Skip to main content
PMC home page
Journal of Virology logoLink to Journal of Virology
. 2005 Jan;79(2):966–977. doi: 10.1128/JVI.79.2.966-977.2005

Genome of Deerpox Virus

C L Afonso 1,*, G Delhon 1,2, E R Tulman 1, Z Lu 1, A Zsak 1, V M Becerra 3, L Zsak 1, G F Kutish 1, D L Rock 1
PMCID: PMC538591  PMID: 15613325

Abstract

Deerpox virus (DPV), an uncharacterized and unclassified member of the Poxviridae, has been isolated from North American free-ranging mule deer (Odocoileus hemionus) exhibiting mucocutaneous disease. Here we report the genomic sequence and comparative analysis of two pathogenic DPV isolates, W-848-83 (W83) and W-1170-84 (W84). The W83 and W84 genomes are 166 and 170 kbp, containing 169 and 170 putative genes, respectively. Nucleotide identity between DPVs is 95% over the central 157 kbp. W83 and W84 share similar gene orders and code for similar replicative, structural, virulence, and host range functions. DPV open reading frames (ORFs) with putative virulence and host range functions include those similar to cytokine receptors (R), including gamma interferon receptor (IFN-γR), interleukin 1 receptor (IL-1R), and type 8 CC-chemokine receptors; cytokine binding proteins (BP), including IL-18BP, IFN-α/βBP, and tumor necrosis factor binding protein (TNFBP); serpins; and homologues of vaccinia virus (VACV) E3L, K3L, and A52R proteins. DPVs also encode distinct forms of major histocompatibility complex class I, C-type lectin-like protein, and transforming growth factor β1 (TGF-β1), a protein not previously described in a mammalian chordopoxvirus. Notably, DPV encodes homologues of cellular endothelin 2 and IL-1R antagonist, novel poxviral genes also likely involved in the manipulation of host responses. W83 and W84 differ from each other by the presence or absence of five ORFs. Specifically, homologues of a CD30 TNFR family protein, swinepox virus SPV019, and VACV E11L core protein are absent in W83, and homologues of TGF-β1 and lumpy skin disease virus LSDV023 are absent in W84. Phylogenetic analysis indicates that DPVs are genetically distinct from viruses of other characterized poxviral genera and that they likely comprise a new genus within the subfamily Chordopoxvirinae.

Within the subfamily Chordopoxvirinae of the family Poxviridae, eight genera are currently recognized based primarily on morphological and biological characteristics (48). Viruses from seven genera infect mammalian species (Capripoxvirus, Leporipoxvirus, Molluscipoxvirus, Orthopoxvirus, Parapoxvirus, Suipoxvirus, and Yatapoxvirus), and one genus infects birds (Avipoxvirus). Comparative genome analysis has provided a genetic basis for poxviral genus classification (31, 43). Chordopoxvirus (ChPV) genomes range from 135 to 365 kb in size and contain 130 to 328 putative genes. Complete genomic sequences have been determined for representative and often multiple viruses from each ChPV genus, including the following viruses: sheeppox, goatpox, and lumpy skin disease viruses (Capripoxvirus) (61, 62); myxoma and rabbit (Shope) fibroma viruses (Leporipoxvirus) (14, 67); molluscum contagiosum virus (Molluscipoxvirus) (55); monkeypox, vaccinia, camelpox, variola, and ectromelia viruses (Orthopoxvirus) (4, 16, 28, 32, 42, 56); orf and bovine popular stomatitis viruses (Parapoxvirus) (17); swinepox virus (Suipoxvirus) (3); Yaba monkey tumor and Yaba-like disease viruses (Yatapoxvirus) (12, 41); and canarypox and fowlpox viruses (Avipoxvirus) (2, 60). Many poxviruses are presently unclassified, however, suggesting that greater phylogenetic breadth exists within the Chordopoxvirinae (48).

Genomic sequences, together with extensive genetic and reverse genetic studies of model poxviruses, have demonstrated that the chordopoxviral genome is organized into a large, central region containing genes involved in basic replicative mechanisms, including multistage viral transcription, viral genome replication, and virion assembly, and into terminal regions containing genes involved in virus-host interactions (45, 46, 63). Comparative genomic analysis has revealed that while gene content and gene order in the central regions are relatively well conserved among mammalian chordopoxviruses, terminal genomic regions are more variable, with distantly related viruses having greater differences in gene order and content (31, 55).

Natural and experimentally induced poxviral diseases have been reported for members of three subfamilies of cervids, including American deer (Odocoileinae), alces (Alcinae), and reindeer and caribou (Rangiferinae), and include diseases which resemble infections caused by parapoxvirus orf virus (8, 24, 40, 50, 68, 71). Deerpox viruses (DPVs) are poorly characterized viruses responsible for non-orf-like infections and are presently unclassified members of the Chordopoxvirinae. Reports of DPV-like infections in deer include a reindeer herd in the Metropolitan Toronto Zoo (8) and two mule deer (Odocoileus hemionus) a year apart in Bighorn Basin, Wyoming (68). The actual prevalence of infection and significance of DPV as a pathogen remain unknown. Clinical presentation of DPV infection includes keratoconjunctivitis and proliferative-ulcerative skin lesions on the face and feet. In the Wyoming cases, the disease was thought to be a significant factor in the death of the animals (68). Virions resembling vaccinia virus (VACV) were observed by electron microscopy upon examination of skin sections of DPV-infected animals (8, 68). Here we present genome analysis of two DPVs isolated in Wyoming. The data suggest that DPV represents a new genus within the Chordopoxvirinae (48).

MATERIALS AND METHODS

Virus strains, DNA isolation, cloning, sequencing, and sequence analysis.

DPVs W-848-83 (W83) and W-1170-84 (W84) were isolated in Basin, Wyoming, in 1983 and in Burlington, Wyoming, in 1984, respectively, from skin lesions of free-ranging mule deer. Viral genomic DNA was isolated from uncloned stocks as previously described (65) after three passages of W83 in fetal lamb kidney cells and W84 in Vero cells. Random DNA fragments were obtained by incomplete enzymatic digestion with Tsp509I endonuclease (New England Biolabs, Beverly, Mass.), and DNA fragments larger than 1.0 kbp were cloned and used in dideoxy sequencing reactions as previously described (2). Reaction products were analyzed on an ABI PRISM 3700 automated DNA sequencer (Applied Biosystems, Foster City, Calif.). Sequence data were assembled with the Phrap and CAP3 software programs (22, 36), and gaps were closed as described previously (1). Final DNA consensus sequences for W83 and W84 genomes represented on average 8.6- to 9.2-fold redundancy at each base position, with Consed estimated error rates of 0.3 and 0.9 per 10 kbp, respectively (22, 23, 30), and no significant genetic heterogeneity.

Genome DNA composition, structure, repeats, and restriction enzyme patterns were analyzed as previously described (1) by using the GCG version 10 software package (18). Pairwise genomic alignments were done by using WABA (Jim Kent; http://www.cse.ucsc.edu/∼kent/), and multiple genomic and protein alignments were done with DIALIGN (44) and/or CLUSTAL (58) alignment programs. Open reading frames (ORFs) longer than 30 codons were evaluated for coding potential as previously described (2). All ORFs with coding potential and ORFs greater than 60 codons were subjected to homology searches as previously described (1, 2). Based on these criteria, 172 ORFs were annotated as potential genes and numbered from left to right. Phylogenetic comparisons were performed on complete, concatenated datasets of 79 proteins encoded in conserved central core regions homologous to those located between VACV F17L and A24R. Alignment data were also manually edited with SEAVIEW to exclude ambiguously aligned gap and low-complexity regions prior to phylogenetic analysis (26). Phylogenetic analyses on unedited and edited protein alignments were done by using the PHYLO_WIN and TREE-PUZZLE version 5.2 software packages (26, 54).

Nucleotide sequence accession numbers.

The genome sequences of DPVs W83 and W84 have been deposited in GenBank under accession numbers AY689436 and AY689437, respectively.

RESULTS AND DISCUSSION

DPV genome organization.

Genomic sequences of DPV field isolates W83 and W84 were assembled into contiguous sequences of 166,259 and 170,560 bp, respectively, containing approximately 73% A+T. Terminal hairpin loops were not sequenced, but the assembled genome contained the putative telomeric resolution sequences at position 30 for W83 (ATTTATATACCTAAAAAAAAGATAAAAACA) and at position 122 for W84 (ATTTATATACCTTAAAAAAAAGATAAAACA), with the leftmost nucleotide of each assembled genome arbitrarily designated base 1. Like other poxviruses, DPV genomes contain a large, unique coding region (95% nucleotide identity between W83 and W84) bounded by two identical inverted terminal repeat (ITR) regions. Assembled ITRs of W83 and W84 are 5,012 and 7,061 bp, respectively, and contain significant differences in the lengths of tandem repeat regions (1.5 and 3.5 kbp, respectively). W83 contains 13 and 20 copies of a 39- and a 48-bp repeat, respectively, while W84 contains 109 and 2 copies of a 31- and a 48-bp repeat, respectively. All DPV repeats in this region share a 15-bp motif (GGGAAAGGGATAAAA).

W83 and W84 genomes contain 169 and 170 genes, respectively, coding for proteins of 53 to 1,953 amino acids and representing an approximate 96% coding density. The central DPV genomic region contains homologues of conserved poxviral genes involved in basic replicative mechanisms (including viral transcription, RNA modification, and DNA replication), virion structure, and assembly of intracellular mature and extracellular enveloped virions (Table 1) (45). DPV genomes also contain a complement of potential nucleotide metabolism genes similar to those of leporipox, capripox, swinepox, and yatapox viruses, including homologues of genes for thymidine kinase, dUTPase, and the small subunit of ribonucleotide reductase. A gene for the large subunit of ribonucleotide reductase is absent. DPV terminal genomic regions contain genes with functions likely affecting viral virulence, host range, and immune response modulation, many of which are members of gene families or have homologues in other poxviruses (Table 1).

TABLE 1.

Characterization of DPV ORFs

ORF number W83 position (length)a W84 position (length)a % Identityb Best matchc
Description, putative function, and/or namef
Accession no.d Species and descriptiond % Identity LSDVe
SWPVe
VACVe
ORF % Identityb ORF % Identityb ORF % Identityb
DPV001 2176-1715 (154) 4278-3817 95 P18387 SPPV T3A 54 LSDV001 53 SPV001 54 B15R 35
DPV002 2754-2263 (164) 4861-4364 (166) 86 LSDV002 43 SPV002 38
DPV003 4057-2975 (361) 6176-5085 (364) 88 YLDV 149R 29 LSDV149 27 SPV145 25 C12L 26 Serpin-like protein
DPV004 4788-4066 (241) 6910-6185 (242) 93 LSDV003 46 B9R 42 ER-localized apoptosis regulator
DPV005 7351-7043 (103) X94355 CPXV C5L 54 A53R 31 CD30-like protein
DPV006 5312-5106 (69) 7628-7422 67 P22389 Mus musculus endothelin 2 39 Endothelin precursor
DPV007 6429-5365 (355) 8745-7681 91 LSDV007 46 C10L 35
DPV008 7511-6492 (340) 9808-8798 (337) 79 SPV003 57 MHC-like TNF binding protein
DPV009 8278-7547 (244) 10575-9844 92 LSDV009 26 SPV007 52 C1L 26
DPV010 9191-8376 (272) 11488-10670 (273) 86 LSDV008 35 SPV008 36 B8R 35 Soluble IFN-γ receptor
DPV011 9972-9253 (240) 12269-11604 (222) 95 LSDV009 41 N2L 30
DPV012 10358-10017 (114) 12632-12351 (94) 97 SPV009 40
DPV013 11331-10294 (346) 13629-12592 94 YLDV 7L 50 LSDV011 39 SPV146 29 CC-chemokine receptor-like protein
DPV014 12013-11387 (209) 14313-13687 93 LSDV012 48 SPV142 28 C19L 23 Ankyrin repeat protein
DPV015 12743-12066 (226) 15045-14365 (227) 68 LSDV006 32 B16R 23 IL-1 receptor-like protein
DPV016 13391-12804 (196) 15722-15126 (199) 67 AF012825 ECTV EVM008 29 Viral TNFR II-like C-terminal fragment
DPV017 14095-13418 (226) 16432-15749 (228) 86 YLDV 9L 40 M2L 29
DPV018 15271-14126 (382) 17612-16464 (383) 94 YLDV 10L 44 LSDV149 29 SPV145 26 K2L 27 Serpin-like protein
DPV019 17220-15292 (643) 19558-17630 93 YLDV 11L 52 LSDV145 25 SPV141 24 B4R 24 Ankyrin repeat protein
DPV020 17490-17224 (89) 19828-19562 98 LSDV014 56 K3L 45 elF-2α-like PKR inhibitor
DPV021 17959-17537 (141) 20299-19880 (140) 77 YLDV 14L 46 LSDV015 40 SPV011 39 IL-18 binding protein
DPV022 18518-17982 (179) 20859-20323 98 YMTV 16L 38 LSDV017 34 SPV012 32 F1L 27 Antiapoptotic membrane protein
DPV023 19002-18571 (144) 21343-20912 97 LSDV018 68 SPV013 71 F2L 59 dUTPase
DPV024 19424-19038 (129) 21766-21380 92 YLDV 18L 40 SPV014 33
DPV025 21055-19469 (529) 23397-21811 95 LSDV019 40 SPV015 44 F3L 23 Kelch-like protein
DPV026 22092-21130 (321) 24434-23472 97 LSDV020 78 SPV016 76 F4L 76 Ribonucleotide reductase small subunit
DPV027 22407-22123 (95) 24763-24479 86 YMTV 21L 28 LSDV021 29 SPV017 31
DPV028 22734-22459 (92) 25090-24815 91 LSDV022 60 SPV018 28
DPV029 22939-22745 (65) LSDV023 63
DPV030 25381-25139 (81) SPV019 46
DPV031 23655-23011 (215) 26563-25919 95 LSDV024 57 SPV021 60 F9L 52
DPV032 24970-23639 (444) 27878-26547 99 LSDV025 81 SPV022 82 F10L 72 Serine/threonine protein kinase
DPV033 26136-24997 (380) 29047-27905 (381) 93 LSDV026 31 SPV023 43 F11L 32
DPV034 28123-26168 (652) 31034-29079 95 LSDV027 50 SPV024 57 F12L 38 EEV maturation protein
DPV035 29289-28165 (375) 32201-31077 97 LSDV028 75 SPV025 72 F13L 55 Palmitylated virion envelope protein
DPV036 29523-29314 (70) 32435-32226 99 AF012825 ECTV EVM037 32 SPV026 34 F14L 32
DPV037 30238-29795 (148) 33150-32707 97 YLDV 29L 66 LSDV029 64 SPV027 63 F15L 64
DPV038 30964-30305 (220) 33877-33218 94 LSDV030 43 SPV028 49 F16L 36
DPV039 31030-31353 (108) 33946-34266 (107) 97 YLDV 31R 72 LSDV031 70 SPV029 70 F17L 61 DNA-binding virion protein
DPV040 32765-31356 (470) 35678-34269 99 LSDV032 78 SPV030 76 E1L 67 Poly(A) polymerase large subunit
DPV041 34993-32798 (732) 37906-35711 98 LSDV033 53 SPV031 60 E2L 43
DPV042 35662-35066 (199) 38575-37979 91 LSDV034 48 SPV032 46 E3L 38 dsRNA binding PKR inhibitor
DPV043 36446-35715 (244) 39359-38628 99 LSDV036 65 SPV033 72 E4L 55 RNA polymerase subunit RP030
DPV044 36554-37795 (414) 39467-40702 (412) 93 LSDV035 40 E5R 29
DPV045 37833-39530 (566) 40740-42437 99 LSDV037 79 SPV034 72 E6R 62
DPV046 39559-40359 (267) 42466-43266 98 LSDV038 83 SPV035 79 E8R 69
DPV047 43395-40366 (1010) 46305-43273 (1011) 99 MYXV m34L 76 LSDV039 75 SPV036 78 E9L 67 DNA polymerase
DPV048 43433-43717 (95) 46343-46627 94 LSDV040 71 SPV037 81 E10R 68 IMV redox protein
DPV049 47025-46630 (132) LSDV041 52 E11L 46 Virion core protein
DPV050 45992-43956 (679) 49048-47015 (678) 97 YLDV 42L 49 LSDV042 46 SPV038 47 O1L 37
DPV051 47089-46151 (313) 50148-49210 98 LSDV043 76 SPV039 72 I1L 71 DNA-binding virion core protein
DPV052 47321-47079 (81) 50377-50135 93 LSDV044 53 SPV040 54 I2L 44
DPV053 48140-47325 (272) 51196-50381 99 LSDV045 63 SPV041 70 I3L 53 DNA-binding phosphoprotein
DPV054 48720-48226 (165) 51774-51283 (164) 89 AB005148 Bos taurus IL-1 receptor antagonist 53 IL-1 receptor antagonist
DPV055 48993-48760 (78) 52042-51809 99 YLDV 46L 78 LSDV046 64 SPV043 61 I5L 47 IMV membrane protein
DPV056 50183-49017 (389) 53226-52066 (387) 97 YMTV 47L 54 LSDV047 56 SPV044 54 I6L 51
DPV057 51474-50179(432) 54517-53222 99 LSDV048 80 SPV045 78 I7L 68 Virion core protein
DPV058 51480-53528 (683) 54523-56574 (684) 97 LSDV049 65 SPV046 66 I8R 57 RNA helicase
DPV059 55321-53531 (597) 58367-56577 99 LSDV050 66 SPV047 67 G1L 56 Metalloprotease
DPV060 55647-56309 (221) 58693-59355 97 LSDV051 56 SPV048 53 G2R 45 Transcriptional elongation factor
DPV061 55653-55321 (111) 58699-58367 98 AF170722 SFV gp046L 68 LSDV052 58 SPV049 59 G3L 45
DPV062 56656-56282 (125) 59702-59328 100 LSDV053 80 SPV050 65 G4L 52 Glutaredoxin
DPV063 56659-57960 (434) 59705-61006 99 LSDV054 64 SPV051 63 G5R 45
DPV064 57964-58152 (63) 61010-61198 98 YLDV 55R 85 LSDV055 86 SPV052 84 G5.5R 33 RNA polymerase subunit RPO7
DPV065 58155-58658 (168) 61201-61704 99 LSDV056 61 SPV053 63 G6R 45
DPV066 59806-58682 (375) 62858-61734 98 LSDV057 62 SPV054 62 G7L 52 Virion core protein
DPV067 59836-60615 (260) 62888-63667 99 LSDV058 93 SPV055 92 G8R 84 Late transcription factor VLTF-1
DPV068 60655-61659 (335) 63707-64711 98 YLDV 59R 64 LSDV059 63 SPV056 59 G9R 52 Myristylated protein
DPV069 61663-62409 (249) 64715-65461 100 LSDV060 87 SPV057 84 L1R 70 Myristylated IMV envelope protein
DPV070 62457-62741 (95) 65509-65793 100 LSDV061 53 SPV058 56 L2R 31
DPV071 63719-62727 (331) 66771-65779 99 LSDV062 72 SPV059 68 L3L 50
DPV072 63744-64499 (252) 66796-67551 100 LSDV063 81 SPV060 80 L4R 64 DNA-binding virion protein VP8
DPV073 64522-64911 (130) 67574-67963 99 LSDV064 63 SPV061 59 L5R 53 Membrane protein
DPV074 64871-65320 (150) 67923-68372 99 LSDV065 72 SPV062 64 J1R 59 Virion protein
DPV075 65320-65892 (191) 68372-68944 97 LSDV066 67 SPV063 69 J2R 67 Thymidine kinase
DPV076 65871-66551 (227) 69008-69604 (199) 96 LSDV067 58 SPV064 47 C7L 35 Host range protein
DPV077 66571-67611 (347) 69623-70663 99 LSDV068 82 SPV065 80 J3R 74 Poly(A) polymerase small subunit
DPV078 67529-68083 (185) 70581-71135 99 LSDV069 79 SPV066 81 J4R 69 RNA polymerase subunit RPO22
DPV079 68503-68093 (137) 71555-71145 100 LSDV070 73 SPV067 66 J5L 65
DPV080 68579-72436 (1286) 71631-75488 99 LSDV071 86 SPV068 86 J6R 82 RNA polymerase subunit RPO147
DPV081 72974-72459 (172) 76026-75511 99 AF124517 SPPV H1L 83 LSDV072 84 SPV069 80 H1L 66 Protein-tyrosine kinase, assembly
DPV082 72990-73559 (190) 76042-76611 98 LSDV073 74 SPV070 73 H2R 65
DPV083 74548-73571 (326) 77600-76623 100 LSDV074 61 SPV071 57 H3L 39 IMV envelope protein p35
DPV084 76948-74552 (799) 80000-77604 99 LSDV075 83 SPV072 82 H4L 71 RNA polymerase-associated RAP94
DPV085 77116-77691 (192) 80168-80743 99 MYXV m73R 55 LSDV076 46 SPV073 49 H5R 42 Late transcription factor VLTF-4
DPV086 77734-78675 (314) 80786-81727 99 LSDV077 73 SPV074 67 H6R 66 DNA topoisomerase
DPV087 78699-79136 (146) 81751-82188 99 LSDV078 62 SPV075 63 H7R 42
DPV088 79187-81715 (843) 82239-84767 99 LSDV079 73 SPV076 72 D1R 66 mRNA capping enzyme, large subunit
DPV089 82146-82889 (248) 85198-85941 98 LSDV081 45 SPV078 41 D3R 36 Virion protein
DPV090 82147-81680 (156) 85199-84732 99 LSDV080 45 SPV077 45 D2L 39 Virion protein
DPV091 82889-83542 (218) 85941-86594 100 MYXV m79R 78 LSDV082 77 SPV079 76 D4R 68 Uracil DNA glycosylase
DPV092 83577-85934 (786) 86629-88986 100 YLDV 83R 80 LSDV083 78 SPV080 80 D5R 69 NTPase, DNA replication
DPV093 85934-87838 (635) 88986-90890 100 LSDV084 89 SPV081 91 D6R 82 Early transcription factor VETFs
DPV094 87872-88363 (164) 90924-91415 99 LSDV085 83 SPV082 80 D7R 67 RNA polymerase subunit RPO18
DPV095 88411-89043 (211) 91463-92095 99 LSDV086 70 SPV083 65 D9R 59 mutT motif
DPV096 89046-89795 (250) 92098-92847 99 YLDV 87R 65 LSDV087 67 SPV084 64 D10R 48 mutT motif
DPV097 91724-89820 (635) 94775-92871 100 LSDV088 78 SPV085 76 D11L 73 NPH-I, transcription termination factor
DPV098 92623-91763 (287) 95674-94814 100 LSDV089 78 SPV086 82 D12L 77 mRNA capping enzyme, small subunit
DPV099 94305-92656 (550) 97356-95707 100 LSDV090 80 SPV087 81 D13L 74 Rifampin resistance protein
DPV100 94787-94335 (151) 97838-97386 100 MYXV m89L 71 LSDV091 68 SPV088 64 A1L 64 Late transcription factor VLTF-2
DPV101 95494-94823 (224) 98545-97874 100 AB015885 YMTV Yb-B9L 87 LSDV092 88 SPV089 88 A2L 86 Late transcription factor VLTF-3
DPV102 95721-95494 (76) 98772-98545 99 MYXV m91L 75 LSDV093 71 SPV090 68 A2.5L 33
DPV103 97700-95745 (652) 100751-98796 100 LSDV094 76 SPV091 81 A3L 66 Virion core protein P4b
DPV104 98213-97761 (151) 101264-100812 99 LSDV095 47 SPV092 43 A4L 28 Virion core protein, morphogenesis
DPV105 98253-98762 (170) 101304-101810 (169) 98 LSDV096 68 SPV093 63 A5R 64 RNA polymerase subunit RPO19
DPV106 99892-98771 (374) 102940-101819 100 LSDV097 77 SPV094 76 A6L 56
DPV107 102066-99922 (715) 105114-102970 99 LSDV098 81 SPV095 81 A7L 71 Early transcription factor VETF
DPV108 102126-103007 (294) 105174-106055 99 MYXV m97R 72 LSDV099 70 SPV096 70 A8R 63 Intermediate transcription factor VITF-3
DPV109 103263-103021 (81) 106311-106069 99 LSDV100 79 SPV097 82 A9L 71 IMV membrane protein
DPV110 106011-103267 (915) 109059-106315 99 LSDV101 71 SPV098 76 A10L 52 Virion core protein P4a
DPV111 106026-106976 (317) 109074-110024 99 YLDV 102R 78 LSDV102 77 SPV099 76 A11R 54
DPV112 107555-106986 (190) 110603-110034 97 LSDV103 61 SPV100 57 A12L 49 Virion core protein
DPV113 107840-107622 (73) 110887-110669 97 LSDV104 63 SPV101 53 A13L 36 IMV membrane protein
DPV114 108203-107928 (92) 111246-110971 100 YLDV 105L 86 LSDV105 78 SPV102 85 A14L 54 IMV membrane protein
DPV115 108381-108223 (53) 111424-111266 100 YLDV 106L 84 LSDV106 74 SPV103 77 A14.5L 55 Virulence factor
DPV116 108655-108374 (94) 111698-111417 100 AB015885 YMTV Yb-B23L 54 LSDV107 54 SPV104 52 A15L 49
DPV117 109781-108642 (380) 112827-111685 (381) 98 LSDV108 68 SPV105 66 A16L 51 Myristylated membrane protein
DPV118 110402-109812 (197) 113449-112859 98 YLDV 109L 75 LSDV109 66 SPV106 73 A17L 41 TMV membrane protein
DPV119 110417-111862 (482) 113464-114909 98 LSDV110 59 SPV107 64 A18R 54 DNA helicase, elongation
DPV120 112073-111849 (75) 115120-114896 100 YLDV 111L 76 LSDV111 73 SPV108 79 A19L 71
DPV121 112420-113703 (428) 115467-116750 99 LSDV112 55 SPV109 55 A20R 44 DNA polymerase processivity factor
DPV122 112421-112077 (115) 115468-115124 100 LSDV113 64 SPV110 68 A21L 59
DPV123 113687-114229 (181) 116734-117276 100 LSDV114 67 SPV111 72 A22R 72 Holliday junction resolvase
DPV124 114216-115394 (393) 117263-118441 99 LSDV115 65 SPV112 64 A23R 62 Intermediate transcription factor VITF-3
DPV125 115423-118887 (1155) 118470-121934 99 LSDV116 91 SPV113 89 A24R 83 RNA polymerase subunit RPO132
DPV126 119300-118890 (137) 122344-121937 (136) 95 LSDV117 47 SPV114 55 A27L 30 Fusion protein
DPV127 119723-119304 (140) 122767-122348 98 AF170722 SFV gp116L 70 LSDV118 69 SPV115 71 A28L 59 IMV protein
DPV128 120641-119742 (300) 123685-122786 100 LSDV119 69 SPV116 68 A29L 61 RNA polymerase subunit RPO35
DPV129 120837-120613 (75) 123881-123657 99 AB018404 YMTV Yb-D13L 72 LSDV120 72 SPV117 67 A30L 57 IMV, membrane
DPV130 121027-121476 (150) 124069-124527 (153) 95 AF438165 CMLV 150 47 A31R 53
DPV131 122253-121492 (254) 125304-124543 100 MYXV m120L 88 LSDV121 88 SPV118 82 A32L 59 DNA packaging, virus assembly
DPV132 122383-122958 (192) 125433-126008 96 YLDV 122R 48 LSDV122 37 SPV119 46 A33R 28 EEV glycoprotein
DPV133 122982-123485 (168) 126032-126535 100 LSDV123 56 SPV120 69 A34R 51 EEV protein
DPV134 123533-124075 (181) 126583-127125 99 LSDV124 43 SPV121 45 A35R 37
DPV135 124111-124971 (287) 127157-128014 (286) 98 LSDV125 45 SPV122 48
DPV136 125031-125675 (215) 128074-128730 (219) 93 LSDV126 33 SPV123 46 A36R 24 EEV glycoprotein
DPV137 125741-126562 (274) 128796-129617 99 LSDV127 46 SPV124 49 A37R 32
DPV138 127452-127883 (144) 130507-130938 97 YLDV 129R 50 Hypothetical protein
DPV139 127480-126584 (299) 130535-129639 98 MYXV m128L 46 LSDV128 40 SPV125 44 A38L 26 CD47-like protein
DPV140 127918-128220 (101) 130973-131317 (115) 85 LSDV129 30 SPV126 23
DPV141 128291-128536 (82) 131384-131629 99 LSDV130 53 SPV127 47
DPV142 129596-128550 (349) 132691-131645 98 SPV128 56 A44L 46 Beta-hydroxysteroid dehydrogenase
DPV143 129652-130143 (164) 132747-133238 99 LSDV131 64 SPV129 62 A45R 36 Superoxide dismutase-like protein
DPV144 131047-130400 (216) 134133-133486 97 AF320596 Mus musculus C lectin-related protein 52 A40R 27 C-type lectin-like protein
DPV145 131243-132928 (562) 134328-136013 99 LSDV133 64 SPV130 67 A50R 53 DNA ligase-like protein
DPV146 133038-138896 (1953) 136122-141971 (1950) 96 LSDV134 53 SPV131 52 Variola virus B22R-like protein
DPV147a 138920-139969 (350) 142021-142308 (96) 81 LSDV135 32 SPV132 36 B19R 32 IFN-α/β binding protein (fragment)
DPV147b 142418-143050 (211) 89 YLDV 136R 29 LSDV135 30 SPV132 31 B19R 34 IFN-α/β binding protein fragment
DPV148 140001-140564 (188) 143082-143645 96 45 LSDV136 40 SPV133 46 K7R 23
DPV149 140620-141645 (342) 143702-144727 99 47 LSDV137 47 SPV134 47 A51R 31
DPV150 142576-141671 (302) 145647-144748 (300) 95 AF030894 MYXV α2,3-sialyltransferase 44 α2,3-sialyltransferase
DPV151 143540-142584 (319) 146611-145655 99 AJ010865 Bos taurus MHC class I antigen 27 MHC class I-like protein
DPV152 143630-144205 (192) 146701-147276 98 MYXV m139R 53 SPV135 54 A52R 34 IL-1R/TLR signaling inhibitor
DPV153 144262-144822 (187) 147333-147893 96 LSDV138 42 A56R 26 Ig domain OX-2-like protein
DPV154 144859-145803 (315) 147930-148874 98 LSDV139 66 SPV137 63 B1R 49 Serine/threonine protein kinase
DPV155 145827-146561 (245) 148898-149632 99 LSDV140 51 SPV138 43 N1R-like RING finger host range protein
DPV156 146642-147526 (295) 149713-150597 98 LSDV141 41 SPV139 53 C3L 36 EEV host range protein
DPV157 147558-147971 (138) 150629-151042 96 LSDV142 39 N1L 42 Virulence factor
DPV158 148004-148933 (310) 151075-152004 95 LSDV143 53 SPV140 54 Tyrosine protein kinase-like protein
DPV159 148966-149436 (157) 152037-152507 99 LSDV150 50 A52R 22
DPV160 149486-151123 (546) 152557-154194 96 LSDV151 51 SPV136 30 A55R 30 Kelch-like protein
DPV161 151190-153112 (641) 154261-156183 95 LSDV145 46 SPV141 50 C9L 23 Ankyrin repeat protein
DPV162 153187-154434 (416) 156252-157457 (402) 68 LSDV011 36 SPV146 46 CC-chemokine receptor-like protein
DPV163 154548-155477 (310) AF191297 Cavia porcellus TGF-β 28 TGF-β1
DPV164 155544-157046 (501) 157707-159209 93 LSDV147 44 SPV142 46 B4R 21 Ankyrin repeat protein
DPV165 157088-158536 (483) 159251-160699 94 LSDV148 40 SPV143 39 C9L 24 Ankyrin repeat protein
DPV166 158557-160062 (502) 160752-162230 (493) 96 LSDV152 39 SPV144 36 B4R 26 Ankyrin repeat protein
DPV167 160101-161105 (335) 162261-163268 (336) 92 YLDV 149R 48 LSDV149 47 SPV145 42 C12L 35 Serpin-like protein
DPV168 161118-161408 (97) 163305-163586 (94) 91 LSDV153 45 SPV147 52
DPV169 161472-162194 (241) 163651-164376 (242) 93 LSDV154 46 B9R 42 ER-localized apoptosis regulator
DPV170 162203-163285 (361) 164385-165476 (364) 88 YLDV 149R 29 LSDV149 27 SPV145 25 C12L 26 Serpin-like protein
DPV171 163506-163997 (164) 165700-166197 (166) 86 LSDV155 43 SPV149 38
DPV172 164084-164545 (154) 166283-166744 95 P18387 SPPV T3A 54 LSDV156 53 SPV150 54 B15R 35
Open in a new tab
a

Lengths of ORFs are in codons. W84 ORF lengths are presented only if differing from that of W83.

b

Percent amino acid identity was obtained by FASTA analysis.

c

Best scoring matches in BLAST analysis.

d

Accession numbers, species, and descriptions indicated are those different from lumpy skin disease virus (LSDV) and swinepox virus (SWPV). Other abbreviations are as follows: CPXV, cowpox virus; ECTV, ectromelia virus; MYXV, myxoma virus; SFV, rabbit (Shope) fibroma virus; SPPV, sheeppox virus; YLDV, Yaba-like disease virus; YMTV, yaba monkey tumor virus. GenBank database accession numbers are as follows: MYXV, AF170726; SFV, AF170722; and YLDV, AJ293568.

e

Best-matching ORFs from LSDV (accession no. AF325528), SWPV (accession no. AF410153), and VACV strain Copenhagen (accession no. M35027 and AF516337) genomes. Highlighted ORFs indicate best overall match to W84 in similarity searches.

f

Function was deduced from the degree of similarity to known genes and Prosite signatures. Abbreviations are as follows: IMV, intracellular mature virion; EEV, extracellular enveloped virion; eIF-2α, α subunit of eukaryotic initiation factor 2; dsRNA, double-stranded RNA.

Putative DPV virulence and host range proteins include those similar to secreted cytokine receptors (R) or binding proteins (BP), including gamma interferon receptor (IFN-γR; DPV010), interleukin-1 receptor (IL-1R; DPV015), IFN-α/βΒP (DPV147), IL-18BP (DPV021), major histocompatibility complex class I (MHC-I)-like tumor necrosis factor binding protein (TNFBP; DPV008), and two TNFR-like proteins (DPV016 and DPV005). DPV016 resembles a carboxyl-terminal fragment of viral TNFR-II, proteins present in several poxviral genera, and DPV005 resembles cellular CD30, a homologue of which has been found in orthopoxviruses cowpox virus, ectromelia virus, monkeypox virus, and variola virus (Table 1). Potential membrane-bound DPV immunomodulators include ORFs similar to cellular type 8 CC-chemokine receptor (DPV013 and DPV162), CD47 (DPV139), and OX-2 (DPV153). DPV proteins that are likely to inhibit intracellular signaling involved in immunological responses and/or apoptosis include homologues of VACV E3L and K3L (DPV042 and DPV020, respectively), myxoma virus M004 and M011R (DPV004 or DPV169 and DPV022, respectively), and serpins (DPV003, DPV018, DPV167, and DPV170). Notably, serpins DPV003 and DPV170, located in the ITR, are the least similar to known poxviral serpins but do contain the Asp P1 residue similar to poxvirus serpins known to affect inflammation, apoptosis, and virulence through inhibition of caspases 1 and 8 and granzyme B (57). DPV152 and DPV157 share similarity with VACV A52R and VACV N1L, respectively, proteins which affect intracellular signaling through IL-1R/Toll-like receptors and/or TNF superfamily receptors to affect viral virulence (10, 19, 33, 38).

DPV encodes six proteins containing ankyrin repeat motifs, two kelch-like proteins, and a protein similar to rabbit fibroma virus N1R (DPV155), proteins with homologues affecting poxviral virulence, host range, immunopathology, and/or apoptosis (Table 1) (11, 27, 37, 51). Other ORFs potentially affecting DPV-host interaction include homologues of poxvirus β-hydroxysteroid dehydrogenase (DPV142), superoxide dismutase (DPV143), α2,3-sialyltransferase (DPV150), and Tyr protein kinase-like protein (DPV158). Although many of these terminally located genes have similarity to those found in other poxviruses, this unique complement likely underlies DPV mechanisms of virulence and host range.

Notable host range and immunomodulatory genes.

DPVs contain several genes which are either completely novel within the Poxviridae or represent unique forms of cellular-like genes present in other poxviruses. Notably, some of these genes represent insertions in regions otherwise syntenic with other poxviruses (Table 1). These genes, likely involved in viral pathogenesis, encode proteins similar to cellular endothelin, IL-1R antagonist (IL-1Ra), transforming growth factor β1 (TGF-β1), C-type lectin-like receptors, and MHC-I.

DPV006 resembles endothelins (ETs), three potent vasoactive 21-amino-acid peptides (ET 1 to ET 3) with important roles in vascular homeostasis, and the structurally related snake venom sarafotoxins (Fig. 1A) (Table 1). ETs are synthesized as large precursors from which 40- to 90-amino-acid amino-terminal and 110- to 120-amino-acid carboxyl-terminal domains are sequentially removed by endopeptidases and endothelin-converting enzymes to yield biologically active ET peptides (49).

FIG. 1.

FIG. 1.

Open in a new tab

Multiple amino acid alignment of DPV006 with endothelins and DPV054 with secreted IL-1Ra (isoform 1). Amino acid positions are indicated on the right; / indicates truncation of the amino acid sequence, * indicates residues critical for receptor binding, and ^ indicates cleavage sites. (A) Alignment of DPV006 to endothelin homologues. ET peptide is underlined. Accession numbers are the following: P22389, mouse; P23943, rat; P12064, dog; and P20800, human. (B) Alignment of DPV054 to IL-1Ra. Accession numbers are the following: AB038268, dolphin; L38849, pig; AB005148, cow; P18510, human; AY026462, dog; P26890, rabbit; and P25086, rat.

DPV006 encodes an ET precursor-like protein including an amino-terminal signal peptide and a highly conserved Arg/Lys-Arg-Cys tripeptide endopeptidase cleavage site (positions 47 to 49) (Fig. 1A). The lack of a carboxyl-terminal domain in DPV006 suggests that endothelin-converting enzyme-mediated cleavage is not required for activation (52). Although W83 and W84 ET-like peptides are only 52% identical, both peptides contain two predicted disulfide bonds and conserved residues which are important for ET 1 and 2 receptor binding and biological activity (Fig. 1A) (49). Upstream nucleotide sequences resembling early poxviral promoters suggest that DPV006 is expressed as an early gene.

ETs are produced primarily by endothelial cells, but also by epithelial cells and neurons, and exert their actions in a paracrine-autocrine fashion by interacting with G protein-coupled receptors expressed in vascular smooth muscle cells, endothelial cells, and, to a lesser extent, other cell types (29). Mammalian ETs have been implicated in a number of airway, pulmonary vascular, and cardiovascular disorders and in chronic and acute inflammatory diseases (5, 29, 34). ET 1 binding to smooth muscle cell receptors leads to vasoconstriction, cytokine production, cell growth, and inflammatory cell recruitment, while binding to endothelial receptors has been associated with nitric oxide release and prevention of apoptosis (5, 34). DPV ETs may have similar functions in the host, conceivably contributing to the marked proliferative and necrotizing character of DPV-induced lesions (68). Alternatively, DPV006 may function as an ET antagonist, interfering with normal host ET functions. DPV006 represents a second poxviral gene with similarity to host genes primarily associated with vascular physiology and, like parapoxvirus vascular endothelial growth factor, may have a significant role in virus virulence (53).

DPV054 is similar to cellular IL-1Ra, an IL-1-like molecule which acts as a competitive inhibitor of IL-1 and antagonizes IL-1R signaling (Table 1) (Fig. 1B). DPV054 in W83 and W84 are 89% identical and contain a predicted amino-terminal signal peptide, indicating that DPV054, similar to mammalian secreted IL-1Ra isoforms, is secreted. Although overall identity between DPV and mammalian IL-1Ra is 41 to 53%, a region between residues 27 and 48 of DPV054 is 76 to 90% identical to mammalian IL-1Ra and contains 3 of 5 residues involved in the binding of IL-1Ra to IL-1R. A fourth residue involved in binding is also conserved in DPV054 (Tyr159) (21).

The balance between IL-1 and IL-1Ra is known to influence the course of many inflammatory and viral diseases (6). For instance, elevated IL-1Ra levels relative to IL-1β levels in human immunodeficiency virus-infected patients may reflect direct stimulation of monocyte IL-1Ra production by human immunodeficiency virus (39). Correlation of increased IL-1Ra levels during rhinovirus infection with peak symptomatology and onset of clinical resolution has led to the suggestion that IL-1Ra may play a role in the resolution of this respiratory infection (70). Poxviruses inhibit proinflammatory IL-1β activity, often through multiple strategies, as evidenced in DPV, which encodes homologues of viral serpins, IL-1R, and an intracellular IL-1R/Toll-like receptor inhibitor, which affect IL-1 maturation or signaling (Table 1) (46). To our knowledge, DPV054 encodes the first viral protein with similarity to IL-1Ra, thus adding an additional poxviral strategy to block host IL-1β-mediated responses.

DPV163, present only in W83, is similar to TGF-β1 (Table 1). Although multiple copies of distantly related TGF-β homologues are present in avian poxviruses, this is the first observation of a TGF-β1-like gene in a mammalian chordopoxvirus (2). DPV163 encodes a 310-amino-acid protein that contains most of the TGF-β1 propeptide region and the TGF-β1 chain, including a TGF-β1 prosite motif and all 10 Cys residues necessary for disulfide bridge formation. As with avian poxviral TGF homologues, DPV163 is most similar to cellular TGF-β1 in the TGF-β1 chain region (50% amino acid identity between DPV163 residues 214 to 310).

DPV163 lacks features associated with the amino-terminal propeptide of eukaryotic TGF-β1, including 36 amino acids containing the predicted signal peptide, an Arg-Gly-Asp cell attachment site, and the Arg-His-Arg-Arg cleavage site (DPV163 amino acids 210 to 214) necessary for removal of the propeptide and subsequent activation of TGF-β1. Notably, DPV163 contains an Ile-Asn-Met-Pro motif (DPV163 amino acids 262 to 265) instead of the Trp-Ser-Leu-Asp motif important for the interaction of mammalian TGF-β1 with its receptor, for growth inhibition of epithelial cells, and for growth stimulation of fibroblasts (35). Divergence in the propeptide region, lack of the cleavage site needed for release of the mature peptide, and substitutions at significant sites suggest that processing or specificities of DPV163 may be distinct from cellular TGFs.

TGF-β1 suppresses multiple immune functions, including polyclonal antibody production, cytotoxic T lymphocytes, natural killer (NK) and lymphokine-activated killer cell activity, macrophage activation, and IL-1R expression (20). At the site of injury, TGF-β induces production of inflammatory cytokines IL-1, TNF, and IL-6 (20). TGF-β also affects cell growth, stimulating connective tissue cell growth and differentiation during neovascularization and wound healing while suppressing proliferation in most other cell types, including T and B lymphocytes, monocytes, and macrophages (7, 9, 15, 20, 47). DPV163 may affect similar host responses.

DPV144 encodes a protein with similarity to members of a glycoprotein gene superfamily which exhibit a C-type animal lectin domain (Table 1). DPV144 in W83 and W84 are 97% identical and are most similar to proteins encoded by the NK gene complex (NKC) and related cell receptors (40 to 60% amino acid identity). Similar to NKC proteins, DPV144 is a predicted type II integral membrane protein, containing four conserved Trp residues and two of the three Cys pairs believed to form intrachain disulfide bonds within the lectin-like domain (69). DPV144 also resembles viral lectin-like proteins encoded by rat cytomegalovirus (45% amino acid identity), fowlpox virus (FPV239; 36% amino acid identity), and VACV (A40R; 27% amino acid identity). These rat cytomegalovirus and VACV proteins are not essential for virus growth in vitro (64, 66), and disruption of A40R attenuates VACV strain WR following intradermal but not intranasal inoculation of mice (59, 64). Although poxviral C-type lectin-like proteins share sequence similarity to NK cell receptors, evidence for a role of these proteins in NK cell activation or modulation is lacking.

DPV151 is most similar (27% identity over 187 amino acids) to cellular HLA class I histocompatibility antigen α chain precursors, containing putative extracellular α1, α2, and α3 domains, connecting peptide, transmembrane domains, and four Cys residues necessary for disulfide bond formation (Table 1). DPV151 lacks amino-terminal signal peptide and carboxyl-terminal cytoplasmic domains homologous to cellular MHC-I, and the α 1 domain is not well conserved (data not shown). DPV151 is less similar to the MHC-I homologue from molluscum contagiosum virus (16% identity over 201 amino acids to MC080R) and to homologues of the MHC-I-like TNFBP of Tanapox virus and its homologues in DPV (DPV008), Yaba-like disease virus, and swinepox virus (21% identity over 254 amino acids to SPV003) (13). Notably, an MHC-I homologue encoded by murine cytomegalovirus (m144 gene) functions to protect against NK-mediated clearance of virus-infected cells (25). A similar function has not been demonstrated for poxviral MHC-I, but it is tempting to speculate that DPV151 could have a role in interfering with NK-mediated antiviral immunity.

Comparison of DPVs and other ChPV genera.

DPVs are most similar to viruses of the capripoxvirus, suipoxvirus, leporipoxvirus, and yatapoxvirus (CSLY) genera, grouping with these viruses by phylogenetic analysis (Fig. 2). In addition, DPV and CSLY share distinctive genomic features, such as the insertion of the VACV C7L homologue (DPV076) between homologues of VACV J2R and J3R, the absence of A-type inclusion protein genes (VACV A25L/A26L), and more extensive gene colinearity (Table 1 and Fig. 2). Phylogenetic analysis also suggests that DPVs, capripoxviruses, and swinepox virus are monophyletic (Fig. 2). However, data indicate that DPV is a group as distinct as other ChPV genera are from each other (Fig. 2). Maximum likelihood analysis of whole genome sequences reveals distance estimates between DPV and other CSLY genera (0.654 to 0.754) on the same order of magnitude as those between established CSLY genera (0.505 to 0.725). Other genomic features distinguish DPV from other CSLY viruses, including the presence of DPV-specific genes and a homologue of VACV A31R, a gene otherwise present only in orthopoxviruses and avipoxviruses. Taken together, these data indicate that DPV represents a new poxvirus genus.

FIG. 2.

FIG. 2.

Open in a new tab

Phylogenetic analysis of DPV proteins. Seventy-nine conserved ORFs between DPV039 and DPV125 were concatenated from W83 and W84 and aligned with similarly concatenated ORF sets from other ChPVs with DIALIGN. Unrooted trees were generated by neighbor-joining analysis with Poisson correction for multiple substitutions and 500 bootstrap replicates as implemented in PHYLO_WIN (A) and maximum likelihood analysis with JTT correction for multiple substitutions and 1,000 quartet puzzling steps as implemented in TREE-PUZZLE (B). Bootstrap (A) or support (B) values of 100% are marked with dots; values less than 100% are presented at appropriate nodes. Homologous protein sequences from the following viruses and accession numbers were compared: bovine popular stomatitis virus (BPSV), AY386265; canarypox virus (CNPV), AY318871; ectromelia virus (ECTV), AF012825; fowlpox virus (FWPV), AF198100; lumpy skin disease virus (LSDV), AF325528; molluscum contagiosum virus (MOCV), MCU60315; myxoma virus (MYXV), AF170726; orf virus (ORFV), AY386264; rabbit (Shope) fibroma virus (SFV), AF170722; sheeppox virus (SPPV), AY077833; swinepox virus (SWPV), AF410153; vaccinia virus (VACV), M35027; Yaba-like disease virus (YLDV), AJ293568; and Yaba monkey tumor virus (YMTV), AY386371. Similar results were obtained by using an alignment manually edited to include only unambiguously aligned sites (20,132 of 30,019 sites) and using alignments generated with CLUSTAL W (data not shown).

Despite the high degree of similarity between W83 and W84 genomes relative to other ChPV genera (Table 1 and Fig. 2), significant differences between these DPVs exist. While centrally located ORFs (DPV020 to DPV160) are the most conserved between DPVs (97% average amino acid identity), terminally located ORFs are less similar (88% average amino acid identity [Table 1]). Whole genome maximum likelihood distances between W83 and W84 (0.042) are less than distances between both sequenced viruses of the genus leporipoxvirus (0.166) but greater than distances between eight sequenced viruses of the genus capripoxvirus (0.023 to 0.034). Although W83 and W84 have similar gene orders and contents, in W84 two genes are absent (DPV030 and DPV163) and one gene is fragmented into two ORFs (DPV147a and DPV147b) by an in-frame stop, and in W83 three genes are absent (DPV005, DPV031, and DPV051). With the exception of DPV147, genomic indels of 165 to 860 bp are responsible for differences in gene content between W83 and W84. These include CD30-like, TGF-β-like, and IFN-α/βBP genes, which conceivably could impart virus-specific host range and virulence functions to each DPV. These genomic differences suggest that W83 and W84 are distinct viruses within the genus.

Conclusions.

Genome sequences of W83 and W84 provide the first view of DPV genomics. A unique complement of DPV virulence and host range genes predicts novel mechanisms underlying virus-cervid host interactions in infection and immunity. Genomic analysis indicates that DPV represents a new genus within the Chordopoxvirinae.

Acknowledgments

We thank A. Lakowitz and C. Balinsky for providing excellent technical assistance.

REFERENCES

  • 1.Afonso, C. L., E. R. Tulman, Z. Lu, E. Oma, G. F. Kutish, and D. L. Rock. 1999. The genome of Melanoplus sanguinipes entomopoxvirus. J. Virol. 73:533-552. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Afonso, C. L., E. R. Tulman, Z. Lu, L. Zsak, G. F. Kutish, and D. L. Rock. 2000. The genome of fowlpox virus. J. Virol. 74:3815-3831. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Afonso, C. L., E. R. Tulman, Z. Lu, L. Zsak, F. A. Osorio, C. Balinsky, G. F. Kutish, and D. L. Rock. 2002. The genome of swinepox virus. J. Virol. 76:783-790. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Afonso, C. L., E. R. Tulman, Z. Lu, L. Zsak, N. T. Sandybaev, U. Z. Kerembekova, V. L. Zaitsev, G. F. Kutish, and D. L. Rock. 2002. The genome of camelpox virus. Virology 295:1-9. [DOI] [PubMed] [Google Scholar]
  • 5.Alonso, D. M. W., and M. W. Radomski. 2003. The nitric oxide-endothelin-1 connection. Heart Fail. Rev. 8:107-115. [DOI] [PubMed] [Google Scholar]
  • 6.Arend, W. P. 2002. The balance between IL-1 and IL-1Ra in disease. Cytokine Growth Factor Rev. 13:323-340. [DOI] [PubMed] [Google Scholar]
  • 7.Ashcroft, G. S. 1999. Bidirectional regulation of macrophage function by TGF-β. Microbes Infect. 1:1275-1282. [DOI] [PubMed] [Google Scholar]
  • 8.Barker, I. K., K. G. Mehren, W. A. Rapley, and A. N. Cagnon. 1980. Keratoconjunctivitis and oral cutaneous lesions associated with poxvirus infection in reindeer, p. 171-177. In R. J. Montali and G. Migaki (ed.), The comparative pathology of zoo animals: proceedings of a symposium held at the National Zoological Park, Smithsonian Institution. Smithsonian Institution Press, Washington, D.C.
  • 9.Blobe, G. C., W. P. Schiemann, and H. F. Lodish. 2000. Role of transforming growth factor beta in human disease. N. Engl. J. Med. 342:1350-1358. [DOI] [PubMed] [Google Scholar]
  • 10.Bowie, A., E. Kiss-Toth, J. A. Symons, G. L. Smith, S. K. Dower, and L. A. O'Neill. 2000. A46R and A52R from vaccinia virus are antagonists of host IL-1 and toll-like receptor signaling. Proc. Natl. Acad. Sci. USA 97:10162-10167. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Brick, D. J., R. D. Burke, L. Schiff, and C. Upton. 1998. Shope fibroma virus RING finger protein N1R binds DNA and inhibits apoptosis. Virology 249:42-51. [DOI] [PubMed] [Google Scholar]
  • 12.Brunetti, C. R., H. Amano, Y. Ueda, J. Qin, T. Miyamura, T. Suzuki, X. Li, J. W. Barrett, and G. McFadden. 2003. Complete genomic sequence and comparative analysis of the tumorigenic poxvirus Yaba monkey tumor virus. J. Virol. 77:13335-13347. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Brunetti, C. R., M. Paulose-Murphy, R. Sing, J. Qin, J. W. Barrett, A. Tardivel, P. Schneider, K. Essani, and G. McFadden. 2003. A secreted high-affinity inhibitor of human TNF from Tanapox virus. Proc. Natl. Acad. Sci. USA 100:4831-4836. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Cameron, C., S. Hota-Mitchell, L. Chen, J. Barrett, J. X. Cao, C. Macaulay, D. Willer, D. Evans, and G. McFadden. 1999. The complete DNA sequence of myxoma virus. Virology 264:298-318. [DOI] [PubMed] [Google Scholar]
  • 15.Cerwenka, A., and S. L. Swain. 1999. TGF-β1: immunosuppressant and viability factor for T lymphocytes. Microbes Infect. 1:1291-1296. [DOI] [PubMed] [Google Scholar]
  • 16.Chen, N., M. I. Danila, Z. Feng, R. M. Buller, C. Wang, X. Han, E. J. Lefkowitz, and C. Upton. 2003. The genomic sequence of ectromelia virus, the causative agent of mousepox. Virology 317:165-186. [DOI] [PubMed] [Google Scholar]
  • 17.Delhon, G., E. R. Tulman, C. L. Afonso, Z. Lu, A. de la Concha-Bermejillo, H. D. Lehmkuhl, M. E. Piccone, G. F. Kutish, and D. L. Rock. 2004. Genomes of the parapoxviruses ORF virus and bovine papular stomatitis virus. J. Virol. 78:168-177. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Devereux, J., P. Haeberli, and O. Smithies. 1984. A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 12:387-395. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.DiPerna, G., J. Stack, A. G. Bowie, A. Boyd, G. Kotwal, Z. Zhang, S. Arvikar, E. Latz, K. A. Fitzgerald, and W. L. Marshall. 2004. Poxvirus protein N1L targets the I-kappaB kinase complex, inhibits signaling to NF-kappaB by the tumor necrosis factor superfamily of receptors, and inhibits NF-kappaB and IRF3 signaling by toll-like receptors. J. Biol. Chem. 279:36570-36578. [DOI] [PubMed] [Google Scholar]
  • 20.Durum, S. K., and J. J. Oppenheim. 1993. Proinflammatory cytokines and immunity, p. 801-835. In W. E. Paul (ed.), Fundamental immunology, 3rd ed. Raven Press, Ltd., New York, N.Y.
  • 21.Evans, R. J., J. Bray, J. D. Childs, G. P. A. Vigers, B. J. Brandhuber, J. J. Skalicky, R. C. Thompson, and S. P. Eisenberg. 1995. Mapping receptor binding sites in interleukin (IL)-1 receptor antagonist and IL-1B by site-directed mutagenesis. J. Biol. Chem. 270:11477-11483. [DOI] [PubMed] [Google Scholar]
  • 22.Ewing, B., and P. Green. 1998. Base-calling of automated sequencer traces using Phred. II. Error probabilities. Genome Res. 8:186-194. [PubMed] [Google Scholar]
  • 23.Ewing, B., L. Hillier, M. C. Wendl, and P. Green. 1998. Base-calling of automated sequencer traces using Phred. I. Accuracy assessment. Genome Res. 8:175-185. [DOI] [PubMed] [Google Scholar]
  • 24.Falk, E. S. 1978. Parapoxvirus infections of reindeer and musk ox associated with unusual human infections. Br. J. Dermatol. 99:647-654. [DOI] [PubMed] [Google Scholar]
  • 25.Farrell, H. E., N. J. Davis-Poynter, D. M. Andrews, and M. A. Degli-Esposti. 2002. Function of CMV-encoded MHC class I homologues. Curr. Top. Microbiol. Immunol. 269:131-151. [DOI] [PubMed] [Google Scholar]
  • 26.Galtier, N., M. Gouy, and C. Gautier. 1996. SEAVIEW and PHYLO WIN: two graphic tools for sequence alignment and molecular phylogeny. Comput. Appl. Biosci. 12:543-554. [DOI] [PubMed] [Google Scholar]
  • 27.Gillard, S., D. Spehner, R. Drillien, and A. Kirn. 1986. Localization and sequence of a vaccinia virus gene required for multiplication in human cells. Proc. Natl. Acad. Sci. USA 83:5573-5577. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Goebel, S. J., G. P. Johnson, M. E. Perkus, S. W. Davis, J. P. Winslow, and E. Paoletti. 1990. The complete DNA sequence of vaccinia virus. Virology 179:247-266. [DOI] [PubMed] [Google Scholar]
  • 29.Goraca, A. 2002. New views on the role of endothelin. Endocr. Regul. 36:161-167. [PubMed] [Google Scholar]
  • 30.Gordon, D., C. Abajian, and P. Green. 1998. Consed: a graphical tool for sequence finishing. Genome Res. 8:192-202. [DOI] [PubMed] [Google Scholar]
  • 31.Gubser, C., S. Hue, P. Kellam, and G. L. Smith. 2004. Poxvirus genomes: a phylogenetic analysis. J. Gen. Virol. 85:105-117. [DOI] [PubMed] [Google Scholar]
  • 32.Gubser, C., and G. L. Smith. 2002. The sequence of camelpox virus shows it is most closely related to variola virus, the cause of smallpox. J. Gen. Virol. 83:855-872. [DOI] [PubMed] [Google Scholar]
  • 33.Harte, M. T., I. R. Haga, G. Maloney, P. Gray, P. C. Reading, N. W. Bartlett, G. L. Smith, A. Bowie, and L. A. O'Neill. 2003. The poxvirus protein A52R targets Toll-like receptor signaling complexes to suppress host defense. J. Exp. Med. 197:343-351. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Hocher, B., A. Schwarz, K. A. Fagan, C. Thone-Reineke, K. El-Hag, H. Kusserow, S. Elitok, C. Bauer, H. H. Neumayer, D. M. Rodman, and F. Theuring. 2000. Pulmonary fibrosis and chronic lung inflammation in ET-1 transgenic mice. Am. J. Respir. Cell Mol. Biol. 23:19-26. [DOI] [PubMed] [Google Scholar]
  • 35.Huang, S. S., M. Zhou, F. E. Johnson, H. S. Shieh, and J. S. Huang. 1999. An active site of transforming growth factor-β(1) for growth inhibition and stimulation. J. Biol. Chem. 274:27754-27758. [DOI] [PubMed] [Google Scholar]
  • 36.Huang, X., and A. Madan. 1999. CAP3: a DNA sequence assembly program. Genome Res. 9:868-877. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Ink, B. S., C. S. Gilbert, and G. I. Evan. 1995. Delay of vaccinia virus-induced apoptosis in nonpermissive Chinese hamster ovary cells by the cowpox virus CHOhr and adenovirus E1B 19K genes. J. Virol. 69:661-668. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Kotwal, G. J., A. W. Hugin, and B. Moss. 1989. Mapping and insertional mutagenesis of a vaccinia virus gene encoding a 13,800-Da secreted protein. Virology 171:579-587. [DOI] [PubMed] [Google Scholar]
  • 39.Kreuzer, K. A., J. M. Dayer, J. K. Rockstroh, T. Sauerbruch, and U. Spengler. 1997. The IL-1 system in HIV infection: peripheral concentrations of IL-1β, IL-1 receptor antagonist and soluble IL-1 receptor type II. Clin. Exp. Immunol. 109:54-58. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Kummeneje, K. 1979. Contagious ecthyma (orf) in reindeer (Rangifer tarandus). Vet. Rec. 105:60-61. [DOI] [PubMed] [Google Scholar]
  • 41.Lee, H. J., K. Essani, G. L. Smith, F. Jeanmougin, and D. G. Higgins. 2001. The genome sequence of Yaba-like disease virus, a yatapoxvirus. Virology 281:170-192. [DOI] [PubMed] [Google Scholar]
  • 42.Massung, R. F., L.-I. Liu, J. Qi, J. C. Knight, T. E. Yuran, A. R. Kerlavage, J. M. Parsons, J. C. Venter, and J. J. Esposito. 1994. Analysis of the complete genome of smallpox variola major virus strain Bangladesh-1975. Virology 201:215-240. [DOI] [PubMed] [Google Scholar]
  • 43.McLysaght, A., P. F. Baldi, and B. S. Gaut. 2003. Extensive gene gain associated with adaptive evolution of poxviruses. Proc. Natl. Acad. Sci. USA 100:15655-15660. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Morgenstern, B., K. Frech, A. Dress, and T. Werner. 1998. DIALIGN: finding local similarities by multiple sequence alignment. Bioinformatics 14:290-294. [DOI] [PubMed] [Google Scholar]
  • 45.Moss, B. 2001. Poxviridae: the viruses and their replication, p. 2849-2883. In D. M. Knipe and P. M. Howley (ed.), Fields virology, 4th ed., vol. 2. Lippincott, Williams and Wilkins, Philadelphia, Pa.
  • 46.Moss, B., and J. L. Shisler. 2001. Immunology 101 at poxvirus U: immune evasion genes. Semin. Immunol. 13:59-66. [DOI] [PubMed] [Google Scholar]
  • 47.Moustakas, A., K. Pardali, A. Gaal, and C. H. Heldin. 2002. Mechanisms of TGF-β signaling in regulation of cell growth and differentiation. Immunol. Lett. 82:85-91. [DOI] [PubMed] [Google Scholar]
  • 48.Moyer, R. W., B. Arif, D. N. Black, D. B. Boyle, R. M. Buller, K. R. Dumbell, J. J. Esposito, G. McFadden, B. Moss, A. Mercer, S. Ropp, D. N. Tripathy, and C. Upton. 2000. Family Poxviridae, p. 137-147. In M. H. V. van Regenmortel, C. M. Fauquet, D. H. L. Bishop, E. B. Carstens, M. K. Estes, S. M. Lemon, J. Maniloff, M. A. Mayo, D. J. McGeoch, C. R. Pringle, and R. B. Wickner (ed.), Virus taxonomy. Academic Press, New York, N.Y.
  • 49.Nakajima, K., S. Kubo, S. Kumagaye, H. Nishio, M. Tsunemi, T. Inui, H. Kuroda, N. Chino, T. X. Watanabe, T. Kimura, and S. Sakakibara. 1989. Structure-activity relationship of endothelin: importance of charged groups. Biochem. Biophys. Res. Commun. 163:424-429. [DOI] [PubMed] [Google Scholar]
  • 50.Patton, J. F., R. W. Nordhausen, L. W. Woods, and N. J. MacLachlan. 1996. Isolation of a poxvirus from a black-tailed deer (Odocoileus hemionus columbianus). J. Wildl. Dis. 32:531-533. [DOI] [PubMed] [Google Scholar]
  • 51.Pires de Miranda, M., P. C. Reading, D. C. Tscharke, B. J. Murphy, and G. L. Smith. 2003. The vaccinia virus kelch-like protein C2L affects calcium-independent adhesion to the extracellular matrix and inflammation in a murine intradermal model. J. Gen. Virol. 84:2459-2471. [DOI] [PubMed] [Google Scholar]
  • 52.Rubanyi, G. M., and L. H. Parker-Botelho. 1991. Endothelins. FASEB J. 5:2713-2720. [DOI] [PubMed] [Google Scholar]
  • 53.Savory, L. J., S. A. Stacker, S. B. Fleming, B. E. Niven, and A. A. Mercer. 2000. Viral vascular endothelial growth factor plays a critical role in orf virus infection. J. Virol. 74:10699-10706. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Schmidt, H. A., K. Strimmer, M. Vingron, and A. von Haeseler. 2002. TREE-PUZZLE: maximum likelihood phylogenetic analysis using quartets and parallel computing. Bioinformatics 18:502-504. [DOI] [PubMed] [Google Scholar]
  • 55.Senkevich, T. G., E. V. Koonin, J. J. Bugert, G. Darai, and B. Moss. 1997. The genome of Molluscum contagiosum virus: analysis and comparison with other poxviruses. Virology 233:19-42. [DOI] [PubMed] [Google Scholar]
  • 56.Shchelkunov, S. N., A. V. Totmenin, P. F. Safronov, M. V. Mikheev, V. V. Gutorov, O. I. Ryazankina, N. A. Petrov, I. V. Babkin, E. A. Uvarova, L. S. Sandakhchiev, J. R. Sisler, J. J. Esposito, I. K. Damon, P. B. Jahrling, and B. Moss. 2002. Analysis of the monkeypox virus genome. Virology 297:172-194. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Shisler, J. L., and B. Moss. 2001. Immunology 102 at poxvirus U: avoiding apoptosis. Semin. Immunol. 13:67-72. [DOI] [PubMed] [Google Scholar]
  • 58.Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Tscharke, D. C., P. C. Reading, and G. L. Smith. 2002. Dermal infection with vaccinia virus reveals roles for virus proteins not seen using other inoculation routes. J. Gen. Virol. 83:1977-1986. [DOI] [PubMed] [Google Scholar]
  • 60.Tulman, E. R., C. L. Afonso, Z. Lu, L. Zsak, G. F. Kutish, and D. L. Rock. 2004. The genome of canarypox virus. J. Virol. 78:353-366. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.Tulman, E. R., C. L. Afonso, Z. Lu, L. Zsak, G. F. Kutish, and D. L. Rock. 2001. Genome of lumpy skin disease virus. J. Virol. 75:7122-7130. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Tulman, E. R., C. L. Afonso, Z. Lu, L. Zsak, J. H. Sur, N. T. Sandybaev, U. Z. Kerembekova, V. L. Zaitsev, G. F. Kutish, and D. L. Rock. 2002. The genomes of sheeppox and goatpox viruses. J. Virol. 76:6054-6061. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Turner, P. C., and R. W. Moyer. 2002. Poxvirus immune modulators: functional insights from animal models. Virus Res. 88:35-53. [DOI] [PubMed] [Google Scholar]
  • 64.Voigt, S., G. R. Sandford, L. Ding, and W. H. Burns. 2001. Identification and characterization of a spliced C-type lectin-like gene encoded by rat cytomegalovirus. J. Virol. 75:603-611. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Wesley, R. D., and A. E. Tuthill. 1984. Genome relatedness among African swine fever virus field isolates by restriction endonuclease analysis. Prev. Vet. Med. 2:53-62. [Google Scholar]
  • 66.Wilcock, D., S. A. Duncan, P. Traktman, W.-H. Zhang, and G. L. Smith. 1999. The vaccinia virus A40R gene product is a nonstructural, type II membrane glycoprotein that is expressed at the cell surface. J. Gen. Virol. 80:2137-2148. [DOI] [PubMed] [Google Scholar]
  • 67.Willer, D. O., G. McFadden, and D. H. Evans. 1999. The complete genome sequence of shope (rabbit) fibroma virus. Virology 264:319-343. [DOI] [PubMed] [Google Scholar]
  • 68.Williams, E. S., V. M. Becerra, E. T. Thorne, T. J. Graham, M. J. Owens, and C. E. Nunamaker. 1985. Spontaneous poxviral dermatitis and keratoconjunctivitis in free-ranging mule deer (Odocoileus hemionus) in Wyoming. J. Wildl. Dis. 21:430-433. [DOI] [PubMed] [Google Scholar]
  • 69.Yokoyama, W. M., and B. F. M. Plougastel. 2003. Immune functions encoded by the natural killer gene complex. Nat. Rev. Immunol. 3:304-316. [DOI] [PubMed] [Google Scholar]
  • 70.Yoon, H. J., Z. Zhu, J. M. Gwaltney, Jr., and J. A. Elias. 1999. Rhinovirus regulation of IL-1 receptor antagonist in vivo and in vitro: a potential mechanism of symptom resolution. J. Immunol. 162:7461-7469. [PubMed] [Google Scholar]
  • 71.Zarnke, R. L., R. A. Dieterich, K. A. Neiland, and G. Ranglack. 1983. Serologic and experimental investigations of contagious ecthyma in Alaska. J. Wildl. Dis. 19:170-174. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES