Skip to main content
PLOS One logoLink to PLOS One
. 2017 Apr 19;12(4):e0176098. doi: 10.1371/journal.pone.0176098

Comparative analysis of the expression level of recombinant ginsenoside-transforming β-glucosidase in GRAS hosts and mass production of the ginsenoside Rh2-Mix

Muhammad Zubair Siddiqi 1,2, Chang-Hao Cui 3, Seul-Ki Park 3, Nam Soo Han 4, Sun-Chang Kim 3, Wan-Taek Im 1,2,*
Editor: Hua Zhou5
PMCID: PMC5396970  PMID: 28423055

Abstract

The ginsenoside Rh2, a pharmaceutically active component of ginseng, is known to have anticancer and antitumor effects. However, white ginseng and red ginseng have extremely low concentrations of Rh2 or Rh2-Mix [20(S)-Rh2, 20(R)-Rh2, Rk2, and Rh3]. To enhance the production of food-grade ginsenoside Rh2, an edible enzymatic bioconversion technique was developed adopting GRAS host strains. A β-glucosidase (BglPm), which has ginsenoside conversion ability, was expressed in three GRAS host strains (Corynebacterium glutamicum, Saccharomyces cerevisiae and Lactococus lactis) by using a different vector system. Enzyme activity in these three GRAS hosts were 75.4%, 11.5%, and 9.3%, respectively, compared to that in the E. coli pGEX 4T-1 expression system. The highly expressed BglPm_C in C. glutamicum can effectively transform the ginsenoside Rg3-Mix [20(S)-Rg3, 20(R)-Rg3, Rk1, Rg5] to Rh2-Mix [20(S)-Rh2, 20(R)-Rh2, Rk2, Rh3] using a scaled-up biotransformation reaction, which was performed in a 10-L jar fermenter at pH 6.5/7.0 and 37°C for 24 h. To our knowledge, this is the first report in which 50 g of PPD-Mix (Rb1, Rb2, Rb3, Rc, and Rd) as a starting substrate was converted to ginsenoside Rg3-Mix by acid heat treatment and then 24.5-g Rh2-Mix was obtained by enzymatic transformation of Rg3-Mix through by BglPm_C. Utilization of this enzymatic method adopting a GRAS host could be usefully exploited in the preparation of ginsenoside Rh2-Mix in cosmetics, functional food, and pharmaceutical industries, thereby replacing the E. coli expression system.

Introduction

The ginseng (Panax ginseng C.A. Meyer) is a famous herbal medicinal plant, which is broadly circulated in Asian and Western countries and used for millions of years for the cure of human diseases [1]. For the last decades, especially, red ginseng is used as a common tonic for its high pharmacological activities. The biological and pharmacological active components of P. ginseng are commonly known as ginsenosides (major ginsenosides), a class of triterpene glycosides [24].

The major ginsenosides, PPD-type [protopanaxadiol type (Rb1, Rb2, Rb3, Rc and Rd)] and PPT-type [protopanaxatriol type (Re, and Rg1)] are present more than 90% of all ginsenosides, in the ginseng constitute [2, 5]. But, due to its high molecular weight the absorption of these major ginsenosides are very difficult through by the human digestive tract system [6, 7]. Therefore, these major ginsenosides are converted into minor ginsenosides by using of various methods including physical (heat treatment), chemical (acid or base treatment) and biological (microorganisms or enzymes) transformation. The minor ginsenosides (including, F1, F2, Rg2, Rg3, Rh1, Rh2 and C-k) which are the de-glycosylated byproducts from major ginsenosides are present in smaller amounts in the ginseng extract or powder. These minor ginsenosides show high pharmacological effects for anticancer, anti-allergy, anti-inflammatory, antitumor, antidiabetic, and anti-osteoporosis effects [810] than major ginsenosides.

In particular, the minor ginsenoside Rh2 can inhibit the growth of many kinds of cancer cells, including breast cancer, prostate cancer, hepatoma, gastric cancer, colon carcinoma, and pancreatic cancer; moreover, pre-clinical assessment of Rh2 in the PC-3 human xenograft model for prostate cancer in vivo has also been shown to be effective [1117]. In addition, Rh2 also inhibits osteoclastogenesis [18], induces the differentiation and mineralization of osteoblastic MC3T3-E1 cells through activation of PKD and p38 MAPK pathways [19], improves learning and memory [20], reduces cell proliferation, and increases sub-G1 cells [21]. Furthermore, ginsenoside Rh2 improves the scopolamine-induced learning deficiency in mice [22],increases secretion of insulin and lowers plasma glucose in Wistar rats [23], has an antiobesity effect related to the activation of adenosine monophosphate (AMP)-activated protein kinase (AMPK) signaling pathway in 3T3-L1 adipocytes [24], and dose-dependently decreases the acanthosis and papillomatosis index, T lymphocyte percentage, and vessel density in PN skin grafts in mice [25].

The total amount of minor ginsenosides is much less in ginseng extract/powder; researchers are therefore interested in scaling up the production of minor ginsenosides for commercial use in both herbal medicine and food supplementary products. In the early stages of this research, Bae et al. studied the conversion of ginsenosides in the human gastrointestinal tract by gut microorganisms [26]. Thereafter, a highly active recombinant glycoside hydrolase belonging to family I and family III was introduced for the conversion of major ginsenosides into minor ginsenosides for their pharmacological and cosmetic applications [2732].

Initially, this ginsenoside-transforming glycoside hydrolase was mostly expressed in Escherichia coli and no researchers had yet studied the expression of the β-glycoside hydrolyzing gene in a GRAS (generally recognized as safe) host strain for the purpose of converting major ginsenosides into minor ginsenosides for mass production. Recently, Li et al. performed the conversion of major ginsenosides into minor ginsenosides using an expression system of Lactococcus lactis. The GRAS host organisms are non-pathogenic and recommended as food safe [33]. Compared to pathogenic strains, expression of the ginsenoside-transforming β-glucosidase in these GRAS strains is advantageous and of considerable interest for the commercial production of pharmacologically active minor ginsenosides and food supplements (i.e., industrial demand).

In the present study, the expression levels of recombinant ginsenoside-transforming β-glucosidase, from Paenibacillus mucilaginosus [27], were compared between GRAS hosts strains and E. coli. After remarkable successes with GRAS host expression (Corynebacterium glutamicum, Saccharomyces cerevisiae, and Lactoccocus lactis), the 24.5 g scale-up production of Rh2-Mix [20(S)-Rh2, 20(R)-Rh2, Rk2, Rh3] was performed from Rg3-Mix [20(S)-Rg3, 20(R)-Rg3, Rk1, Rg5] using the highly expressed enzymes in C. glutamicum. To our knowledge, this is the first report of scale-up production of high-value Rh2-Mix, using combined methods of acid treatment and food-grade recombinant enzymes expressed in GRAS host strain C. glutamicum. The results of this study would likely broaden the application of ginsenoside Rh2 and Rh2-Mix in the cosmetic, functional food, and pharmaceutical industries, thereby replacing the E. coli expression system.

2. Materials and methods

2.1. Materials

Ginsenosides standards, Rb1, Rc, Rb2, Rd, 20(S)-Rg3, 20(R)-Rg3, 20(S)-Rh2, F2 and C-K, were bought from Nanjing Zelang Medical Technology Co., Ltd. (China), while ginsenosides 20(R)-Rh2, Rk1, Rg5, Rk2 and Rh3 were purchased from Chengdu Biopurify Phytochemicals Co., Ltd. (China). The PPD-Mix type ginsenosides mixture from the root of Panax quinquefolius [American root saponins, mainly contained Rb1 (328 mg/g), Rc (173 mg/g), Rd (107 mg/g) and small amounts of Rb2 (25 mg/g) and Rb3 (25 mg/g)] acquired from Hongjiou Biotech Co. Ltd. (China) was used as the initial substrate in the current investigation. The genomic DNA from Paenibacillus mucilaginosus KCTC 3870T, E. coli, and pGEX 4T-1 plasmid (GE Healthcare, USA) were used for the β-glucosidase gene, host, and expression vector sources, respectively. P. mucilaginosus KCTC 3870T was grown in aerobic conditions at 37°C on nutrient agar (NA, BD, USA). The recombinant E. coli for protein expression was cultivated in a Luria-Bertani (LB) medium supplemented with ampicillin (100 mg/l). C. glutamicum and the pCES208 plasmid, S. cerevisiae and pYES 2.1 plasmid, L. lactis strain NZ9000 and PNZ8148 plasmid (MoBiTec GmbH, Germany) were used as host, and expression vector sources, respectively (Table 1).

Table 1. Bacterial strains and plasmids used in this study.

Hosts Relevant genotype or description Sources or references
BL21 (DE3) fhuA2 [lon] ompT gal (λ DE3) [dcm] ΔhsdS λ DE3 = λ sBamHIo ΔEcoRI-B int::(lacI::PlacUV5::T7 gene1) i21 Δnin NEB strain catalog no. C2527
BL21(DE3) harboring pGEX-BglPm Cloned with glucoside hydrolyzed (BglPm) gene for ginsenosides transformation [27]
C. glutamicum ATCC 13032 Biotin-auxotrophic wild type ATCC
C. glutamicum WJ001 ATCC 13032, cloning host for ginsenosides transformation This study
S. cerevisiae CEN.PK113-5D MATa ura3-52 MAL2-8c SUC2 [37, 38]
S. cerevisiae CEN.PK113-5D Cloning host for ginsenosides transformation This study
L. lactis pNZ8148 Cloning host for ginsenosides transformation MoBiTec
Plasmids
pGEX-BglPm Harboring β-glucosidase (BglPm) gene [27]
pCES208 E. coli/C. glutamicum shuttle vector, 5.93 kb; KanR [39]
pCES208 Expression vector for His-tag fusion in C. glutamicum ATCC 13032 with β-glucosidase (BglPm) gene; KanR This study
pYES2 ApR URA3 GALp Invitrogen Corporation
pYES2.1 pYES2.1 TOPO® TA vector [40]
pYES2.1 Expression vector for BglPm gene in S. cerevisiae 1389 This study
pNZ8148 Broad-host-range vector; CmR, PnisA MoBiTec
pNZ8148 Expression vector for BglPm gene in L. lactis This study

CECT, Coleccioèn Espanìola de Cultivos Tipo; YGSC, Yeast Genetic Stock Center, Berkeley, CA, USA.

KanR, kanamycin resistance

CmR, chloroampinicol resistance

2.2. Rg3-Mix preparation as substrate

The ginsenosides Rg3-Mix [20(S)-Rg3 (118.6 mg/g), 20(R)-Rg3 (108.8 mg/g), Rk1 (144.9 mg/g), and Rg5 (170.5 mg/g)] was prepared from PPD-Mix using heat treatment with organic acid. The PPD-Mix was dissolved in distilled water at a concentration of 50 g/l and included citric acid (2%, w/v) and heat-treated (121°C for 15 min). After the reaction, resultant Rg3-Mix was used as the substrate for the subsequent enzyme reaction.

2.3. Molecular cloning, expression, and purification of recombinant BglPm in GRAS

The genomic DNA from Paenibacillus mucilaginosus KCTC 3870T was extracted using a genomic DNA extraction kit (Solgent, Korea). The gene encoding β-glucosidase (BglPm) [27], which has ginsenoside-transforming activity, was amplified from the genomic DNA as a template via a polymerase chain reaction (PCR) using Pfu DNA polymerase (Solgent, Korea). The sequence of the oligonucleotide primers used for the gene cloning was based on the DNA sequence of BglPm (β-glucosidase; GenBank accession number: AEI42200). Four sets of primers (Table 2) were designed and synthesized by Macrogen Co. Ltd. (Korea) to amplify the gene of BglPm for E. coli and three kinds of GRAS strains. The amplified DNA fragment obtained from the PCR was purified and inserted into the pGEX 4T-1 GST fusion vector, pYES2.1 His-tag combined vector, pCES208 Histag combined vector, and pNZ8148 vector, respectively, using an EzCloning Kit (Enzynomics Co. Ltd., Korea). The resulting recombinant pGEX-BglPm, pYES2.1-BglPm, pCES208-BglPm, and pNZ8148-BglPm were transformed into E. coli BL21 (DE3), C. glutamicum, S. cerevisiae, and L. lactis strain, respectively. The bacterial strains and plasmids used in this study, their relevant characteristics, and their sources or references are given in Table 1.

Table 2. Primers used in this study (sequences 5′→3′).

Function and primer Sequence
GST-pGEX 4T-1 fusion construction
pGEX 4T-1-F
pGEX 4T-1-R
G GTT CCG CGT GGA TCC GAA TAT ATT TTT CCA CAG CAA TTT GATG CGG CCG CTC GAG TTA CAG CAC TTT CGT GGA TGC GAT
His tag- pCES208 and pYES2.1 fusion construction
pCES208-F
pCES208-R
pYES2.1-F
pYES2.1-R
GACTAGAGTCGGATCC ATG GAATATATTTTTCCACAG
CCGCGGTGGCGGCCGC TTA CAGCACTTTCGTGGATGC
TATTAAGCTCGCCCTTATGGAATATATTTTTCCACAGCAATTT
CTCGAAGCTCGCCCTTTTACAGCACTTTCGTGGATGC
β-glucosidase fusion construction
pNZ8148-F
pNZ8148-R
GCAGGCATGCGGTACCATG GAATATATTTTTCCACAG
GCTTGAGCTCTCTAGATTA CAGCACTTTCGTGGATGC

2.4. Comparison of expressed enzyme activity in GRAS host

The E. coli strain BL21, and the three GRAS hosts strains were constructed with different vector systems —pGEX 4T-1, pCES208, pYES 2.1 and pNZ8148, respectively. To determine the levels of expression and the amount of soluble protein, the induction of expression of recombinant E. coli and three GRAS hosts studied was performed. The recombinant E. coli was cultivated in LBA (Luria-Bertani with ampicillin [100 mg/l final concentration]) and induced by 0.15 mM IPTG at 28°C. Similarly, C. glutamicum, S. Cerevisiae, and L. lactis were cultivated in LBK (Luria-Bertani with kanamycin [50 mg/l final concentration] induced by glucose [10 g/l final]), YPD (galactose inducible [18 g/l final concentration]), and GM–17 [glucose 10 g/l and induced by nisin, 10 μl/l final concentration)] at 30°C, respectively. After maximum growth of recombinant strains in the mentioned media, the cells were collected and sonicated for comparative analysis of their enzyme activity.

2.4.1. Effect of sonication on enzyme activity of both recombinant E. coli and GRAS hosts

After the exponential growth of the strains in the particular media as stated above, cells were harvested by centrifugation and pellets were washed twice with a solution consisting of 100 mM sodium phosphate buffer and 1% Triton X-100 (pH 7.0); cells were then resuspended to a concentration of 1 g/10 mL in cold lysis buffer (100 mM sodium phosphate buffer [pH 7.0]). The crude cell extracts were obtained by sonication of the cell pellets using Branson digital sonifier 450 (400 W, 70% power, USA). Total sonication time was 20 and 30 min for E. coli and GRAS hosts strains respectively. After each 2 and 5 min interval, cell lysates were collected in a 1.5 ml tube in order to check enzyme activity and the effect of sonication with time intervals.

2.4.2. Comparison of crude enzymes activities of GRAS host strains with recombinant E. coli

The activity of crude recombinant β-glucosidase was determined using 5 mM pNPGlc (p-nitrophenyl-β-D-glucopyranoside) as substrate. Crude enzyme (20 μL) was incubated in 100 μL of 50 mM sodium phosphate buffer (pH7.0) containing 5 mM PNPGlc at 37°C, then the reaction was stopped by 0.5 M (final concentration) Na2CO3 and the release of p-nitrophenol was measured immediately using a microplate reader at 405 nm (Bio-Rad Model 680; Bio-Rad, Hercules, CA). One unit of activity was defined as the amount of protein required to generate 1 μmol of p-nitrophenol per minute. Specific activity was expressed as units per milligram of protein. Protein concentrations were determined using the bicinchoninic acid (BCA) protein assay (Pierce, Rockford, IL), with bovine serum albumin (Sigma Aldrich, USA) as the standard. All assays were performed in triplicate. In comparative analysis of the GRAS host strains, the strain, which showed high enzymatic activity COMPARED with recombinant E. coli was selected for further experiments.

2.4.3. Electrophoresis

SDS-PAGE analysis was performed using a 10% acrylamide-bis-acrylamide gel (37.5:1 [Qbiogene]). The culture samples were prepared by mixing dye with the samples (3:1) of each cell suspension. The solutions were mixed well and heated for 5 min at 100°C. Similarly, in each lane of the gel 15 μL of dye-sample mixture was loaded and electrophoresis was performed in SDS-Tris-Glycine buffer at a constant voltage until the dye front reached the bottom of the gel. The protein bands were stained with Coomassie brilliant Blue Ez stain (AQua), and de-stained in distilled water. After de-staining, the results of the GRAS host strains were compared with those of the recombinant E. coli. Based on the comparative analysis of GRAS hosts with recombinant E. coli strain, the highly expressed β-glucosidase enzyme of C. glutamicum was selected for biotransformation of the ginsenoside Rg3-Mix.

2.5. Biotransformation activity of Rg3-Mix using BglPm_C from C. glutamicum

To check the effect of fusion His tag on the activity of BglPm_C, the initial transformation of Rb1 and 20(S)-Rg3 show that the His tag-fused enzyme does not affect the activity of BglPm_C for conversion of ginsenosides Rb1 and 20(S)-Rg3 into F2 and 20(S)-Rh2, respectively (data not shown). Therefore, the His tag fusion protein (BglPm_C) was used for the hydrolysis of the glucose moieties attached at the C-3 sites in the Rg3-Mix [20(S)-Rg3, 20(R)-Rg3, Rk1, Rg5]. The enzyme (20 mg/ml) was reacted with Rg3-Mix solution at a concentration of 5% (w/v, wet base) in 100 mM of sodium phosphate buffer (pH 7.0) at 37°C. The samples were taken at regular intervals of time and analyzed via thin layer chromatography (TLC) or high performance liquid chromatography (HPLC) after pretreatment (see section 2.7).

2.6. Scaled-up biotransformation of Rg3-Mix into Rh2-Mix

2.6.1. Preparation of recombinant enzyme (BglPm_C) of C. glutamicum using high cell density culture

For fed-batch cultivation and obtaining high cell density of the recombinant BglPm_C, the LB medium supplemented with kanamycin (50 mg/l final) was used to cultivate the C. glutamicum harboring pCES208 in a 10 L stirred-tank reactor (Biotron GX, Hanil Science Co., Korea) with a 6-L working volume at 400 rpm. Using 100 mM sodium phosphate buffer the pH value of the medium was adjusted to 7.0. The culture was incubated at 30°C for 24 h and the protein expression was induced through the addition of glucose with a final concentration of 10 g/l. After cell density reached an OD of 40–42 at 600 nm, the cells were harvested via centrifugation at 8,000 rpm for 20 min. The pellets (50 g) were resuspended in 100 mM of sodium phosphate buffer (pH 7.0); then the cells were broken via sonication (Branson Digital Sonifier, Mexico), and the time was adjusted according to the method described in section 2.4.1. In order to get the crude soluble enzyme fraction for the conversion of ginsenosides, the unwanted cells debris was removed via centrifugation at 5,000 rpm for 10 min at 4°C. For the enzymatic biotransformation of ginsenoside Rg3-Mix, the crude recombinant BglPm_C was diluted to the desired concentration with 100 mM sodium phosphate buffer (pH 7.0) and was for the conversion of ginsenoside Rg3-Mix.

2.6.2. Production of Rh2-Mix from Rg3-Mix using BglPm_C

For the mass production of ginsenoside Rh2-Mix, the reaction mixture was performed in a 10-L stirred-tank reactor (Biotron GX, Hanil Science Co.) with a 3-L of working volume. The reaction mixture was started with a composition of 50 mg/ml (final concentration) of substrate ginsenosides (Rg3-Mix; total 150 g, wet base) and 20 mg/ml of crude recombinant BglPm_C in 0.1 M of sodium phosphate buffer (pH 6.5–7.0). The reaction was completed under its optimal conditions of pH 6.5 with 300 rpm for 24 h. After 24 h, the ginsenoside Rg3-Mix was completely converted to the Rh2-Mix. Samples were collected at regular intervals and were analyzed by high performance liquid chromatography (HPLC) in order to determine the time course of the biotransformation of ginsenoside Rg3-Mix to Rh2-Mix.

2.7. Analytic methods

2.7.1. TLC analysis

The ginsenosides spots on the TLC plates [60F254 silica gel plates (Merck, Germany)] were identified and visualize through comparisons with ginsenosides standard using CHCl3-CH3OH-H2O (65:35:10, lower phase) as TLC solvent and 10% (v/v) H2SO4 as a spraying reagent for spots visualization followed by heating of 110°C for 5–10 min.

2.7.2. HPLC analysis

The ginsenosides PPD-Mix, Rg3-Mix, Rh2-Mix (by BglPm_C) and ginsenoside standards with a final concentration of 1 mg/ml were dissolved in HPLC grade methanol and analysed by HPLC (Younglin Co. Ltd, Korea). The ginsenosides separation was performed on a Prodigy ODS (2) C18 column (5 μm, 150 × 4.6 mm i.d.; Phenomenex, USA) with a guard column (Eclipse XDB C18, 5 μm, 12.5 × 4.6 mm i.d.). The mobile phases were water (line B) and acetonitrile (line C). The gradient elution started with 68% of solvent B and 32% of solvent C; the flow rate was 1.0 ml/min and detection was performed by monitoring the absorbance at 203 nm with an injected volume of 25 μl for 28 min.

3. Results and discussion

3.1. Cloning, expression and comparison of recombinant BglPm in different GRAS host strains

The β-glucosidase gene consists of 1,260 bp and encodes 419 amino acids, with 46 kDa M.wt, which have homology to the protein domain of the glycoside hydrolase family 1. The gene (β-glucosidase) was amplified via PCR and then inserted into the pGEX 4T-1, pYES2.1, pCES208 and pNZ8148 vectors respectively. The predictive molecular masses and expression level of the recombinant BglPm were also determined by SDS-PAGE, and the protein expression of the GRAS host strains were compared with the recombinant E. coli system (Fig 1A and 1B). The molecular masses of the native β-glucosidase were calculated via an amino acid sequence and fusion tag protein found to be 72 (46+26), 47 (46+1), 47 (46+1), and 46 kDa (Table 3), as expressed by E. coli, C. glutamicum, S. cerevisiae, and L. lactis, respectively. The GST-BglPm and His-tag-BglPm were purified using the GST and His-tag bind resin column (Elpis Biotech). After purification of cell lysates, non-induced, induced, and purified protein soluble fractions were analyzed by SDS-PAGE and the prominent protein bands, with an apparent molecular weight near 72, 47, 47 and 46 kDa, were identified in three GRAS host strains and recombinant E. coli lysates. In the comparative study of SDS-PAGE assay of GRAS host strains with E. coli (Fig 1A, lane 3,4) it was clearly shown that the expected protein bands were more visible and well expressed in the soluble fraction in C. glutamicum (Fig 1A, lane 6,7) than in S. cerevisiae and L. lactis (Fig 1B, lane 11–12 and 13–14).

Fig 1. (A and B). SDS-PAGE analysis of recombinant E. coli and GRAS host strains.

Fig 1

A: Lane 1, molecular weight standard; lane 2, soluble crude extract of recombinant E. coli without induction; lane 3, BglPm of recombinant E. coli after induction; lane 4, purified soluble fraction of recombinant E. coli (BglPm); lane 5, non-inducible fraction of Corynebacterium glutamicum harboring pCES208; lane 6, inducible BglPm_C; lane 7, purified BglPm_C (C. glutamicum); lane 8, molecular weight standard. B: lane 9, molecular weight standard; lane 10, non-inducible fraction of Saccharomyces cerevisiae; lane, 11 inducible BglPm_S; lane 12, BglPm_S protein of S. cerevisiae after purification; lane, 13–14, non-inducible and inducible fraction of Lactococcus lactis; lane 15, molecular weight standard.

Table 3. Total activities of β-glucosidase in cell-free extracts of induced E. coli and GRAS host strains which were constructed with different vectors, and induced by different promoters used in this study.

The GRAS strain, which was well-expressed and showed high enzyme activity with recombinant E. coli, is indicated in bold.

Hosts Media Vectors Inducers Fusion tags M.wt of fusion tag protein/ recombinant protein (kDa) Name of recombinant enzyme Enzymes activity Specific activity (U/mg)* Relative express enzymes activities
E. coli LBA PGEX4T-1 IPTG GST 26/46 BglPm 0.2619 10.22 ± 0.62 100
C. glutamicum LBK pCES208 Glucose His tag 1/46 BglPm_C 0.1976 12.54 ± 0.51 75.4
S. cerevisiae YPD pYES2.1 Galactose His tag 1/46 BglPm_S 0.03 12.92 ± 0.13 11.5
Lactococcus lactis M-17 pNZ8148 Nisin –/46 BglPm_L 0.0244 ND 9.3

*One unit of activity was defined as the amount of protein required to generate 1 mmol of p-nitrophenol per min. Enzymes were purified ones.

Abbreviation; LBA (Luria-Bertani with ampicillin); LBK (Luria-Bertani with Kanamycin); YPD (Yeast+ peptone and dextrose); ND (not determined)

3.2. Effect of sonication on enzymes activities

Cell suspensions of recombinant E. coli and GRAS hosts were sonicated for different periods, ranging from 2 to 30 min, in 50-ml tubes. After the sonication, the cell lysates were separated into soluble and particulate fractions by centrifugation and each soluble fraction was assayed for its enzyme activity. During the investigation of enzymes activities of the GRAS host and recombinant E. coli, which were reacted with 5 mM pNPG, the maximum enzyme activity was obtained by recombinant E. coli after a 10 min period of sonication; further sonication caused loss of enzyme activity (Fig 2a). Comparable results were obtained from GRAS hosts, which showed optimum enzyme activity at 20, 25 and 15 min for C. glutamicum pCES208 (Fig 2b), S. cerevisiae pYES2.1 (Fig 2c), and L. lactis pNZ8148, respectively (Fig 2d). Collectively, these results suggest that the maximum enzyme activity of the GRAS host strains were compared with recombinant E. coli. On the basis of data presented here, we found that BglPm_C expressed by C. glutamicum had an enzyme activity of 75.4% COMPARED with recombinant BglPm expressed by E. coli (as compared to BglPm_S [11.5%] and BglPm_L [9.3%]), as shown in Table 3. We therefore selected highly expressed β-glucosidase (BglPm_C) by C. glutamicum for the mass production of edible Rh2-Mix ginsenosides from Rg3-Mix.

Fig 2. (a, b, c and d) shows the effect of sonication on the enzyme activity of; recombinant BglPm (E. coli), BglPm_C (C. glutamicum), BglPm_S (S. cerevisiae) and BglPm_L (Lactococcus lactis), respectively.

Fig 2

From the sonication analysis, these results clearly show that enzymes lose their activities after a specific time interval for all recombinant enzymes used in this study.

3.3. Biotransformation of Rg3-Mix to Rh2-Mix

To verify the bioconversion of Rg3-Mix by BglPm_C expressed by C. glutamicum harboring pCES208, TLC and HPLC analyses were carried out at regular intervals. TLC analysis show that BglPm_C completely transformed ginsenosides Rg3-Mix into Rh2-Mix, as shown in Fig 3A and 3B. The Rf values of ginsenoside Rk1 and Rg5 was a little above the 20(S)-Rg3 and 20(R)-Rg3 position as shown in Fig 3A. Rh2-Mix, which has one glucose moiety removed at the C20 position of Rg3-Mix, was placed in the upper position of control S (Rg3-Mix), as shown in the middle position of Fig 3B.

Fig 3. TLC analyses of time course of ginsenosides by acid and enzyme (BglPm_C) treatment.

Fig 3

(A) Transformation of ginsenoside PPD-Mix. (B) Biotransformation of Rg3-Mix to Rh2-Mix after 24 h. Developing solvent: CHCl3-CH3OH-H2O (65:35:10, lower phase). Lane S represents PPD-Mix (A) and Rg3-Mix (B). PPD, protopanaxadiol.

3.4. Preparation of BglPm_C and scaled-up production of Rh2-Mix as a gram unit

The C. glutamicum cells that harbor pCES208 were further incubated for 24 h at 30°C and induced by the addition of 10 g/l of glucose. After induction, when the culture reached an OD of 40–42 at 600 nm the cells were harvested via centrifugation. 100 g of wet cells were harvested and resusupended (50 g/500 ml [w/v]) in 0.1 M of phosphate buffer (pH 7.0) (w/v). The cells were broken via ultrasonication and the supernatant was used as crude enzymes for the biotransformation of the ginsenoside Rg3-Mix. The crude recombinant BglPm_C (soluble form) was applied to the biotransformation reactor. The enzyme reaction was induced using the crude recombinant BglPm_C, which was adjusted to a final concentration of 20 mg/ml in a 3-L tank, to produce the Rh2-Mix. The ginsenoside Rg3-Mix [20(S)-Rg3, 20(R)-Rg3, Rk1, and Rg5] was completely converted to Rh2-Mix [20(S)-Rh2, 20(R)-Rh2, Rk2, and Rh3]. After 24 h, the results were confirmed by HPLC analysis; all the ginsenosides (PPD-Mix, Rg3-Mix, and Rh2-Mix) were compared with the ginsenosides standards that were used in this study, as shown in Fig 4A. The PPD-Mix type ginsenoside (Fig 4B) was used as the initial substrate. For the enzymatic reaction, the PPD-Mix was transformed to the Rg3-Mix by acid treatment as shown in Fig 4C. Lastly, after 24 h, the Rh2-Mix [20(S)-Rh2, 20(R)-Rh2, Rk2 and Rh3] was produced as a final product from the bioconversion of Rg3-Mix using the BglPm_C enzyme of C. glutamicum (Fig 4D). The HPLC analysis revealed that the BglPm_C completely hydrolyzed the Rg3-Mix within 24 h.

Fig 4. HPLC analysis of the transformation of the ginsenosides (PPD-Mix and Rg3-Mix) by acid and enzyme treatments.

Fig 4

(A) Ginsenosides standard. (B) PPD-Mix as a starting substrate. (C) Rg3-Mix after 15 min at 121°C by acid treatment of PPD-Mix. (D) Rh2-Mix after 24 h of the reaction of BglPm_C with Rg3-Mix. PPD-Mix, protopanaxadiol-type ginsenoside mixture (Rb1, Rb2, Rb3, Rc and Rd).

In order to remove the unwanted substances, the reaction mixture was centrifuged at 8,000 rpm for 10 min. Most of the ginsenoside Rh2-Mix precipitated to form a solid, with a small quantity remaining dissolved in the supernatant (data not shown). Three liters of a 95% ethanol solution was used, twice, to dissolve the precipitated ginsenosides Rh2-Mix thoroughly. The ginsenosides Rh2-Mix in the supernatant was evaporated in vacuo in order to create 24.5 g of powdered Rh2-Mix [20(S)-Rh2 (116.6 mg/g), 20(R)-Rh2 (107.2 mg/g), Rk2 (143.1 mg/g) and Rh3 (165.0 mg/g)]. Finally, in terms of yield, 24.5 g of Rh2-Mix was obtained via the conversion of 50 g of PPD-Mix as the initial substrate S1 Fig.

In oriental herbal medicine, red ginseng is a very popular health-promoting food but contains approximately less than 0.02% Rh2 or Rh2-Mix based on dry weight. Although Rh2 has anti-cancer effect for breast cancer, prostate cancer, hepatoma, gastric cancer, colon carcinoma, and learning and memory effects, the lack of a selective mass-production technology has hindered its commercial uses. To get a scaled up production of Rh2-Mix, a number of researchers sought to achieve biotransformation of major ginsenosides to minor ginsenosides using microorganisms [34] and recombinant enzymes in laboratory settings [35, 36, 41]. Ko et al [36] were only able to obtain a 10 mg scale of Rg2(S) and Rh1(S) from the bioconversion of PPT-type ginsenosides using crude β-galactosidase from Aspergillus oryzae and crude lactase from Penicillium sp. Similarly, Juan et al. produced ginsenoside Rg2(S) as a 100-gram unit using recombinant β-glucosidase from Pseudonocardia sp. Gsoil 1536 [30]. Despite the use of recombinant enzymes, no study has yet focused on the mass production of minor ginsenosides using edible enzymes from GRAS host strains.

In this study, we describe a brief comparison between GRAS host strains and recombinant E. coli and the effect of sonication on enzyme activity of GRAS hosts and E. coli. Furthermore, we found a BglPm_C, comparable to E. coli, from C. glutamicum, which is capable of the biotransformation of Rg3-Mix and is therefore expected to facilitate the mass production of Rh2-Mix. The BglPm_C shows a very specific ginsenoside hydrolysis activity via the following pathways: 20(S)-Rg3→20(S)-Rh2, 20(R)-Rg3→20(R)-Rh2 and ginsenoside Rk1→RK2 and Rg5→Rh3 as shown in Fig 5. This unique bioconversion ability, together with optimum reaction conditions (30°C and pH 6.5/7.0) [27], makes it possible to produce 24.5 gram-scale Rh2-Mix. Here, we report for the first time that the BglPm_C expressed by one of GRAS hosts (C. glutamicum) can be used to make up to 50 mg/ml of PPD-Mix to 24.5 gram-scale Rh2-Mix within 24 h. This combined treatment of acid and the use of the recombinant enzyme BglPm_C expressed in C. glutamicum enable the usage of ginsenoside Rh2 and Rh2-Mix derived from Panax quinquefolius (American ginseng) or Panax ginseng Meyer (Korean ginseng) in the cosmetics, functional food, and pharmaceutical industries by replacing the E. coli expression system.

Fig 5. Schematic view of transformation pathways for Rh2-Mix production and the relative structures of ginsenosides.

Fig 5

Conclusion

Upon choosing appropriate experimental organisms for β-glucosidase gene expression, we found alternative systems using food grade bacteria for the expression of β-glucosidase gene rather than recombinant E. coli. By means of BglPm_C, 24.5 g of ginsenoside Rh2-Mix was achieved via biotransformation of 50 g of PPD-Mix initial substrate consisting of ginsenosides Rb1, Rb2, Rb3, Rc, and Rd. The bioconversion reaction was started in a 10 L jar fermenter at pH 6.5 and 30°C for 24 h, with a substrate concentration of 50 mg (Rg3-Mix, wet base). This combinational usage of edible organic acid treatment of PPD-Mix to Rg3-Mix and enzymatic transformation of Rg3-Mix to Rh2-Mix offers an efficient method for the preparation of minor ginsenoside Rh2-Mix on a large scale to meet industrial needs.

Supporting information

S1 Fig. Entire process of Rh2-Mix production from PPD-Mix (protopanaxadiol-type ginsenoside) as starting substrate using combined method of acid heat treatment and enzyme treatment (BglPm_C).

(TIF)

Data Availability

All relevant data are within the paper and its Supporting Information file.

Funding Statement

This work was supported by the Intelligent Synthetic Biology Center of Global Frontier Project funded by the Ministry of Education, Science and Technology (2014M3A6A8066437) and by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (2015R1D1A1A01060255).

References

  • 1.Sengupta S, Toh SA, Sellers LA, Skepper JN, Koolwijk P, Leung HW, et al. Modulating angiogenesis: The yin and the yang in ginseng. Circulation 2004; 110(10):1219–1225. 10.1161/01.CIR.0000140676.88412.CF [DOI] [PubMed] [Google Scholar]
  • 2.Attele AS, Wu JA, Yuan CS. Ginseng pharmacology: Multiple constituents and multiple actions. Biol Pharm Bull. 1999;58(11):1685–1693. [DOI] [PubMed] [Google Scholar]
  • 3.Yuan CS, Wu JA, Osinski J. Ginsenoside variability in American ginseng samples. Am J Clin Nutr. 2002;75(3):600–601. 10.1016/S0006-2952(99)00212-9 [DOI] [PubMed] [Google Scholar]
  • 4.Lee CH, Kim JH. A review on the medicinal potentials of ginseng and ginsenosides on cardiovascular diseases. J Ginseng Res. 2014;38(3):161–166. 10.1016/j.jgr.2014.03.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Christensen LP. (2009). Ginsenosides chemistry, biosynthesis, analysis, and potential health effects. Adv Food Nutr Res. 2009;55:1–99. 10.1016/S1043-4526(08)00401-4 [DOI] [PubMed] [Google Scholar]
  • 6.Tawab MA, Bahr U, Karas M, Wurglics M, Schubert-Zsilavecz M. Degradation of ginsenosides in humans after oral administration. Drug Metab Dispos. 2003;31(8):1065–1071. 10.1124/dmd.31.8.1065 [DOI] [PubMed] [Google Scholar]
  • 7.Xu QF, Fang XL, Chen DF. Pharmacokinetics and bioavailability of ginsenoside Rb1 and Rg1 from Panax notoginseng in rats. J Ethnopharmacol. (2003);84:187–192. 10.1016/S0378-8741(02)00317-3 [DOI] [PubMed] [Google Scholar]
  • 8.Jia L, Zhao Y. Current evaluation of the millennium phytomedicine-ginseng (I): etymology, pharmacognosy, phytochemistry, market and regulations. Curr Med Chem. 2009;16(19):2475–84. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Choi JR, Hong SW, Kim Y, Jang SE, Kim NJ, Han MJ, et al. Metabolic activities of ginseng and its constituents, ginsenoside Rb1 and Rg1, by human intestinal microflora. J Ginseng Res. 2011;35(3):301–307. 10.5142/jgr.2011.35.3.301 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Siddiqi MH, Siddiqi MZ, Ahn S, Kang S, Kim YJ, Veerappan K, et al. Stimulative effect of ginsenosides Rg5:Rk1 on murineosteoblastic MC3T3-E1 cells. Phytother Res. 2014; 28:1447–1455. 10.1002/ptr.5146 [DOI] [PubMed] [Google Scholar]
  • 11.Oh M, Choi YH, Choi S, Chung H, Kim K, Kim SI, et al. Anti-proliferating effects of ginsenoside Rh2 on MCF-7 human breast cancer cells. Int J Oncol. 1999;14(5):869–75. [DOI] [PubMed] [Google Scholar]
  • 12.Wang CZ, Li XL, Wang QF, Mehendale SR, Fishbein AB, Han AH, et al. The mitochondrial pathway is involved in American ginseng-induced apoptosis of SW-480 colon cancer cells. Oncol Rep. 2009; 21(3):577–584. 10.3892/or_00000259 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Tang XP, Tang GD, Fang CY, Liang ZH, Zhang LY. Effects of ginsenoside Rh2 on growth and migration of pancreatic cancer cells. World J Gastroenterol. 2013;19(10):1582–1592. 10.3748/wjg.v19.i10.1582 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Li B, Zhao J, Wang CZ, Searle J, He TC, Yuan CS, et al. Ginsenoside Rh2 induces apoptosis and paraptosis like cell death in colorectal cancer cells through activation of p53. Cancer Lett. 2011;301(2):185–192. 10.1016/j.canlet.2010.11.015 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Li S, Gao Y, Ma W, Guo W, Zhou G, Cheng T, et al. EDFR signaling-dependent inhibition of glioblastoma growth by ginsenoside Rh2. Tumour Biol. 2014; 35(6):5593–5598. 10.1007/s13277-014-1739-x [DOI] [PubMed] [Google Scholar]
  • 16.Liua S, Chena M, Li P, Wu Y, Chang C, Qiu Y, et al. Ginsenoside Rh2 Inhibits Cancer Stem-Like Cells in Skin Squamous Cell Carcinoma. Cell Physiol Biochem. 2015;36(2):499–508. 10.1159/000430115 [DOI] [PubMed] [Google Scholar]
  • 17.Musende AG, Eberding A, Wood C, Adomat H, Fazli L, Hurtado-Coll A, et al. Pre-clinical evaluation of Rh2 in PC-3 human xenograft model for prostate cancer in vivo: formulation, pharmacokinetics, biodistribution and efficacy. Cancer Chemother Pharmacol. 2009;64(6):1085–1095. 10.1007/s00280-009-0965-1 [DOI] [PubMed] [Google Scholar]
  • 18.He L, Lee J, Jang JH, Lee SH, Nan MH, Nan BC. et al. Ginsenoside Rh2 inhibits osteoclastogenesis through down-regulation of NF-κB,NFATc1 and c-Fos. Bone. 2012;50(6):1207–13. 10.1016/j.bone.2012.03.022 [DOI] [PubMed] [Google Scholar]
  • 19.Kim DY, Jung MS., Park YG, Yuan HD, Quan HY, Chung SH. Ginsenoside Rh2(S) induces the differentiation and mineralization of osteoblastic MC3T3-E1 cells through activation of PKD and p38 MAPK pathways. BMB Reports. 2011;44(10):659–64. 10.5483/BMBRep.2011.44.10.659 [DOI] [PubMed] [Google Scholar]
  • 20.Hou J, Xue J, Lee M, Liu L, Zhang D, Sun M, et al. Ginsenoside Rh2 improves learning and memory in mice. J Med Food. 2013;16(8):772–776. 10.1089/jmf.2012.2564 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Popovich DG, Kitts DD. Ginsenosides 20(S)-protopanaxadiol and Rh2 reduce cell proliferation and increase sub-G1 cells in two cultured intestinal cell lines, Int-407 and Caco-2. Can J Physiol Pharmacol. 2004;82(3):183–90 10.1139/y04-001 [DOI] [PubMed] [Google Scholar]
  • 22.Yang JH, Han SJ, Ryu JH, Jang IS, Kim DH. Ginsenoside Rh2 ameliorates scopolamine-induced learning deficit in mice. Biol Pharm Bull. 2009;32(10):1710–5. [DOI] [PubMed] [Google Scholar]
  • 23.Lee WK, Kao ST, Liu IM, Cheng JT. Increase of insulin secretion by ginsenoside Rh2 to lower plasma glucose in wistar rats. Clin Exp Pharmacol Physiol. 2006;33(1–2):27–32. 10.1111/j.1440-1681.2006.04319.x [DOI] [PubMed] [Google Scholar]
  • 24.Hwang JT, Kim SH, Lee MS., Kim SH, Yang HJ, Kim MJ, et al. Anti-obesity effects of ginsenoside Rh2 are associated with the activation of AMPK signaling pathway in 3T3-L1 adipocyte. Biochem Biophys Res Commun. 2007;364 (4):1002–1008. 10.1016/j.bbrc.2007.10.125 [DOI] [PubMed] [Google Scholar]
  • 25.Zhou J, Gao Y, Yi X, Ding Y. Ginsenoside Rh2 Suppresses Neovascularization in Xenograft Psoriasis Model. Cell Physiol Biochem. 2015;36(3):980–7. 10.1159/000430272 [DOI] [PubMed] [Google Scholar]
  • 26.Bae EA, Han MJ, Kim EJ, Kim DH. Transformation of ginseng saponins to ginsenoside Rh2 by acids and human intestinal bacteria and biological activities of their transformants. Arch Pharm Res. 2004;27(1):61–7. [DOI] [PubMed] [Google Scholar]
  • 27.Cui CH, Kim JK, Kim SC, Im WT. Characterization of a ginsenoside-transforming beta-glucosidase from Paenibacillus mucilaginosus and its application for enhanced production of minor ginsenoside F(2). PLoS ONE. 2014;9:e85727 10.1371/journal.pone.0085727 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Cui CH, Kim SC, Im WT. Characterization of the ginsenoside-transforming recombinant beta-glucosidase from Actinosynnema mirum and bioconversion of major ginsenosides into minor ginsenosides. Appl Microbiol Biotechnol. (2013a);97(2):649–59. [DOI] [PubMed] [Google Scholar]
  • 29.Cui CH, Liu QM, Kim JK, Sung BH, Kim SG, Kim SC, et al. Identification and characterization of a Mucilaginibacter sp. strain QM49 beta-glucosidase and its use in the production of the pharmaceutically active minor ginsenosides (S)-Rh1 and (S)-Rg2. Appl Environ Microbiol. 2013b;79(19):5788–5798. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Du Juan, Cui CH, Park SC, Kim JK, Yu HS, Jin FX, et al. Identification and Characterization of a Ginsenoside-Transforming β-Glucosidase from Pseudonocardia sp. Gsoil 1536 and Its Application for Enhanced Production of Minor Ginsenoside Rg2(S). PLoS ONE. 2014;9(6):e96914 10.1371/journal.pone.0096914 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Hong H, Cui CH, Kim JK, Jin FX, Kim SC, Im WT. Enzymatic Biotransformation of Ginsenoside Rb1 and Gypenoside XVII into Ginsenosides Rd and F2 by Recombinant beta-glucosidase from Flavobacterium johnsoniae. J Ginseng Res. 2012;36(4):418–424. 10.5142/jgr.2012.36.4.418 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Kim JK, Cui CH, Yoon MH, Kim SC, Im WT. Bioconversion of major ginsenosides Rg1 to minor ginsenoside F1 using novel recombinant ginsenoside hydrolyzing glycosidase cloned from Sanguibacter keddieii and enzyme characterization. J Biotechnol. 2012;161(3):294–301. 10.1016/j.jbiotec.2012.06.021 [DOI] [PubMed] [Google Scholar]
  • 33.Li L, Shin SY, Lee SJ, Moon JS, Im WT, Han NS. Production of Ginsenoside F2 by Using Lactococcus lactis with Enhanced Expression of β-Glucosidase Gene from Paenibacillus mucilaginosus. J Agric Food Chem. 2016; 64(12):2506–2512. 10.1021/acs.jafc.5b04098 [DOI] [PubMed] [Google Scholar]
  • 34.Bae EA, Shin JE, Kim DH. Metabolism of ginsenoside Re by human intestinal microflora and its estrogenic effect. Biol Pharm Bull. 2005;28(10):1903–1908. [DOI] [PubMed] [Google Scholar]
  • 35.Quan LH, Min JW, Jin Y, Wang C, Kim YJ, Yang DC. Enzymatic biotransformation of ginsenoside Rb1 to compound K by recombinant beta-glucosidase from Microbacterium esteraromaticum. J Agric Food Chem. (2012a); 60(14):3776–3781. [DOI] [PubMed] [Google Scholar]
  • 36.Ko SR, Choi KJ, Suzuki K, Suzuki Y. Enzymatic preparation of ginsenosides Rg2, Rh1, and F1. Chem Pharm Bull. 2003;51(4):404–408. [DOI] [PubMed] [Google Scholar]
  • 37.Nijkamp JF, van den Broek M, Datema E, de Kok S, Bosman L, Luttik MA, et al. De novo sequencing, assembly and analysis of the genome of the laboratory strain Saccharomyces cerevisiae CEN.PK113-7D, a model for modern industrial biotechnology. Microb Cell Fact. 2012;11:36 10.1186/1475-2859-11-36 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.van Dijken JP, Bauer J, Brambilla L, Duboc P, François JM, Gancedo C, et al. An interlaboratory comparison of physiological and genetic properties of four Saccharomyces cerevisiae strains. Enzyme Microb. Technol. 2000;26(9–10):706–714. [DOI] [PubMed] [Google Scholar]
  • 39.Park JU, Jo JH, Kim YJ, Chung SS, Lee JH, Lee HH. Construction of heat-inducible expression vector of C. glutamicum and C. ammoniagenes: fusion of lambda operator with promoters isolated from C. ammoniagenes. J Microbiol Biotechnol. 2008;18(4):639–47. [PubMed] [Google Scholar]
  • 40.Deng X, Petitjean M, Teste MA, Kooli W, Samuel T, François JM, et al. Similarities and differences in the biochemical and enzymological properties of the four isomaltases from Saccharomyces cerevisiae. FEBS Open Bio. 2014;4:200–212. 10.1016/j.fob.2014.02.004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Siddiqi MZ, Siddiqi MH, Kim YJ, Jin Y, Huq MA, Yang DC. Effect of Fermented Red Ginseng Extract Enriched in Ginsenoside Rg3 on the Differentiation and Mineralization of Preosteoblastic MC3T3-E1 Cells. J Med Food. 2015;18(5):542–548. 10.1089/jmf.2014.3251 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 Fig. Entire process of Rh2-Mix production from PPD-Mix (protopanaxadiol-type ginsenoside) as starting substrate using combined method of acid heat treatment and enzyme treatment (BglPm_C).

(TIF)

Data Availability Statement

All relevant data are within the paper and its Supporting Information file.


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES