Inhibition assays were performed using a modified protocol of our reported method ¹[10]. Briefly, 2.1 μL of compound suspended in DMSO was placed in duplicate into a Black 96 well non-binding plate (Corning). Compounds were plated in duplicate to a final concentration of 0.13 – 100 μM. To each well of the plate 186.9 μL of reaction mixture without DNA substrate was added (10 mM HEPES pH 7.5, 10% glycerol w/v, 10 mM MnCl₂, 1 mM DTT, 1 μM integrase). The enzyme was incubated with inhibitor for 10 min at 25 °C after which the reaction was initiated by the addition of 21 μL of 500 nM oligo (5′ biotin ATGTGGAAAATCTCTAGCA annealed with ACTGCTAGAGATTTTCCACAT 3′ Cy5). Reactions were incubated at 37 °C for 30 min and then quenched by the addition of 5.2 μL 500 mM EDTA. Each reaction was moved (200 μL) to a MultiScreen HTS PCR plate (Millipore) containing 20 μL streptavidin agarose beads (Life Technologies) and incubated with shaking for 30 min. A vacuum manifold was used to remove the reaction mixture and the beads were similarly washed 3 times with wash buffer (.05% SDS, 1 mM EDTA in PBS). The plates were further washed 3 times with 200 μL 50 mM NaOH to denature DNA not covalently linked to the biotin modification. For each denaturation step the plate was incubated with shaking at 25 °C for 5 min and the NaOH was removed by centrifugation at 1000 g for 1 min. The reaction products were eluted from the beads by the addition of 150 μL formamide. The plate was incubated at 25 °C for 10 min and read directly at 635/675 in a SpectraMax i3 plate reader (Molecular Devices).

Expression and purification of the recombinant IN in Escherichia coli were performed as previously reported[27, 28] with addition of 10% glycerol to all buffers. Preparation of oligonucleotide substrates has been described.[29] Integrase reactions were performed in 10 μL with 400 nM of recombinant IN, 20 nM of 5′-end [³²P]-labeled oligonucleotide substrate and inhibitors at various concentrations. Solutions of 10% DMSO without inhibitors were used as controls. Reactions were incubated at 37 °C (60 minutes) in buffer containing 50 mM MOPS pH 7.2, 7.5 mM MgCl₂, and 14.3 mM 2-mercaptoethanol. Reactions were stopped by addition of 10 μL of loading dye (10 mM EDTA, 98% deionized formamide, 0.025% xylene cyanol and 0.025% bromophenol blue). Reactions were then subjected to electrophoresis in 20% polyacrylamide–7 M urea gels. Gels were dried and reaction products were visualized and quantitated with a Typhoon 8600 (GE Healthcare). Densitometric analyses were performed using ImageQuant from Molecular Dynamics Inc. The concentrations at which enzyme activity was reduced by 50% (IC₅₀) were determined using “Prism” software (GraphPad Software) for nonlinear regression to fit dose-response data to logistic curve models.

4.2.4. Antiviral MAGI assays

MAGI assays were carried out using P4R5 indicator cells essentially as previously described [16]. P4R5 cells were cultured in 96-well microplates with 4×10³ cells per well and maintained in DMEM/10% FBS supplemented with puromycin (1 μg/ml). Cells were incubated with either 1% DMSO or varying concentrations of the drugs for 24h and then exposed to HIV (MOI of 1.25) followed by an additional incubation period of 48h. The extent of infection was assessed using a fluorescence-based β-galactosidase detection assay, as previously described with minor modifications [30]. After the 48h incubation period, cells were lysed and substrate 4-methylumbelliferyl-galactoside (MUG) was added. The β-galactosidase produced during infection acts on the substrate MUG and yields a fluorescent product 4-methylumbelliferone (4-MU) that could be detected fluorimetrically with excitation wavelength 365 nm and emission wavelength 446 nm.

4.2.5. HIV-1 cytoprotection assay[17]

The HIV cytoprotection assay used CEM-SS cells and the IIIB strain of HIV-1. Briefly, virus and cells were mixed in the presence of test compound and incubated for 6 days. The virus was pre-titered such that control wells exhibit 70 to 95% loss of cell viability due to virus replication. Therefore, antiviral effect or cytoprotection was observed when compounds prevent virus replication. Each assay plate contained cell control wells (cells only), virus control wells (cells plus virus), compound toxicity control wells (cells plus compound only), compound colorimetric control wells (compound only) as well as experimental wells (compound plus cells plus virus). Cytoprotection and compound cytotoxicity were assessed by MTS (CellTiter® 96 Reagent, Promega) and the EC₅₀ (concentration inhibiting virus replication by 50%), CC₅₀ (concentration resulting in 50% cell death) and a calculated TI (therapeutic index CC₅₀/EC₅₀) were provided. Each assay included AZT as a positive control.

4.2.6. HIV-1 RT/4a crystallization and data collection

HIV-1 RT containing C280S mutations in the p66 and p51 subunits was expressed and purified as previously described [31, 32]. Co-crystallization of HIV-1 RT with 4a was achieved by mixing a solution of RT at a final concentration of 11 mg/ml, 50 mM MgCl₂, 5 mM tris(2-carboxyethyl)phosphine (TCEP) HCl, 0.5% β-octylglucoside, and 1 mM 4a in a 1:1 ratio with a solution of 15% PEG 3500, 0.1 M sodium potassium phosphate, 5% ethylene glycol, and 0.1 M MES pH 6.1. Large, blocky crystals grew by hanging drop vapor diffusion at 18 °C in 2–3 days.

HIV-1 RT/4a co-crystals were additionally soaked with 1 mM 4a, 5 mM TCEP HCl, 0.5% β-octylglucoside, 8% ethylene glycol, and 50 mM MgCl₂ for 20 minutes before brief cryoprotection in a solution containing 23% ethylene glycol and 4% trimethylamine N-oxide, followed by fast cryo-cooling in liquid nitrogen. Data collected at Beamline 23-ID-B of the Advanced Photon Source at Argonne National Laboratory was processed and scaled to 2.7 Å resolution using XDS [33]. The HIV-1 RT/4a crystals were of space group C2, and had unit cell dimensions of a = 161.9 Å, b = 72.4 Å, c = 107.3 Å and β = 99.9°. One RT molecule was present in the asymmetric unit, and the Matthews coefficient was 2.7 ų/Da, corresponding to a solvent content of 54.8% [34]. Crystal data and statistics are listed in SI Table 1.

4.3. Phase determination and structure refinement

The structure was determined by molecular replacement using Phaser [35], using a high resolution crystal structure of an HIV-1 RT/NNRTI complex (Protein Data Bank code 4G1Q) as the initial search model[36]. Rigid-body, simulated annealing (to remove bias), atomic displacement parameter (ADP), real-space and restrained refinement were performed using Phenix [37]. Several cycles of model building and refinement were carried out using Coot [38] and Phenix or Refmac [39], respectively. The final RT/4a structure was validated using MolProbity [40]. Final refinement statistics are listed in SI Table 1.

Highlights.

• HPD subtype featuring a C-6 cyclohexylmethyl group potently inhibited HIV-1.

• Dual biochemical inhibition against RNase H and pol.

• Antiviral activity correlates better with RT pol inhibition for most analogues and with RNase H with two analogues 4f and 4m.

• Analogues lacking the 3-OH inhibited HIV-1 and RT pol, but not RNase H.

Abbreviations

HPD

3-Hydroxypyrimidine-2,4-dione

HIV

human immunodeficiency virus

RT

reverse transcriptase

INST

integrase strand transfer

Pol

polymerase

NNRTI

nonnucleoside RT inhibitor

HAART

highly active antiretroviral therapy

NRTI

nucleoside reverse transcriptase inhibitor

PIs

protease inhibitors

CDI

carbonyldiimidazole

mCPBA

meta-chloroperoxybenzoic acid

HEPT

1-[(2-Hydroxyethoxy)methyl]-6-(phenylthio)thymine

SAR

structure-activity-relationship

dNTP

deoxynucleotide triphosphate

MUG

4-methylumbelliferyl-galactoside

4-MU

4-methylumbelliferone

TCEP

tris(2-carboxyethyl)phosphine

ADP

atomic displacement parameter

Appendix A. Supplementary data

Synthesis and characterization data, including ¹H NMR and MS data, of intermediates 6–10. This material is available free of charge via the Internet at t http://dx.doi.org/10.1016/j.ejmech.2016.12.030

PDB ID

The atomic coordinates and structure factors have been deposited in the RCSB Protein Data Bank (PDB ID: 5TUQ). Authors will release the atomic coordinates and experimental data upon article publication.