Abstract
Background
The aldo-keto reductase 1C3 (AKR1C3) has been heavily implicated in the propagation of prostate malignancy. AKR1C3 protein is elevated within prostate cancer tissue, it contributes to the formation of androgens and downstream stimulation of the androgen receptor (AR). Elevated expression of AKR1C3 is also reported in acute myeloid leukemia but the target nuclear receptors have been identified as members of the peroxisome-proliferator activated receptor (PPARs) subfamily. Thus, AKR1C3 cancer biology is likely to be tissue dependent and hormonally linked to the availability of ligands for both the steroidogenic and non-steroidogenic nuclear receptors.
Methods
In the current study we investigated the potential for AKR1C3 to regulate the availability of prostaglandin-derived ligands for PPARg mainly, prostaglandin J2 (PGJ2). Using prostate cancer cell lines with stably reduced AKR1C3 levels we examined the impact of AKR1C3 upon proliferation mediated by PPAR ligands.
Results
These studies revealed knockdown of AKR1C3 had no effect upon the sensitivity of androgen receptor independent prostate cancer cells towards PPAR ligands. However, the reduction of levels of AKR1C3 was accompanied by a significantly reduced mRNA expression of a range of HDACs, transcriptional co-regulators, and increased sensitivity towards SAHA, a clinically approved histone deacetylase inhibitor.
Conclusions
These results suggest a hitherto unidentified link between AKR1C3 levels and the epigenetic status in prostate cancer cells. This raises an interesting possibility of a novel rational to target AKR1C3, the utilization of AKRIC3 selective inhibitors in combination with HDAC inhibition as part of novel epigenetic therapies in androgen deprivation therapy recurrent prostate cancer.
Keywords: Prostate cancer, 17B-Hydroxysteroid dehydrogenase, AKR1C3, PPAR, Prostaglandins, Bezafibrate
1. Introduction
Nuclear receptors (NRs) regulate multiple gene targets controlling cell growth and differentiation in many self-renewing tissues including hematopoietic and epithelial cells. The ability of NRs to exert these gene regulatory effects is dictated by the supply of ligand availability and epigenetic context (reviewed in [1,2]).
Prostate cancer (CaP) represents an attractive disease with which to target NR signaling in either chemoprevention or chemotherapeutic strategies. Early stage disease is a potential target for chemotherapies that target NRs such as VDR, RARs/RXRs and PPARs [3–5]. Expression of these receptors is sustained in early stage CaP and they are well established as exerting a range of tumor repressive effects. For example, PPARg receptor activation induces anti-proliferative, pro-differentiating gene targets and has subsequently been the target of various clinical trials including a phase II clinical study with Troglitazone [6]. At late stage CaP targeting of the AR by androgen deprivation therapy (ADT) forms the current treatment mainstay for advanced prostate cancer. However, in ADT-R CaP (androgen deprivation therapy—recurrent prostate cancer), is predominantly lethal with limited alternative therapeutic strategies [7].
In late stage and ADT-R CaP aberrant co-repressor actions preclude NR activation, impairing anti-proliferative capacity and further epigenetic mechanisms contribute to this resistance [8] with similar events disrupting AR signaling [9,10] (reviewed in [11]). Specifically, PPARg actions are epigenetically disrupted and can be targeted selectively by using HDAC inhibitor co-treatments [12,13]. Elevated levels of the co-repressors NCOR1, and to a lesser extent NCOR2/SMRT, correlated with, and functionally drive, the selective insensitivity of PPARa/g receptors towards dietary derived and therapeutic ligands [13,14].
One approach to target NR signaling in CaP is to target the enzymes that regulate ligand availability. Aldoketoreductase 1C3 (AKR1C3) is a multifunctional enzyme and acts as a type 23-alpha-hydroxysteroid dehydrogenase or 17-beta-HSD type 5. A key regulator of steroidal metabolism, it is implicated in cancer progression. For example, silencing of AKR1C3 has been shown to inhibit cervical cancer metastasis [15]. In CaP, AKR1C3 actions are implicated in the generation of androgens [16–19], AR activation and has been investigated as a potential biomarker for CaP progression [20,21]. However, AKR1C3 is able to convert various different substrates and reflecting this, it has been implicated in the altered metabolism of chemotherapeutics propagating cancer cells resistance [22]. Perhaps reflecting this promiscuity over substrate choice, AKR1C3 is often overexpressed in prostate cancer tissues and prostate cancer cell lines [23]. Furthermore its expression is elevated in cell lines with either absent or low levels of AR [24] suggesting that substrates may include those independent of androgen signaling and 5α-dihydrotestosterone may not be the only product of AKR1C3 [25,26].
Previous publications have considered the regulatory actions of AKR1C3 on alternative substrates, including the arachidonate-derived prostaglandins that act as de novo ligands for PPARg [27]. The expression level of AKR1C3 has been examined in ADT-R CaP tissue and cells lines, including PC-3 and DU 145 cells, and been shown to be elevated compared to less aggressive counterparts and directly proportional to the 11b-PGF2 levels [28]. We and others have examined the ability of AKR1C3 to convert prostaglandin D2 (PGD2), into 9-alpha, 11beta-prostaglandin F2 [28,29] (a ligand for the FP receptor, which is a driver of cell proliferation) preventing the alternative spontaneous and non-enzymatic generation of the potent PPARg ligand PGJ2 [30,31]. Additionally, the PPARg mediated protective action of AKR1C3 have been investigated by exploiting 6-Medroxyprogesterone acetate (MPA) an inhibitor of AKR1C3 [32]. In leukemic systems a synergistic effect on cell death occurs with the combination of MPA with PPARg ligand bezafibrate [33]. Combinatorial treatments of MPA and PGD2 have corroborated this in other cancer models to induce apoptosis and cell cycle arrest through PPARg driven activation pathways [34], and other studies have echoed this approach in CaP [35].
Therefore, the current study, examined the possibility that an AR-independent mechanism for AKR1C3 was operating in CaP cells and, in particular, we focused on a potential role in ADT-R CaP cells where AR signaling is either diminished or lost. By generating CaP cell lines stably expressing a short hairpin siRNA sequence to AKR1C3 we investigated responses to treatment with the PPARg ligand precursor and AKR1C3 substrate PGD2.
2. Materials & methods
2.1. Ligands
Suberoylanilide hydroxamic acid (SAHA) (Merck Inc, New Jersey, USA), GW9662 (Sigma–Aldrich) and prostaglandin D2 (Sigma–Aldrich) were stored in DMSO (Sigma–Aldrich) as 100 mM stocks. Bezafibrate (PPARa/g), 6-medroxyprogesterone acetate (Sigma–Aldrich), and indomethacin (Sigma–Aldrich) were stored as 10 mM stocks in DMSO.
2.2. Cell culture and shRNA knockdown
ShRNA targeting AKR1C3 oligonucleotides containing the short hairpin sequence (Sigma–Aldrich) were annealed and inserted in a pcDNA3.1 vector (Invitrogen). Stably transfected cells were exposed to 100 mg/ml neomycin sulphate (Sigma–Aldrich) as a selection agent. Human prostate cell lines used RWPE-1, LNCaP, PC-3, DU 145 were purchased from American Type Cell Culture (ATCC) Manassas, Virginia USA. RWPE-1 cells were maintained within keratinocyte serum free medium (K-SFM) (Invitrogen GIBCO) used in combination with the recommended supplements of bovine pituitary extract (0.05 mg/ml) (BPE) and human recombinant epidermal growth factor (5ng/ml) (EGF). LNCaP, PC-3 and DU 145 cells were maintained in RPMI 1640 medium (Sigma–Aldrich) containing 10% fetal bovine serum (Invitrogen), 2 mM l-glutamine and containing 100 units/ml penicillin and 100 μg/ml Streptomycin. Cells were kept at 37 °C in 95% air and 5% CO2. Cells were washed in sterile phosphate buffered saline (PBS) and split using Trypsin-EDTA (Sigma–Aldrich) and seeded into new flasks containing fresh media. All experiments were conducted using cells between passages 15 and 28.
2.3. Primary prostate tumor material
All tumors were collected under IRB approval at Roswell Park Cancer Institute (RPCI), specifically the Genitourinary Disease Site Research Network at RPCI, which assesses applications for non-human subject research under guidance of the Office of Research Subject Protection. All patients at RPCI give written consent to allow tumor material not needed for pathological grading to be considered for non-human subject research. Total mRNA from local tumors and adjacent non-neoplastic tissue from the same patient were extracted from snap frozen radical prostatectomy samples with subsequent frozen section analysis for quality control. The frozen section H&E was evaluated by a board certified pathologist for prostatic adenocarcinoma versus benign tissue. Segments of tissue corresponding to prostatic adenocarcinoma with equal to or greater than 70% neoplastic nuclei are submitted for RNA isolation. RNA processing was done in the Pathology Resource Network facilities with standard operating procedures as described previously [36].
2.4. Proliferation assays
Proliferation (ViaLight HS, LumiTech, Nottingham, U.K.) was measured as described previously [37] and optimized using different seeding densities to ensure exponential proliferation through the course of the experiment. Cancer cell lines (2 × 103 cells/well) and RWPE-1 (4 × 103 cells/well) were plated in 96-well, white-walled plates (Fisher Scientific Ltd., Loughborough, U.K.), dosed with agents to final volume of 100 μl/well and incubated for 96 h, with re-dosing after 48 h. Cells were normalized to vehicle control treated wells performed in each separate assay plate. Each treatment was performed in technical triplicate and in biological triplicate experiments.
2.5. Q-RT-PCR
cDNA was prepared using random primers (Promega) and target genes relative expression quantitated using ABI 7500–Applied Biosystems. Sequences for AKR1C3 FORWARD GGGATCTCAACGAGACAAACG REVERSE AAAGGACTGGGTCCTCCAAGA PROBE TGGACCCGAACTCCCCCGGTG were designed and validated. 18S VIC-labeled probe was used as an endogenous control (Applied Biosystems). Measurements were carried in triplicate, in triplicate wells for each condition and ddCt fold changes calculated.
2.6. Multi-target micro-fluidic Q-RT-PCRM
Measurement of targeted multiple gene transcripts was undertaken on custom-designed TaqMan Low Density Array (ABI 7900HT Fast Real-Time PCR System) as described previously [14] the full 95 gene list is available upon request. Briefly, the array included probes and primers for 18S and the gene targets in nine functional groups whose expression together reflects nuclear receptor signaling capacity. These were 1. Nuclear receptors (e.g. high and broad affinity such as VDR and PPARs); 2. Nuclear receptor co-factors (e.g. co-activators [p160 family, non-p160 members, members of the ‘bridging’ DRIP/TRAP complex], co-repressors [NCOR1, NCOR2/SMRT, COPS2/TRIP15/Alien]; 3. Histone modifiers (histone deacetylases [e.g. HDACs hSIRT1] and acetyltransferases [P300, CBP, PCAF], histone methyltransferases [SUV39H1, SUV39H2], demethylases [KDM1A/LSD1], Histone deaminases [e.g. PAD14]); 4. Metabolic enzymes (e.g. CYP24 and SULTA1); 5. Cell death regulators (e.g. CASP4 and BAX); 6. Transcription factors (e.g. YY1 and ID1); 7. Cell surface transporters (e.g. ABC transporters such as MRP3); 8. Cell cycle regulators (e.g. CCND1,GADD45a, CDKN1A, TP53); 9. Signal transduction (e.g. IGFBPs, MAPKs, CDH1). The exact choices represented in classes 1-3 were guided by SAGE expression data from normal prostate tissue [38] and those in classes 4-9 included known direct target genes for nuclear receptors [39–46]. Total mRNA from cell-cycle sorted cells was quantified in triplicate samples measured in duplicate as described previously [14].
Fold changes were calculated for target gene expression and statistical analyses carried out using the TIGR MultiExperiment Viewer 4.0, MeV. A one sample t-test analysis based on permutation (Westfall Young stepdown [47]–MaxT correction) was used to identify genes significantly expressed. In this case vectors containing gene expression values were tested against the mean of 18S fold changes. One-Way ANOVA was used to identify genes that were differentially expressed for the shAKR1C3 PC-3 knock-down experiment compared to vector only PC-3 controls.
2.7. Western immunoblotting
Total proteins were electrophoresed in a 12.5% gel, for 90 min at 120 volts. Proteins were then transferred onto PVDF (polyvinylidene fluoride) membrane (45 min at 80 V). The PVDF membranes were then left in 5% non-fat milk diluted in Tri-buffered saline containing 2% Tween (TBS-T) detergent for 45 min. Monoclonal anti-AKR1C3 antibody (Sigma–Aldrich) produced in mouse was diluted 1 in 10,000 into 5% non-fat milk diluted in TBS-T. The PVDF membranes were left in the primary antibody mixture overnight in a cold room (5°C) to prevent evaporation. The PVDF membranes were washed in TBS-T for 15 min changing the TBS-T every 5 min. Secondary HRP-labeled anti-mouse immunoglobulin was diluted 1 in 10,000 into TBS-T and the membranes incubated in the mixture for 45 min. Chemiluminescent ECL western blotting detection kit (Amersham, GE Health Care) was added in accordance with manufacturer's protocol.
2.8. Statistical analysis
Data shown are mean ± SEM of at least three independent experiments with statistical significance defined as P < 0.05 (*P < 0.05; **P < 0.01; ***P < 0.001) using unpaired Student's t-test and were conducted with Prism (GraphPad, CA). Statistical analysis on real-time PCR data was performed on mean dct values.
3. Results
3.1. AKR1C3 expression is elevated in prostate cancer cell lines and primary prostate cancer material
Fig. 1A illustrates Q-RT-PCR data for AKR1C3 in CaP cell lines, normalized to RWPE-1 non-malignant prostate cells. Significant elevation of AKR1C3 was demonstrated in PC-3 and LNCaP cancer cell lines (p < 0.05); LNCaP (5.08 ±1.0 SEM), PC-3 (7.54 ±0.1 SEM). Fig. 1B shows expression of AKR1C3, PPARA and PPARG in thirteen human primary tumors compared to matched normal tissue, derived from radical prostatectomy. There was a significant increase in AKR1C3 levels (2.69 ±1.7 SEM). PPARA and PPARG levels were comparable between normal and tumor samples [48].
Fig. 1.

(A) AKR1C3 is elevated in most but not all prostate cancer cell lines and tissue samples. Total RNA from RWPE-1, LNCaP, PC-3 and DU 145 cells was extracted and reverse transcribed. Levels of AKR1C3 mRNA were measured using Q-RT-PCR using ribosomal 18S as an endogenous control. Values were normalized relative to the non-malignant immortalized prostate RWPE-1 cell line shown as fold change in AKR1C3. Bars indicate mean values ± SEM of at least three independent biological measurements performed in triplicate PCR wells. (B) AKR1C3 is elevated in most human prostate cancer tissue samples. Thirteen samples of human prostate tumors were used and total mRNA extracted and subject to reverse transcription. The Q-RT-PCR was performed on the resulting cDNA using 18S as an endogenous control. The ddCt values for non-tumorigenic tissue samples were normalized and compared to human tumor samples. Statistical analysis was performed using t-test. *= p-value 0.05, ** = p-value 0.01, *** = p-value 0.001.
3.2. Neither AKR1C3 inhibition nor knockdown enhances PPAR antiproliferative signaling
Previously, studies of acute myeloid leukemia have shown combinatorial anti-tumor activity when AKR1C3 inhibitors are combined with Bezafibrate (a dual PPARa/g ligand). Assuming prostate cell lines have comparable basal turnover of cholesterol-derived prostaglandin substrate the similar response would be observed. However, the use of AKR1C3 inhibitors either indomethacin or 6-medroxyprogesterone acetate [49] did not enhance the anti-proliferative effects of Bezafibrate against the non-malignant RWPE-1 cells or either CaP cell line (Fig. 2A).
Fig. 2.

Reducing AKR1C3 levels is unable to restore anti-proliferative PGD2 response. (A) RWPE-1, PC-3 and DU 145 cells were plated out at 2 × 103 cells per well with bezafibrate (0.1 μM) alone or in combination with indomethacin (20 μM) or MPA (0.5 μM). After incubation for 48 h the cells were re-dosed again. Total treatment time was 96 h. Bars indicate the mean of at least three independent experiments ± SEM. (B) PC-3 and DU 145 shAKR1C3 cells show significant reduction in AKR1C3 mRNA and protein in comparison to vector only. Q-RT-PCR was performed on the resulting cDNA using 18S as an endogenous control. (C) DU 145 shows Western immunobloting analysis of shAKR1C3 transfected cells and vector only cells probed with AKR1C3 specific antibody and detected using chemoluminesence. Image shown is representative of three independent experiments. (D) Cells were plated out at 2 × 103 cells per well with PGD2 added (0.62 μM, 1.25 μM, 2.5 μM, or 5.0 μM) and after incubation for 48 h the cells were re-dosed with PGD2. Total treatment time was 96 h. Each data point represents the mean of four experiments each in triplicate wells ± SEM. Statistical analysis was performed using t-test * = p-value 0.05, ** = p-value 0.01, *** = p-value 0.001.
Stable transfection of short hairpin RNA targeted towards AKR1C3 in PC-3 and DU 145 resulted in significant reduction in both AKR1C3 mRNA (Fig. 2B) and protein levels (Fig. 2C). Cells were then treated with the PPARg agonist precursor PGD2 to examine the biological impact of AKR1C3 reduction. Fig. 2D demonstrates reduction of AKR1C3 levels had no significant affect on prolifer-ative response to PGD2 within PC-3 (Vector Only (VO) and shAKR1C3) and DU 145 (VO and shAKR1C3) cells. These data suggest that shAKR1C3 PC-3 and DU 145 cells have unchanged response to the PPARg ligand precursor PGD2.
3.3. Cell proliferation in response to SAHA in shAKR1C3 transfected cells
Explanations for deficiency of AKR1C3 inhibitor impact may involve FP1 receptor expression and inherent variations in export/import of prostaglandins. However, we reasoned that the lack of a response to AKR1C3 inhibitors maybe due to epigenetic blockade of PPARg transcriptional actions. Therefore, the HDAC inhibitor acid SAHA was used to treat AKR1C3 knockdown cells in an attempt to overcome epigenetic resistance at PPARg targets. Down regulation of AKR1C3 in DU 145 cells resulted in significant sensitization to the anti-proliferative actions of SAHA. (Fig. 3A and B). A similar trend was observed in PC-3 ShAKR1C3 cells although this did not reach significance when compared SAHA treated PC-3 VO cells (Fig. 3A and B). The lesser difference in PC-3 cells may relate the to greater sensitivity of PC-3VO to SAHA treatment alone when compared to DU 145 VO cells which displayed no antiproliferative response to SAHA. However, SAHA treatment did not sensitize shAKR1C3 cells to either the PPARg ligand precursor PGD2 or the direct PPARg ligand GW9662. Interestingly, DU 145 cells revealed a significantly increased sensitivity to PGD2 in shAKR1C3 cells. This reflects data on chemical inhibition of AKR1C3 by MPA leading to increased sensitivity to Bezafibrate (Fig. 2A).
Fig. 3.

The HDAC inhibitor SAHA shows no interaction with PPARg mediated signaling. (A) PC-3 and DU 145 cells were plated out at 2 × 103 cells per well with PGD2 (2.5 μM) alone or in combination with SAHA (0.5 μM). After incubation for 48 h the cells were re-dosed again. Total treatment time was 96 h. Bars indicate the mean of at least three independent experiments ± SEM. Statistical analysis was performed using t-test * = p-value 0.05, ** = p-value 0.01, *** = p-value 0.001. (B) PC-3 and DU 145 cells were plated out at 2 × 103 cells per well with GW9662 (1.0 μM) alone or in combination with SAHA (0.5 μM), after incubation for 48 h the cells were re-dosed again. Total treatment time was 96 h. Bars indicate the mean of at least three independent experiments ± SEM. Statistical analysis was performed using t-test * = p-value 0.05, ** = p-value 0.01, *** = p-value 0.001.
3.4. Multi-targeted micro-fluidic QT-RT-PCR of the NR network
The above findings in two prostate cancer cell line models suggest that the role of AKR1C3 in CaP is different from that in leukemia and is only weakly linked to the protection of PPARg. To reveal the impact of reduced AKR1C3 levels in this priming event we examined expression of the NR network using a previously established microfluidic PCR approach [8,14]. We selected PC-3 cells for these experiments as arguably it arguably is a more relevant model of ADT-RCaP than DU 145 cells, as it in vivo it will metastasize to the same sites as observed in human disease [50]. The most significantly deregulated genes in shAKR1C3 compared to VO PC-3 cells are shown in Fig. 4. Interestingly, a common downregulation of a range of epigenetic regulators was observed, alongside AKR1C3 downregulation. These include HDACs, NR co-activators and NRs and PPARg coactivator (PPARGC1A). In addition the histone methyltransferase SET7 and proto-oncogene MYB were significantly down-regulated in shAKR1C3. The NFkB complex component IKBkB was the only gene to be significantly upregulated in the presence of shAKR1C3. Transcriptional activators forming the NFkB complex have been found to be important in prostate cancer progression and human prostate cancer prognosis [51–53]. This increase of NFKB in response to shAKR1C3 is of particular interest as it is a key driver of prostate cell proliferation and AKR1C3 presence influencing NFkB activity (through PGF2 production) has also been suggested by others [54].
Fig. 4.

AKR1C3 knockdown influences a network of genes involved in transcriptional regulation. Basal PC-3 vector only controls and shAKR1C3 PC-3 samples were used. Total mRNA was collected and added to a micro-fluidic reverse transcription Q-RT-PCR two step reaction. Primer sets on the card were selected for their nuclear receptor prostate specific context consisting of nine groups listed in the materials and methods section.
4. Discussion
The current study was undertaken to investigate the roles of AKR1C3 in CaP, as this enzyme is increasingly a focus in CaP research that includes its altered expression and function. The studies of others have focused on the role of this enzyme to alter ligand availability for steroidogenic androgen and estrogen receptors in the prostate. Additionally, studies and have considered the impact of PGD2 on cell proliferation in cells that over-express AKR1C3 [55–59]. By contrast, our previous studies show elevated AKR1C3 deprives AML cells of J-series prostaglandins that can act as endogenous PPAR ligands. Given that PPARg ligands have been investigated for the treatment of various cancer types for example neuroblastomas [60], colorectal [61], breast and prostate cancers [62,63]. It was hypothesized that the role in CaP for AKR1C3 may be to silence PPAR signaling. Furthermore, it has been demonstrated that stable expression of AKR1C3 in hormone dependent MCF-7 breast cancer cell lines negatively impacts anti-proliferative actions of PGD2 [27].
This study investigated AKR1C3 function by undertaking knockdown and chemical inhibition approaches in parallel to compare findings to previously published over-expression approaches [56,57]. In particular an overexpression investigation of AKR1C3 in PC-3 cells found overexpression promotes proliferation [35]. However, this study found PGD2 exposure to overexpressing AKR1C2 and AKR1C3 PC-3 models significantly reduces proliferation compared to controls. However, in this study reduction of AKR1C3 in the presence of PGD2 had no impact upon proliferation. This disparity reflects the unclear interplay between AKR1C2, AKR1C3 in prostaglandin metabolism.
PC-3 and DU 145 cells are derived from ADT-R CaP cells that are insensitive to AR signaling but retain the capacity for PPAR signaling. Therefore, knockdown of AKR1C3 in these models allows a clearer examination of the role of AKR1C3 in regulating PPARg. However, shAKR1C3 expression did not significantly alter responses to either endogenous (PGD2) or synthetic PPARg (GW9662) ligands.
These data support the concept that either AKR1C3 is not a major regulator of PPARg in prostate cells or that in CaP the ability of AKR1C3 to exert such an action is overridden by epigenetic events [36,37,64]. Therefore SAHA was utilized in an attempt to restore PPARg function. Interestingly, the shAKR1C3 clones of DU 145 were significantly more sensitive to SAHA than controls; in PC-3 cells this was smaller and non-significant but trending in the same direction. This supports a hitherto unsuspected link between AKR1C3 actions and the epigenome. The anti-proliferative effects of combining AKR1C3 knockdown and SAHA treatment were not further enhanced in the presence of PGD2, reinforcing the notion that these epigenetic actions of AKR1C3 in CaP cells are independent of PPARs. It is however, possible alternative routes of 15delta-PGJ2 elimination in particular, conjugation and dismissal by glutathione could play a contributory role in the absence of PGD2 response.
The fact that reduction of AKR1C3 levels lead to increased sensitivity towards SAHA suggested that AKR1C3 has a role in promoting CaP survival, proliferation and its removal whilst not directly affecting cell growth primes cells for sensitivity to other potential CaP therapeutics. This suggests overexpression of AKR1C3 has an impact upon the epigenetic state of the cell, and is independent of both PPAR and AR signaling, (given the diminished/absent AR state of these cells). The down regulation of a number of HDACs following AKR1C3 knockdown supports the hypothesis that AKR1C3 in some manner is able to regulate enzymes governing epigenetic gene regulation, explaining why the cells gain sensitivity to SAHA. Interestingly, the upregulation of IKBkB correlates with previous findings suggesting a link between AKR1C3 and NFkB signaling pathways [65,66]. More broadly to establish the association of AKR1C3 with tumor status The Cancer Genome Atlas (TCGA) data was examined to identify genes associated with AKR1C3 signalling, and in parallel the AR and PPARg signalling. The goal was to reveal commonly distorted components and to infer how AKR1C3 may be co-expressed with either of these pathways, and at what stage of prostate cancer. We mined RNA-Seq associated with AKR1C3 in two different cohorts of prostate cancer samples in TCGA, namely, the University of Michigan cohort of 94 advanced stage and invasive tumors [67] and the Stand Up to Cancer (SU2C) cohort of 118 metastatic castrate recurrent tumors [68]. From these analyses we generated heatmaps for each of the tumor cohort (Supplementary Fig. 1). In each case AKR1C3 (red arrowhead) grouped by expression in a different cluster than the AR (Black arrowhead). In particular AKR1C3 expression clusters more closely with PPARs than the AR. These findings suggest that taking an unbiased approach to the networks in which AKR1C3 is implicated supports a role of close association with PPARs rather than the AR and this is especially evident in aggressive and advanced disease that has failed anti-androgen treatment.
Furthermore in the SU2C cohort of 114 tumors, AKR1C3 is over-expressed and amplified in 4% of tumors. However network analyses [69] of AKR1C3 reveals a direct protein–protein interaction with ZHX1 which is a corepressor and known to recruit HDACs [70]. ZHX1 [71] is a relatively unexplored protein. Large-scale protein–protein screens reveal that it interacts with proteins including histone deacetylase (HDAC1), the DNA methyltransferases (DNMT1 and DNMT3B) [72], and a number of transcription factors (NFYa and b) [73]. These findings generate confidence that a ZHX1 complex initiates chromatin condensation and leads to gene silencing. Together we believe strongly that our data generated by two different experimental approaches, and these parallel findings from others indicate a direct and functional link between AKR1C3 and the regulation of the epigenome.
The current study has revealed a novel role of AKR1C3 expression on the epigenetic status of prostate cancer cells that is independent of AR and PPARs signaling and highlights the potential for selective inhibitors of AKRIC3 in combination with SAHA or other HDAC inhibitors as prospective therapy in AR resistant disease (Fig. 5).
Fig. 5.

A model of AKR1C3 mediated epigenetic resistance in prostate cancer. (a) PGD2 is responsible for the generation of PPARg ligand PGJ2. (b) Increased AKR1C3 levels divert PGD2 converting it to 11b-PGF2 contributing to the activation of proliferative transcription factors such as the NFkB complex. (c) Observations in shAKR1C3 prostate cancer cells suggest AKR1C3 plays a role in sustained repression of anti-proliferative genes, this can be relieved with impairment of AKR1C3 activity combined with the treatment of HDAC inhibitor permitting access to the HATs responsible for permissive gene activation.
Supplementary Material
Acknowledgments
MJC acknowledges support in part from National Institute of Health grants [R01CA095367-06 and 2R01-CA-095045-06] and the Prostate program of the Department of Defense Congressionally Directed Medical Research Programs [W81XWH-14-1-0608], MJC also acknowledges support, in part, of the NCI Cancer Center Support Grant to the Roswell Park Cancer Institute [CA016056]. SB acknowledges support in part from the Prostate program of the Department of Defense Congressionally Directed Medical Research Programs [W81XWH-13-1-0276; PC121785].
Footnotes
Disclosure: All authors have nothing to disclose.
Author contributions: CLD, SB and FK conducted the work. MJC and CLD wrote the manuscript. MJC and CMB conceived and designed the research.
Appendix A Supplementary data: Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.jsbmb.2015.09.037.
References
- 1.Rosenfeld MG, Lunyak VV, Glass CK. Sensors and signals: a coactivator/corepressor/epigenetic code for integrating signal-dependent programs of transcriptional response. Genes Dev. 2006;20:1405–1428. doi: 10.1101/gad.1424806. [DOI] [PubMed] [Google Scholar]
- 2.Perissi V, Jepsen K, Glass CK, Rosenfeld MG. Deconstructing repression: evolving models of co-repressor action. Nat Rev Genet. 2015;11:109–123. doi: 10.1038/nrg2736. nrg2736 [pii]10.1038/nrg2736. [DOI] [PubMed] [Google Scholar]
- 3.Chomienne C, Fenaux P, Degos L. Retinoid differentiation therapy in promyelocytic leukemia. FASEB J: Off Publ Fed Am Soc Exp Biol. 1996;10:1020–1030. doi: 10.1096/fasebj.10.9.8801163. [DOI] [PubMed] [Google Scholar]
- 4.Thorne J, Campbell MJ. The vitamin D receptor in cancer. Proc Nutr Soc. 2008;67:115–127. doi: 10.1017/S0029665108006964. doi: http://dx.doi.org/10.1017/s0029665108006964. [DOI] [PubMed] [Google Scholar]
- 5.Campbell MJ, Carlberg C, Koeffler HP. A role for the PPARgamma in cancer therapy. PPAR Res. 2008;2008(314974) doi: 10.1155/2008/314974. doi: http://dx.doi.org/10.1155/2008/314974. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Mueller E, et al. Effects of ligand activation of peroxisome proliferator-activated receptor gamma in human prostate cancer. Proc Natl Acad Sci U S A. 2000;97:10990–10995. doi: 10.1073/pnas.180329197. doi: http://dx.doi.org/10.1073/pnas.180329197. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Newling D, et al. Assessment of hormone refractory prostate cancer. Urology. 1997;49:46–53. doi: 10.1016/s0090-4295(99)80323-9. [DOI] [PubMed] [Google Scholar]
- 8.Battaglia S, et al. Elevated NCOR1 disrupts PPAR{alpha}/{gamma} signaling in prostate cancer and forms a targetable epigenetic lesion. Carcinogenesis. 2010 doi: 10.1093/carcin/bgq086. bgq086 [pii]10.1093/carcin/bgq086. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Liao G, et al. Regulation of androgen receptor activity by the nuclear receptor corepressor SMRT. J Biol Chem. 2003;278:5052–5061. doi: 10.1074/jbc.M206374200. 10.1074/jbc.M206374200M206374200[pii] [DOI] [PubMed] [Google Scholar]
- 10.Hodgson MC, et al. The androgen receptor recruits nuclear receptor corepressor (N-CoR) in the presence of mifepristone via its N and C termini revealing a novel molecular mechanism for androgen receptor antagonists. J Biol Chem. 2005;280:6511–6519. doi: 10.1074/jbc.M408972200. M408972200 [pii]10.1074/jbc. M408972200. [DOI] [PubMed] [Google Scholar]
- 11.Battaglia S, Maguire O, Campbell MJ. Transcription factor co-repressors in cancer biology: roles and targeting. Int J Cancer. 2010;126:2511–2519. doi: 10.1002/ijc.25181. doi: http://dx.doi.org/10.1002/ijc.25181. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Chang TH, Szabo E. Enhanced growth inhibition by combination differentiation therapy with ligands of peroxisome proliferator-activated receptor-gamma and inhibitors of histone deacetylase in adenocarcinoma of the lung. Clin Cancer Res. 2002;8:1206–1212. [PubMed] [Google Scholar]
- 13.Battaglia S, et al. Elevated NCOR1 disrupts PPAR signaling in prostate cancer and forms a targetable epigenetic lesion. Carcinogenesis. 2010 doi: 10.1093/carcin/bgq086. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Abedin SA, et al. Elevated NCOR1 disrupts a network of dietary-sensing nuclear receptors in bladder cancer cells. Carcinogenesis. 2009;30:449–456. doi: 10.1093/carcin/bgp005. doi: http://dx.doi.org/10.1093/carcin/bgp005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Wu CH, et al. Clinical implications of aldo-keto reductase family 1 member C3 and its relationship with lipocalin 2 in cancer of the uterine cervix. Gynecol Oncol. 2014;132:474–482. doi: 10.1016/j.ygyno.2013.11.032. doi: http://dx.doi.org/10.1016/j.ygyno.2013.11.032. [DOI] [PubMed] [Google Scholar]
- 16.Penning TM, et al. Human 3alpha-hydroxysteroid dehydrogenase isoforms (AKR1C1-AKR1C4) of the aldo-keto reductase superfamily: functional plasticity and tissue distribution reveals roles in the inactivation and formation of male and female sex hormones. Biochem J. 2000;351:67–77. doi: 10.1042/0264-6021:3510067. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Knuuttila M, et al. Castration induces up-regulation of intratumoral androgen biosynthesis and androgen receptor expression in an orthotopic VCaP human prostate cancer xenograft model. Am J Pathol. 2014;184:2163–2173. doi: 10.1016/j.ajpath.2014.04.010. doi: http://dx.doi.org/10.1016/j.ajpath.2014.04.010. [DOI] [PubMed] [Google Scholar]
- 18.Kikuchi A, et al. In vitro and in vivo characterisation of ASP9521: a novel, selective, orally bioavailable inhibitor of 17beta-hydroxysteroid dehydrogenase type 5 (17betaHSD5; AKR1C3) Invest New Drugs. 2014;32:860–870. doi: 10.1007/s10637-014-0130-5. doi: http://dx.doi.org/10.1007/s10637-014-0130-5. [DOI] [PubMed] [Google Scholar]
- 19.Fankhauser M, et al. Canonical androstenedione reduction is the predominant source of signaling androgens in hormone-refractory prostate cancer. Clin Cancer Res Off J Am Assoc Cancer Res. 2014;20:5547–5557. doi: 10.1158/1078-0432.CCR-13-3483. 10.1158/1078-0432.CCR-13-3483. [DOI] [PubMed] [Google Scholar]
- 20.Tian Y, et al. AKR1C3 overexpression may serve as a promising biomarker for prostate cancer progression. Diagn Pathol. 2014;9:42. doi: 10.1186/1746-1596-9-42. doi: http://dx.doi.org/10.1186/1746-1596-9-42. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Yepuru M, et al. Steroidogenic enzyme AKR1C3 is a novel androgen receptor-selective coactivator that promotes prostate cancer growth. Clin Cancer Res Off J Am Assoc Cancer Res. 2013;19:5613–562510. doi: 10.1158/1078-0432.CCR-13-1151. 1158/1078-0432. CCR-13-11 51. [DOI] [PubMed] [Google Scholar]
- 22.Hofman J, Malcekova B, Skarka A, Novotna E, Wsol V. Anthracycline resistance mediated by reductive metabolism in cancer cells: the role of aldo-keto reductase 1C3. Toxicol Appl Pharmacol. 2014;278:238–248. doi: 10.1016/j.taap.2014.04.027. doi: http://dx.doi.org/10.1016/j.taap.2014.04.027. [DOI] [PubMed] [Google Scholar]
- 23.Segawa Y, et al. Expression of peroxisome proliferator-activated receptor (PPAR) in human prostate cancer. Prostate. 2002;51:108–116. doi: 10.1002/pros.10058. [DOI] [PubMed] [Google Scholar]
- 24.Mitsiades N, et al. Distinct patterns of dysregulated expression of enzymes involved in androgen synthesis and metabolism in metastatic prostate cancer tumors. Cancer Res. 2012;72:6142–6152. doi: 10.1158/0008-5472.CAN-12-1335. 10.1158/0008-5472.CAN-12-1335. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Bauman DR, Steckelbroeck S, Peehl DM, Penning TM. Transcript profiling of the androgen signal in normal prostate, benign prostatic hyperplasia, and prostate cancer. Endocrinology. 2006;147:5806–5816. doi: 10.1210/en.2006-0627. doi: http://dx.doi.org/10.1210/en.2006-0627. [DOI] [PubMed] [Google Scholar]
- 26.Wako K, et al. Expression of androgen receptor through androgen-converting enzymes is associated with biological aggressiveness in prostate cancer. J Clin Pathol. 2008;61:448–454. doi: 10.1136/jcp.2007.050906. doi: http://dx.doi.org/10.1136/jcp.2007.050906. [DOI] [PubMed] [Google Scholar]
- 27.Byrns MC, Duan L, Lee SH, Blair IA, Penning TM. Aldo-keto reductase 1C3 expression in MCF-7 cells reveals roles in steroid hormone and prostaglandin metabolism that may explain its over-expression in breast cancer. J Steroid Biochem Mol Biol. 2010;118:177–187. doi: 10.1016/j.jsbmb.2009.12.009. doi: http://dx.doi.org/10.1016/j.jsbmb.2009.12.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Yin YD, et al. The activity of SN33638, an inhibitor of AKR1C3, on testosterone and 17beta-estradiol production and function in castration-resistant prostate cancer and ER-positive breast cancer. Front Oncol. 2014;4(159) doi: 10.3389/fonc.2014.00159. doi: http://dx.doi.org/10.3389/fonc.2014.00159. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Smuc T, Rizner TL. Expression of 17beta-hydroxysteroid dehydrogenases and other estrogen-metabolizing enzymes in different cancer cell lines. Chem Biol Interact. 2009;178:228–233. doi: 10.1016/j.cbi.2008.10.038. S0009-2797(08) 00548-6 [pii]10.1016/j.cbi.2008.10.038. [DOI] [PubMed] [Google Scholar]
- 30.Forman BM, et al. 15-Deoxy-delta 12, 14-prostaglandin J2 is a ligand for the adipocyte determination factor PPAR gamma. Cell. 1995;83:803–812. doi: 10.1016/0092-8674(95)90193-0. [DOI] [PubMed] [Google Scholar]
- 31.Kliewer SA, et al. A prostaglandin J2 metabolite binds peroxisome proliferator-activated receptor gamma and promotes adipocyte differentiation. Cell. 1995;83:813–819. doi: 10.1016/0092-8674(95)90194-9. [DOI] [PubMed] [Google Scholar]
- 32.Penning TM, Sharp RB, Krieger NR. Purification and properties of 3 alpha-hydroxysteroid dehydrogenase from rat brain cytosol. Inhibition by nonsteroidal anti-inflammatory drugs and progestins. J Biol Chem. 1985;260:15266–15272. [PubMed] [Google Scholar]
- 33.Khanim FL, et al. Combined bezafibrate and medroxyprogesterone acetate: potential novel therapy for acute myeloid leukaemia. PLoS One. 2009;4:e8147. doi: 10.1371/journal.pone.0008147. doi: http://dx.doi.org/10.1371/journal.pone.0008147. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Desmond JC, et al. The aldo-keto reductase AKR1C3 is a novel suppressor of cell differentiation that provides a plausible target for the non-cyclooxygenase-dependent antineoplastic actions of nonsteroidal anti-inflammatory drugs. Cancer Res. 2003;63:505–512. [PubMed] [Google Scholar]
- 35.Wang S, Yang Q, Fung KM, Lin HK. AKR1C2 and AKR1C3 mediated prostaglandin D2 metabolism augments the PI3K/Akt proliferative signaling pathway in human prostate cancer cells. Mol Cell Endocrinol. 2008;289:60–66. doi: 10.1016/j.mce.2008.04.004. doi: http://dx.doi.org/10.1016/j.mce.2008.04.004. [DOI] [PubMed] [Google Scholar]
- 36.Battaglia S, et al. Elevated NCOR1 disrupts PPARalpha/gamma signaling in prostate cancer and forms a targetable epigenetic lesion. Carcinogenesis. 2010;31:1650–1660. doi: 10.1093/carcin/bgq086. doi: http://dx.doi.org/10.1093/carcin/bgq086. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Khanim FL, et al. Altered SMRT levels disrupt vitamin D3 receptor signalling in prostate cancer cells. Oncogene. 2004;23:6712–6725. doi: 10.1038/sj.onc.1207772. 10.1038/sj. onc.12077721207772 [pii] [DOI] [PubMed] [Google Scholar]
- 38.Lal A, et al. A public database for gene expression in human cancers. Cancer Res. 1999;59:5403–5407. [PubMed] [Google Scholar]
- 39.Zandbergen F, et al. The G0/G1 switch gene 2 is a novel PPAR target gene. Biochem J. 2005;392:324–331. doi: 10.1042/BJ20050636. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Matilainen M, Malinen M, Saavalainen K, Carlberg C. Regulation of multiple insulin-like growth factor binding protein genes by 1alpha,25-dihydroxyvitamin D3. Nucleic Acids Res. 2005;33:5521–5532. doi: 10.1093/nar/gki872. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Towsend K, et al. Identification of VDR-responsive gene signatures in breast cancer cells. Oncology. 2006;71:111–123. doi: 10.1159/000100989. 000100989 [pii]10.1159/000100989. [DOI] [PubMed] [Google Scholar]
- 42.Degenhardt T, Matilainen M, Herzig KH, Dunlop TW, Carlberg C. The insulin-like growth factor binding protein 1 gene is a primary target of peroxisome proliferator-activated receptors. J Biol Chem ( 2006 doi: 10.1074/jbc.M605623200. [DOI] [PubMed] [Google Scholar]
- 43.Chene G, et al. n-3 and n-6 polyunsaturated fatty acids induce the expression of COX-2 via PPARgamma activation in human keratinocyte HaCaT cells. Biochim Biophys Acta. 2007;1771:576–589. doi: 10.1016/j.bbalip.2007.02.014. S1388-1981(07) 00039-X [pii] 10.1016/j.bbalip.2007.02.014. [DOI] [PubMed] [Google Scholar]
- 44.Janabi N. Selective inhibition of cyclooxygenase-2 expression by 15-deoxy-delta(12,14)(12,14)-prostaglandin J(2) in activated human astrocytes, but not in human brain macrophages. J Immunol. 2002;168:4747–4755. doi: 10.4049/jimmunol.168.9.4747. [DOI] [PubMed] [Google Scholar]
- 45.Seuter S, Vaisanen S, Radmark O, Carlberg C, Steinhilber D. Functional characterization of vitamin D responding regions in the human 5-lipoxygenase gene. Biochim Biophys Acta. 2007 doi: 10.1016/j.bbalip.2007.04.007. [DOI] [PubMed] [Google Scholar]
- 46.Campbell MJ, Elstner E, Holden S, Uskokovic M, Koeffler HP. Inhibition of proliferation of prostate cancer cells by a 19-nor-hexafluoride vitamin D3 analogue involves the induction of p21waf1, p27kip1 and E-cadherin. J Mol Endocrinol. 1997;19:15–27. doi: 10.1677/jme.0.0190015. [DOI] [PubMed] [Google Scholar]
- 47.Qiu X, Xiao Y, Gordon A, Yakovlev A. Assessing stability of gene selection in microarray data analysis. BMC Bioinf. 2006;7:50. doi: 10.1186/1471-2105-7-50. 1471-2105-7-50 [pii] 10.1186/1471-2105-7-50. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Fung KM, et al. Increased expression of type 2 3alpha-hydroxysteroid dehydrogenase/type 5 17beta-hydroxysteroid dehydrogenase (AKR1C3) and its relationship with androgen receptor in prostate carcinoma. Endocrinol Relat Cancer. 2006;13:169–180. doi: 10.1677/erc.1.01048. [DOI] [PubMed] [Google Scholar]
- 49.Lovering AL, et al. Crystal structures of prostaglandin D(2) 11-ketoreductase (AKR1C3) in complex with the nonsteroidal anti-inflammatory drugs flufenamic acid and indomethacin. Cancer Res. 2004;64:1802–1810. doi: 10.1158/0008-5472.can-03-2847. [DOI] [PubMed] [Google Scholar]
- 50.Virtanen SS, Vaananen HK, Harkonen PL, Lakkakorpi PT. Alendronate inhibits invasion of PC-3 prostate cancer cells by affecting the mevalonate pathway. Cancer Res. 2002;62:2708–2714. [PubMed] [Google Scholar]
- 51.Jin R, et al. Activation of NF-kappa B signaling promotes growth of prostate cancer cells in bone. PLoS One. 2013;8:e60983. doi: 10.1371/journal.pone.0060983. doi: http://dx.doi.org/10.1371/journal.pone.0060983. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Jin R, et al. NF-kappaB gene signature predicts prostate cancer progression. Cancer Res. 2014;74:2763–2772. doi: 10.1158/0008-5472.CAN-13-2543. doi: http://dx.doi.org/10.1158/0008-5472.CAN-13-2543. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Chen CD, Sawyers CL. NF-kappa B. activates prostate-specific antigen expression and is upregulated in androgen-independent prostate cancer. Mol Cell Biol. 2002;22:2862–2870. doi: 10.1128/MCB.22.8.2862-2870.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Penning TM, Byrns MC. Steroid hormone transforming aldo-keto reductases and cancer. Ann NY Acad Sci. 2009;1155:33–42. doi: 10.1111/j.1749-6632.2009.03700.x. doi: http://dx.doi.org/10.1111/j.1749-6632.2009.03700.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Schulze JJ, Karypidis H, Ekstrom L. Basal and regulatory promoter studies of the AKR1C3 gene in relation to prostate cancer. Front Pharmacol. 2012;3(151) doi: 10.3389/fphar.2012.00151. doi: http://dx.doi.org/10.3389/fphar.2012.00151. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Chen M, et al. Crystal structures of AKR1C3 containing an N-(aryl) amino-benzoate inhibitor and a bifunctional AKR1C3 inhibitor and androgen receptor antagonist. Therapeutic leads for castrate resistant prostate cancer. Bioorg Med Chem Lett. 2012;22:3492–3497. doi: 10.1016/j.bmcl.2012.03.085. doi: http://dx.doi.org/10.1016/j.bmcl.2012.03.085. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Dozmorov MG, et al. Elevated AKR1C3 expression promotes prostate cancer cell survival and prostate cell-mediated endothelial cell tube formation: implications for prostate cancer progression. BMC Cancer. 2010;10:672. doi: 10.1186/1471-2407-10-672. doi: http://dx.doi.org/10.1186/1471-2407-10-672. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58.Wang S, Yang Q, Fung KM, Lin HK. AKR1C2 and AKR1C3 mediated prostaglandin D2 metabolism augments the PI3K/Akt proliferative signaling pathway in human prostate cancer cells. Mol Cell Endocrinol. 2008;289:60–66. doi: 10.1016/j.mce.2008.04.004. doi: http://dx.doi.org/10.1016/j.mce.2008.04.004. [DOI] [PubMed] [Google Scholar]
- 59.Fung KM, et al. Increased expression of type 2 3alpha-hydroxysteroid dehydrogenase/type 5 17beta-hydroxysteroid dehydrogenase (AKR1C3) and its relationship with androgen receptor in prostate carcinoma. Endocr-Relat Cancer. 2006;13:169–180. doi: 10.1677/erc.1.01048. doi: http://dx.doi.org/10.1677/erc.1.01048. [DOI] [PubMed] [Google Scholar]
- 60.Wu JS, et al. Ligand-activated peroxisome proliferator-activated receptor-gamma protects against ischemic cerebral infarction and neuronal apoptosis by 14-3-3 epsilon upregulation. Circulation. 2009;119:1124–1134. doi: 10.1161/CIRCULATIONAHA.108.812537. CIRCULATIONAHA.108.812537 [pii]10.1161/CIRCULATIONAHA.108.812537. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Girnun G. PPARG: a new independent marker for colorectal cancer survival. Gastroenterology. 2009;136:1157–1160. doi: 10.1053/j.gastro.2009.02.022. S0016-5085(09) 00202-9 [pii] 10.1053/j.gastro.2009.02.022. [DOI] [PubMed] [Google Scholar]
- 62.Bonofiglio D, et al. Peroxisome proliferator-activated receptor gamma activates fas ligand gene promoter inducing apoptosis in human breast cancer cells. Breast Cancer Res Treat. 2009;113:423–434. doi: 10.1007/s10549-008-9944-1. doi: http://dx.doi.org/10.1007/s10549-008-9944-1. [DOI] [PubMed] [Google Scholar]
- 63.Nagata D, et al. Peroxisome proliferator-activated receptor-gamma and growth inhibition by its ligands in prostate cancer. Cancer Detect Prev. 2008;32:259–266. doi: 10.1016/j.cdp.2008.05.008. S0361-090X(08) 00072-X [pii]10.1016/j.cdp.2008.05.008. [DOI] [PubMed] [Google Scholar]
- 64.Battaglia S, Maguire O, Campbell MJ. Transcription factor co-repressors in cancer biology: roles and targeting. Int J Cancer. 2010;126:2511–2519. doi: 10.1002/ijc.25181. doi: http://dx.doi.org/10.1002/ijc.25181. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65.Mantel A, et al. Aldo-keto reductase 1C3 is expressed in differentiated human epidermis, affects keratinocyte differentiation, and is upregulated in atopic dermatitis. J Invest Dermatol. 2012;132:1103–1110. doi: 10.1038/jid.2011.412. doi: http://dx.doi.org/10.1038/jid.2011.412. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 66.Straus DS, et al. 15-Deoxy-delta 12,14-prostaglandin J2 inhibits multiple steps in the NF-kappa B signaling pathway. Proc Natl Acad Sci U S A. 2000;97:4844–4849. doi: 10.1073/pnas.97.9.4844. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67.Grasso CS, et al. The mutational landscape of lethal castration-resistant prostate cancer. Nature. 2012;487:239–243. doi: 10.1038/nature11125. doi: http://dx.doi.org/10.1038/nature11125. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 68.Robinson D, et al. Integrative clinical genomics of advanced prostate cancer. Cell. 2015;161:1215–1228. doi: 10.1016/j.cell.2015.05.001. doi: http://dx.doi.org/10.1016/j.cell.2015.05.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 69.Prasad Keshava TS, et al. Human protein reference database-2009 update. Nucleic Acids Res. 2009;37:D767–D772. doi: 10.1093/nar/gkn892. doi: http://dx.doi.org/10.1093/nar/gkn892. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 70.Stelzl U, et al. A human protein–protein interaction network: a resource for annotating the proteome. Cell. 2005;122:957–968. doi: 10.1016/j.cell.2005.08.029. doi: http://dx.doi.org/10.1016/j.cell.2005.08.029. [DOI] [PubMed] [Google Scholar]
- 71.Yamada K, Printz RL, Osawa H, Granner DK. Human ZHX1: cloning, chromosomal location, and interaction with transcription factor NF-Y. Biochem Biophys Res Commun. 1999;261:614–621. doi: 10.1006/bbrc.1999.1087. doi: http://dx.doi.org/10.1006/bbrc.1999.1087. [DOI] [PubMed] [Google Scholar]
- 72.Kim SH, et al. Zinc-fingers and homeoboxes 1 (ZHX1) binds DNA methyltransferase (DNMT) 3B to enhance DNMT3B-mediated transcriptional repression. Biochem Biophys Res Commun. 2007;355:318–323. doi: 10.1016/j.bbrc.2007.01.187. doi: http://dx.doi.org/10.1016/j.bbrc.2007.01.187. [DOI] [PubMed] [Google Scholar]
- 73.Yamada K, Osawa H, Granner DK. Identification of proteins that interact with NF-YA. FEBS Lett. 1999;460:41–45. doi: 10.1016/s0014-5793(99)01311-3. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
