Skip to main content
Experimental and Therapeutic Medicine logoLink to Experimental and Therapeutic Medicine
. 2017 Jan 20;13(3):1117–1126. doi: 10.3892/etm.2017.4070

Characteristics of carbapenemase-producing Klebsiella pneumoniae as a cause of neonatal infection in Shandong, China

Yan Jin 1,*, Xiaofei Song 2,*, Yigang Liu 1, Yong Wang 1, Bingchang Zhang 1, Hui Fan 1, Chunhong Shao 1,
PMCID: PMC5403258  PMID: 28450951

Abstract

The goal of the present study was to examine the characteristics of carbapenem-resistant Klebsiella pneumoniae as a cause of neonatal infection. A total of 37 carbapenem-resistant Klebsiella pneumoniae-positive newborns hospitalized in Shandong Provincial Hospital, China between April 2011 and October 2013 were examined. Antibiotic susceptibility testing was performed using the agar dilution method and the Etest. Resistance genes were assessed by polymerase chain reaction (PCR) and sequencing. Pulsed-field gel electrophoresis (PFGE) and multi-locus sequence typing (MLST) were used to determine the genotypes and homology of these isolates. Plasmids were analyzed by PFGE and conjugation experiments. The outer membrane proteins were examined by PCR and SDS-PAGE. All of the isolates were revealed to be resistant to the third and fourth generation cephalosporins and piperacillin-tazobactam. Tigecycline, colistin, levofloxacin and amikacin were successful against all of the isolates. The antibiotic resistance rates of aztreonam, gentamicin, trimethoprim-sulfamethoxazole and fosfomycin were 13.51, 48.64, 78.38 and 86.49%, respectively. Of the 37 cases, 25 isolates (67.57%) were blaNDM-1 positive, 13 isolates (35.14%) were blaIMP-4 positive and 1 isolate (2.70%) was blaIMP-8 positive. Two isolates carried both blaNDM-1 and blaIMP-4. The isolate carrying 2–4 plasmids and blaNDM-1 and blaIMP-4 was transferable between strains. SDS-PAGE data indicated that outer membrane proteins remained present. PFGE revealed 7 distinct clusters, and MLST reported the presence of ST20, ST17, ST54, ST705 and ST290 sequences, which indicated that there was clone and plasmid spread between newborns. The main resistance mechanism of carbapenem-resistant Klebsiella pneumoniae was that the isolates expressed the carbapenemase resistance of blaNDM-1 and blaIMP-4 genes. The current study indicates that early detection of these genes may be helpful in infection prevention and control.

Keywords: Klebsiella pneumoniae, carbapenem-resistance, infection of newborns, NDM-1, IMP-4

Introduction

Klebsiella pneumoniae is an important pathogen of community-acquired and nosocomial neonatal infections, with mortality rates varying between 18 and 68% (1,2). Carbapenem is the most effective drug used to treat infection with gram-negative bacteria, due to its marked antibacterial activity and stability in response to β-lactamases (3). However, the inappropriate use of carbapenem has accelerated the emergence of resistant strains in recent years (4). Infections associated with carbapenem-resistant K. pneumoniae are a public health problem globally due to their transmission mechanism and the limited therapeutic options available (5).

The most prevalent carbapenemase genes expressed by Enterobacteriaceae are in Ambler classes A and B, particularly blaKPC, blaIMP and blaNDM (6). Steinmann et al (7) described a hospital outbreak caused by K. pneumoniae carbapenemase (KPC)-2-producing K. pneumoniae in Germany between July 2010 and January 2011 that resulted in the death of four people. Similarly, in March 2011, a New Delhi Metallo-β-lactamase (NDM)-1-producing Escherichia coli strain was isolated in Hong Kong, China (8).

The prevalence of carbapenem-resistant Enterobacteriaceae is increasing in mainland China, and has caused a number of nosocomial outbreaks. In 2012, Hu et al (9) reported an outbreak of 77 KPC-2-producing Enterobacteriaceae in Shanghai Huashan Hospital, China. Finally, in 2015, Chen et al (10) reported Enterobacteriaceae co-expressing blaNDM-1 and blaIMP-4 in China. The prevalence of carbapenem-resistant Enterobacteriaceae is a current challenge during treatment and infection control in hospitals; fortunately, neonatal cases are typically rare.

In the present study, patients who were carbapenem-resistant Klebsiella pneumoniae-positive in the neonatal, pediatric intensive care and cardiac intensive care units (ICUs) were enrolled, between April 2011 and October 2013. In order to better understand infection control, the antibiotic resistance of the strains, and homogeneity and transmission mechanisms of the resistance genes, were investigated.

Materials and methods

Collection of isolates and susceptibility testing

In the current study, 37 carbapenem-resistant K. pneumoniae samples were collected in Shandong Provincial Hospital, China, between April 2011 and October 2013. Of these, 31 isolates were from the neonatal unit, 5 were from the pediatric ICU and 1 was from the cardiac ICU. All isolates were identified using a VITEK-2 compact 60 system (bioMérieux, Marcy l'Etoile, France). It is of note that 21 of these K. pneumoniae isolates carried with NDM-1 have been described in a previous article (11). The novel isolates were Kpn1, 3–8, 12, 14–18, 21, 24 and 39. Antibiotic susceptibility testing was performed by the agar dilution method (12). All antibiotics, except tigecycline and colisin, were administered according to the approved standard of the Clinical and Laboratory Standards Institute 2014 guidelines (13). The minimum inhibitory concentrations (MICs) of meropenem, imipenem, ertapenem, tigecycline, colisin and fosfomycin were determined by an Etest (bioMérieux). The 2014 European Committee on Antimicrobial Susceptibility Testing breakpoint (www.eucast.org/clinical_breakpoint) was used to determine resistance in colistin and tigectcline. All isolates were screened for carbapenemase production using the modified Hodge test (MHT) and imipenem-ethylenediaminetetraacetic acid (EDTA) double-disc synergistic test (14). E. coli ATCC25922 (American Type Culture Collection Center, Manassas, VA, USA) acted as the control.

Polymerase chain reaction (PCR) and DNA sequence analysis of drug resistance genes

Samples were screened for the presence of carbapenem resistance genes (blaKPC, blaSME, blaIMI/blaNMC, blaGES, blaIMP, blaVIM, blaGIM, blaSIM-1, blaSPM, blaNDM-1 and blaOXA), common extended-spectrum β-lactamase (ESBL) genes (blaCTX-M, blaTEM and blaSHV) and AmpC β-lactamase (AMPC) genes (blaMOX, blaFOX, blaDHA, blaCIT and blaEBC) in all 37 strains using PCR and previously described primers (1518). The primers used are listed in Table I. The genome used as a template was extracted using a Rapid Bacterial Genomic DNA Isolation Kit (Sangon Biotech Co., Ltd., Shanghai, Chin). PCR was performed according to the manufacturer's instruction of the PCR (Taq) kit (B532501-0100; Sangon Biotech Co., Ltd.). The reaction was performed using the following thermal cycling conditions: 1 Cycle at 94°C for 5 min; 30 cycles at 94°C for 1 min, 55–58°C for 45 sec and 72°C for 1 min; and 1 cycle at 72°C for 10 min. The results of PCR were screened by electrophoresis on a 1% agarose gel and the results were sequenced by Sangon Biotech Co., Ltd.

Table I.

Primers used in the present study.

Primer Forward (5′-3′) Reverse (5′-3′)
KPC ATTGGCTAAAGGGAAACACGACC GTAGACGGCCAACACAAT
SME AGATAGTAAATTTTATAG CTCTAACGCTAATAG
IMIF ATAGCCATCCTTGTTTAGCTC TCTGCGATTACTTTATCCTC
NMC GCATTGATATACCTTTAGCAGAGA CGGTGATAAAATCACACTGAGCATA
GES GTTTTGCAATGTGCTCAACG TGCCATAGCAATAGGCGTAG
IMP-1 TGAGCAAGTTATCTGTATTC TTAGTTGCTTGGTTTTGATG
VIM-1 TTATGGAGCAGCAACCGATGT CAAAAGTCCCGCTCCAACGA
GIM-1 AGAACCTTGACCGAACGCAG ACTCATGACTCCTCACGAGG
SIM-1 TACAAGGGATTCGGCATCG TAATGGCCTGTTCCCATGTG
SPM-1 CCTACAATCTAACGGCGACC TCGCCGTGTCCAGGTATAAC
NDM-1 ATTAGCCGCTGCATTGAT GGCATGTCGAGATAGGAAGT
OXA ACACAATACATATCAACTTCGC AGTGTGTTTAGAATGGTGATC
CTX-M-cons TTTGCGATGTGCAGTACCAGTAA CGATATCGTTGGTGGTGCCATA
CTX-M-1 GGTTAAAAAATCACTGCGTC TTACAAACCGTYGGTGACGA
CTX-M-2 ATGATGACTCAGAGCATTCGCCGC TCAGAAACCGTGGGTTACGATTTT
CTX-M-9 GTGACAAAGAGAGTGCAACGG ATGATTCTCGCCGCTGAAGCC
CTX-M-15 CACACGTGGAATTTAGGGACT GCCGTCTAAGGCGATAAACA
TEM ACATGGGGGATCATGTAACT GACAGTTACAATGCTTACT
SHV ATGCGTTATATTCGCCTGTG AGCGTTGCCAGTGCTCGATG
MOX GCTGCTCAAGGAGCACAGGAT CACATTGACATAGGTGTGGTGC
FOX AACATGGGGTATCAGGGAGATG CAAAGCGCGTAACCGGATTGG
DHA AACTTTCACAGGTGTGCTGGGT CCGTACGCATACTGGCTTTGC
CTT TGGCCAGAACTGACAGGCAAA TTTCTCCTGAACGTGGCTGGC
EBC TCGGTAAAGCCGATGTTGCGG CTTCCACTGCGGCTGCCAGTT
OMPK35 ATGATGAAGCGCAATATTCTGGCAGTGG TGGGCTTTGTCGCCATTGCCGTCA
OMPK36 ATGAAAGTTAAAGTACTGTCCCTC GCCGGTATCTCTACCGACGAC

Resistance gene transfer experiments

Transfer experiments were performed using azide-resistant E. coli J53 (donated by Peking Union Medical College Hospital, Beijing, China) as the recipient strain. Overnight single colonies of donor and acceptor strains on MacConkey agar plates were inoculated into 5 ml nutrient broth containing imipenem (0.5 µg/ml) or sodium azide (200 µg/ml). These were incubated at 37°C for 8 h. Cultures of the donor strain (10 µl) and recipient strain (20 µl) were mixed with 10 ml fresh Mueller-Hinton broth and incubated for 24 h at 35°C. The mixture was then inoculated onto MacConkey agar plates containing sodium azide (200 µg/ml) and imipenem (0.5 µg/ml) for 24 h at 35°C. Conjugation was confirmed with a VITEK-2 compact system for drug sensitivity testing. The presence of carbapenemase was confirmed by MHT, imipenem-EDTA double-disc synergistic test and PCR analysis.

Pulse-field gel electrophoresis (PFGE) and plasmid analysis

An overnight bacterial culture was suspended in cell suspension buffer [100 mM EDTA, 100 mM Tris-HCl (pH 8.0)] and adjusted to an optical density of 4.0 at a wavelength of 600 nm. The suspension was mixed with equal volumes of low-melting agarose in Tris-EDTA (TE) buffer in a 2% solution of low-melting-temperature agarose in TE buffer [1 mM EDTA, 10 mM Tris-HCl (pH 8.0)]. Following cooling, the agarose sections were incubated for 4 h at 54°C in cell lysis buffer [50 mM Tris-HCl, 50 mM EDTA (pH 8.0), 0.01 g/ml N-lauroyl-sarcosine, sodium salt, 0.1 mg/ml proteinase K]. These were then washed thoroughly with TE buffer and digested overnight with XbaI restriction endonuclease (Takara Bio, Inc., Otsu, Japan). DNA separation was performed in 0.5X Tris/borate/EDTA (TBE) buffer in a PFGE system (CHEF Mapper; Bio-Rad Laboratories, Inc., Hercules, CA, USA) at 14°C, using a voltage of 6 V/cm, a switch angle of 120° and a switch ramp of 4–40 sec for 21 h. The Salmonella enterica serotype Braenderup H9812 (Peking Union Medical College Hospital) was used as a marker for PFGE. The restriction patterns were analyzed and interpreted in accordance with the protocol implemented by Tenover et al (19).

The plasmid number and size of the 37 isolates, and their transconjugants, were analyzed by S1-PFGE. In summary, the gels embedded with bacterial DNA were digested with proteinase K and Sl nuclease. DNA separation was performed in 0.5X TBE buffer in the above PFGE system at 14°C with a voltage of 6 V/cm, a switch angle of 120° and a switch ramp of 2.16–63.8 sec for 20 h. S. enterica H9812 fragment, digested by XbaI enzyme, was used as a molecular weight standard. Subsequent to PFGE, the DNA products of the positive transconjugants were recovered and used as templates to amplify the carbapenem-resistance genes. The PCR reaction conditions and primers used are the same as described above. The PCR products were sequenced and searched on GenBank (www.ncbi.nlm.nih.gov/genbank).

Multilocus sequence typing (MLST)

MLST was performed on K. pneumoniae using 7 conserved housekeeping genes (gapA, infB, mdh, pgi, phoE, rpoB and tonB) according to protocols available on the MLST Pasteur website (bigsdb.pasteur.fr/klebsiella/primers_used.html).

Analysis of outer membrane proteins (OMPs)

The OMP genes were screened in all clinical isolates with previously described primers, using PCR (20). The primers used are listed in Table I. The reaction used the following thermal cycling conditions: 1 Cycle at 94°C for 5 min; 30 cycles at 94°C for 45 sec, 55°C for 45 sec and 72°C for 1 min; and 1 cycle at 72°C for 10 min. The results of PCR were screened by electrophoresis on a 1% agarose gel. The PCR negative isolates were investigated for alterations in the OMPs by SDS-PAGE, as previously described (21).

Results

Clinical and epidemiological characteristics of 37 isolates

Between April 2011 and October 2013, 37 carbapenem-resistant K. pneumoniae samples were isolated from neonatal inpatients in Shandong Provincial Hospital in Jinan, China. Of these, 32 isolates were from sputum specimens, 3 were from umbilical secretions and 2 were from blood (Table II). As indicated, 21 of these K. pneumoniae isolates carried with NDM-1 have been described in a previous article (11). Of these samples, 31 were isolated from patients in the neonatal department, 5 were from the pediatric ICU and 1 was from a patient in the cardiac ICU. These patients included 23 males and 14 females. The 31 patients from the neonatal ward were all premature, with a low birth weight and neonatal pneumonia. A total of 5 infant patients had an intrauterine infection at birth. All patients were initially treated with various antibiotics, including cloxacillin, cefuroxime, and cefotetan. A total of 8 patients were treated with imipenem or meropenem. The cardiac ICU patient had a respiratory tract infection and fever 5 days after their cardiac operation. The prognosis of this cohort was poor; 2 patients succumbed to bloodstream infection.

Table II.

Characteristics of 37 carbapenem-resistant K. pneumoniae.

Resistance genes

Isolate no. Patient age Gender Ward Isolate date Specimen ST PFGE MHT EDTA carbapenemase ESBL AMPC
Kpn1 9 m F pICU 2011/4/3 sputum 705 F + IMP-4 TEM-1 CTX-M-14
Kpn3 2 m F pICU 2011/9/2 sputum   20 B + IMP-4 TEM-1 CTX-M-14 DHA-1
Kpn4 7 d M neonatal unit 2012/3/16 blood 290 A + IMP-8 TEM-1 CTX-M-15
Kpn5 7 d F neonatal unit 2012/5/17 sputum   54 E + NDM-1 TEM-1 CTX-M-14 DHA-1
Kpn6 1 m F neonatal unit 2012/6/5 sputum   54 E + NDM-1 TEM-1 CTX-M-14 DHA-1
Kpn7 17 d M neonatal unit 2012/7/27 sputum   54 E + NDM-1 TEM-1 CTX-M-14 DHA-1
Kpn8 1 m M neonatal unit 2012/7/26 sputum   54 E + NDM-1, IMP-4 TEM-1 CTX-M-14 DHA-1
Kpn9 2 m M neonatal unit 2012/8/1 sputum   20 B + NDM-1 TEM-1 CTX-M-15 DHA-1
Kpn10 21 d M neonatal unit 2012/8/23 sputum   20 B + NDM-1 TEM-1 CTX-M-15 DHA-1
Kpn11 1 d M neonatal unit 2012/8/29 sputum   20 B ± + NDM-1 TEM-1 CTX-M-15 DHA-1
Kpn12 5 d M pICU 2012/8/28 sputum 705 F + IMP-4 TEM-1 CTX-M-14
Kpn13 13 d M neonatal unit 2012/8/30 sputum   20 B + NDM-1 TEM-1 CTX-M-15 DHA-1
Kpn14 1 m M pICU 2012/8/30 sputum 705 F + IMP-4 TEM-1 CTX-M-14
Kpn15 14 d F neonatal unit 2012/10/4 sputum   54 E + IMP-4 TEM-1 CTX-M-14 DHA-1
Kpn16 4 d F neonatal unit 2012/10/16 sputum   54 E + IMP-4 TEM-1 CTX-M-14 DHA-1
Kpn17 23 d M neonatal unit 2012/11/5 umbilicus   54 E + IMP-4 TEM-1 CTX-M-15
Kpn18 11 d F neonatal unit 2012/11/9 sputum   54 E + IMP-4 TEM-1 CTX-M-15 DHA-1
Kpn19 2 m M neonatal unit 2013/1/1 sputum   20 B + NDM-1 TEM-1 CTX-M-15 DHA-1
Kpn20 22 d F neonatal unit 2013/1/29 sputum   20 B + NDM-1 TEM-1 CTX-M-15 DHA-1
Kpn21 9 d M neonatal unit 2013/1/30 sputum   54 D + IMP-4 TEM-1 CTX-M-15
Kpn23 1 m M neonatal unit 2013/2/25 sputum   20 B + NDM-1 TEM-1 CTX-M-15 DHA-1
Kpn24 12 d M neonatal unit 2013/2/27 umbilicus   54 D + IMP-4 TEM-1 CTX-M-15 DHA-1
Kpn25 2 m M neonatal unit 2013/3/5 sputum   20 G ± + NDM-1 CTX-M-15 DHA-1
Kpn26 1 m M neonatal unit 2013/3/6 sputum   20 B + NDM-1 TEM-1 CTX-M-15 DHA-1
Kpn27 25 d F neonatal unit 2013/3/14 sputum   20 B + NDM-1 TEM-1 CTX-M-15 DHA-1
Kpn28 1 m M neonatal unit 2013/3/19 sputum   20 B + NDM-1 CTX-M-15 DHA-1
Kpn29 1 m M neonatal unit 2013/4/19 sputum   20 B + NDM-1 TEM-1 CTX-M-15 DHA-1
Kpn30 13 d M neonatal unit 2013/4/23 umbilicus   54 D + + NDM-1 CTX-M-15 DHA-1
Kpn31 5 d F neonatal unit 2013/5/2 sputum   20 B + NDM-1 TEM-1 CTX-M-15 DHA-1
Kpn32 9 d F neonatal unit 2013/7/13 sputum   20 B + NDM-1 TEM-1 CTX-M-15 DHA-1
Kpn33 1 m M neonatal unit 2013/7/21 sputum   20 B + + NDM-1 TEM-1 CTX-M-15 DHA-1
Kpn34 2 m M pICU 2013/7/24 sputum   20 B + NDM-1 TEM-1 CTX-M-15 DHA-1
Kpn35 1 d M neonatal unit 2013/7/27 sputum 17 C + + NDM-1 TEM-1 CTX-M-14
Kpn36 1 m F neonatal unit 2013/7/29 blood 20 B ± + NDM-1 TEM-1 CTX-M-15 DHA-1
Kpn37 2 d F neonatal unit 2013/8/19 sputum 17 C + NDM-1 TEM-1 CTX-M-14
Kpn38 1 y F cICU 2013/9/10 sputum 17 C ± + NDM-1, IMP-4 TEM-1 CTX-M-14
Kpn39 16 d M neonatal unit 2013/10/17 sputum 54 D + IMP-4 TEM-1 CTX-M-15 DHA-1

Kpn, Klebsiella pneumonia; d, days; m, months; y, years; M, male; F, female; pICU, pediatric intensive care unit; cICU, cardiac intensive care unit; ST, strain; PFGE, pulse-field gel electrophoresis analysis result; MHT, modified Hodge test; EDTA, EDTA synergistic test; NDM-1, New Delhi Metallo-β-lactamase-1; ESBL, extended-spectrum-p-lactamase.

Susceptibility results

Drug sensitivity was tested with the standard agar dilution method (Table III). These features in 21 previously described K. pneumoniae isolates are included in this analysis (11). All 37 isolates were resistant to penicillin, piperacillin-tazobactam, cephalosporins and their composite agents including the enzyme inhibitors cefoxitin and carbapenem. The percentage of the number of bacteria senstive to antibiotics divided by total strains, the sensitivity rate, to tigecycline, levofloxacin, amikacin and polymyxin were all 100%. The sensitivity rates of aztreonam, gentamicin, trimethoprim-sulfamethoxazole and fosfomycin were 13.51, 48.64, 78.38 and 86.49%, respectively.

Table III.

Antibiotic susceptibility of 37 carbapenem-resistant K. pneumoniae isolates.

MICs (µg/ml)

Isolate no. IMP MEM ETP CN AK TZP CRO CAZ FEP FOX LEV SXT TGC CO FOS ATM
Kpn1 6 4 32 ≥16 ≤2 8 ≥64 ≥64 32 >256 1 ≥16 0.75 0.125 1024 ≤1
Kpn3 2 0.8 3 ≥16 ≤2 64 ≥64 ≥64 32 >256 1 ≤1 0.5 0.125 24 ≥64
Kpn4 3 2 1 ≥16 ≤2 64 ≥64 ≥64 32 >256 1 ≤1 0.75 0.125 64 ≥64
Kpn5 >32 >32 3 ≥16 ≤2 64 ≥64 ≥64 16 >256 1 ≤1 0.5 0.125 16 ≥64
Kpn6 >32 >32 4 ≥16 ≤2 64 ≥64 ≥64 16 >256 0.5 ≤1 0.5 0.125 16 ≥64
Kpn7 >32 >32 >32 ≥16 ≤2 64 ≥64 ≥64 2 >256 0.5 ≤1 0.75 0.125 24 4
Kpn8 0.5 0.75 3 ≥16 ≤2 64 ≥64 ≥64 16 >256 1 ≤1 0.5 0.125 16 ≥64
Kpn9 8 8 >32 0.5 2 >256 ≥64 ≥64 >64 >256 0.5 >32 0.5 0.125 32 >256
Kpn10 24 8 >32 0.5 4 >256 ≥64 ≥64 >64 >256 0.5 0.125 0.5 0.125 48 >256
Kpn11 >32 >32 >32 0.5 2 >256 ≥64 ≥64 >64 >256 1 0.125 0.5 0.125 48 >256
Kpn12 >32 >32 8 ≥16 ≤2 64 ≥64 ≥64 32 >256 1 ≥16 1.5 0.125 1024 2
Kpn13 >32 >32 >32 1 4 >256 ≥64 ≥64 >64 >256 1 >256 0.5 0.125 >256 1
Kpn14 4 >32 >32 ≥16 ≤2 64 ≥64 ≥64 32 >256 1 ≥16 1.5 0.125 1024 2
Kpn15 4 32 >32 ≥16 ≤2 128 ≥64 ≥64 32 >256 0.5 ≤1 0.75 0.25 12 ≥64
Kpn16 1 0.75 4 ≥16 ≤2 64 ≥64 ≥64 32 >256 0.5 ≤1 0.5 0.125 8 ≥64
Kpn17 2 32 32 ≥16 ≤2 64 ≥64 ≥64 >64 >256 ≤0.2 ≤1 0.75 0.125 12 ≥64
Kpn18 32 32 32 ≥16 ≤2 64 ≥64 ≥64 >64 >256 ≤0.2 ≤1 0.5 0.125 16 ≥64
Kpn19 >32 >32 >32 1 4 >256 ≥64 ≥64 >64 >256 0.5 0.25 0.5 0.125 16 >256
Kpn20 >32 >32 >32 1 2 >256 ≥64 ≥64 >64 >256 1 0.125 0.5 0.125 32 >256
Kpn21 0.5 1 4 ≥16 ≤2 64 ≥64 ≥64 32 >256 ≤0.2 ≤1 0.5 0.125 24 ≥64
Kpn23 >32 >32 >32 0.5 2 >256 ≥64 ≥64 >64 >256 1 0.25 0.5 0.125 16 >256
Kpn24 >32 >32 >32 ≥16 ≤2 64 ≥64 ≥64 >64 >256 ≤0.2 ≤1 0.5 0.125 24 ≥64
Kpn25 >32 >32 >32 0.5 2 >256 ≥64 ≥64 >64 >256 1 0.25 0.25 0.125 48 >256
Kpn26 32 32 32 0.5 4 >256 ≥64 ≥64 >64 >256 1 0.25 1 0.125 24 >256
Kpn27 >32 >32 >32 0.5 2 >256 ≥64 ≥64 >64 >256 1 0.19 0.5 0.032 48 >256
Kpn28 >32 >33 >32 0.5 2 >256 ≥64 ≥64 >64 >256 1 0.19 0.5 0.032 32 >256
Kpn29 >32 >32 >32 1 2 >256 ≥64 ≥64 >64 >256 1 0.125 0.5 0.125 48 >256
Kpn30 4 32 32 0.5 4 >256 ≥64 ≥64 >64 >256 1 0.125 1 0.125 32 >256
Kpn31 32 32 >32 0.5 2 >256 ≥64 ≥64 >64 >256 1 0.125 1 0.25 48 >256
Kpn32 >32 >32 >32 0.5 4 >256 ≥64 ≥64 >64 >256 1 0.125 0.5 0.25 128 >256
Kpn33 >32 >32 >32 0.5 4 >256 ≥64 ≥64 >64 >256 0.5 0.5 1 0.25 16 >256
Kpn34 >32 >32 >32 0.5 4 >256 ≥64 ≥64 >64 >256 0.5 0.5 0.5 0.25 32 >256
Kpn35 >32 8 >32 32 2 >256 ≥64 ≥64 >64 >256 0.5 >32 1 0.25 16 >256
Kpn36 >32 >32 >32 0.5 4 >256 ≥64 ≥64 >64 >256 0.5 0.5 1 0.25 48 >256
Kpn37 >32 4 32 32 2 >256 ≥64 ≥64 >64 >256 1 >32 0.5 0.125 16 >256
Kpn38 >32 >32 >32 16 2 >256 ≥64 ≥64 >64 >256 0.5 >32 1 0.125 16 >256
Kpn39 >32 3 4 ≥16 ≤2 64 ≥64 ≥64 16 >256 ≤0.2 ≤1 0.5 0.125 32 ≥64

MIC, Minimum inhibitory concentration; Kpn, Klebsiella pneumonia; IMP, imipenem; MEM, meropenem; ETP, ertapenem; CN, gentamicin; AK, amikacin; TZP, piperacillin-tazobactam; CRO, cefatriaxone; CAZ, ceftazidime; FEP, cefepime; FOX, cefoxitin; LEV: levofloxacin; SXT, trimethoprim-sulfamethoxazole; TGC, tigecycline; CO, colisin; FOS, fosfomycin; ATM, aztreonam.

The 37 K. pneumoniae samples displayed different degrees of resistance to carbapenems. Kpn4 was sensitive to ertapenem, with intermediate sensitivity to imipenem and meropenem. Of the 7 strains with mild sensitivity to ertapenem, 4 strains (Kpn16, 21, 3 and 8) were sensitive to imipenem and meropenem, 2 strains (Kpn5 and 6) were markedly resistant to imipenem and meropenem and Kpn39 was resistant to imipenem, with intermediate resistance to meropenem. The 19 isolates all had high resistance to the three carbapenem antibiotics; the MICs of the three carbapenems were ≥32 µg/ml.

Resistance characterization and resistance genes

The 37 carbapenem-resistant K. pneumoniae, including those from our previous study, all showed positive results in the EDTA synergistic test, and 7 attained positive or weakly positive results in the MHT, at a rate of 18.92% (11). Metallo-β-lactamases (MBL) were confirmed to be present in all isolates through sequencing of the PCR products. Of these, 23 isolates expressed only blaNDM-1, and 11 isolates expressed only blaIMP-4. Kpn4, isolated from blood, expressed only blaIMP-8, and 2 isolates simultaneously expressed blaNDM-1 and blaIMP-4 (11). In addition to MBL, other types of β-lactamase were examined, including ESBLs and AMPCs. The distribution of the resistance genes in these strains is reported in Table II. The ESBL genes were determined to be blaCTX-M-15, blaCTX-M-14 and blaTEM-1 in 24 (64.87%), 13 (35.14%) and 34 (91.89%) isolates, respectively. Genotyping of the AMPC genes confirmed the presence of blaDHA-1 in 28 (75.68%) isolates.

Characterization of OMPs

In our previous study, the outer membrane protein genes OmpK35 and OmpK36 were detected in 21 K. pneumoniae isolates expressing NDM-1 (Kpn9, Kpn10, Kpn11, Kpn13, Kpn19, Kpn20, Kpn23 and Kpn25-38) (11). The remaining 16 strains revealed no loss of OmpK35 and OmpK36 at the gene or the protein level.

Transfer of carbapenem resistance

A total of 28 transconjugants were obtained from 37 isolates by transfer experiments, with a success rate of 75.68%. Of these, 20 transconjugants were obtained from 23 isolates encoding blaNDM-1 and 8 transconjugants were obtained from 11 isolates encoding blaIMP-4 (11). The transfer experiment failed in 2 isolates simultaneously encoding blaNDM-1 and blaIMP-4. All transconjugants were confirmed to have the same biochemical spectrum as E. coli strain J53, using the VITEK-2 compact system. All transconjugants demonstrated similar carbapenem susceptibility to donor strains Table IV. Compared with E. coli strain J53, the MIC of imipenem, meropenem and etarpenem increased 8- to 64-fold, 32- to 512-fold and 256- to 2,048-fold, respectively. The MIC of piperacillin tazobactam, ceftazidime, Cefatriaxone, cefoxitin and cefepime increased 8- to 2,048-fold.

Table IV.

Results of antibiotic susceptibility testing of E. coli J53 transconjugant strains derived from blaNDM-producing K. pneumonia (µg/ml).

Transconjugant IMP MEM ETP CN AK TZP CTX CAZ FEP FOX LEV SXT TGC CO FOS ATM
kpn3-J53 2 1 2 ≥16 ≤2 32 ≥64 ≥64 32 256 1 ≤1 0.5 0.125 24 32
kpn5-J53 16 16 4 ≥16 ≤2 16 ≥64 ≥64 8 64 1 ≤1 0.5 0.125 16 ≥64
kpn6-J53 8 8 2 ≥16 ≤2 16 ≥64 ≥64 16 128 0.5 ≤1 0.5 0.125 16 32
kpn7-J53 16 32 32 ≥16 ≤2 8 ≥64 ≥64 2 64 0.5 ≤1 0.75 0.125 24 4
kpn9-J53 2 2 >32 <1 <2 64 >256 >256 8 >256 <0.25 <0.5 0.25 0.5 2 32
kpn10-J53 2 2 >32 <1 <2 64 >256 >256 >256 >256 <0.25 <0.5 0.25 0.5 2 >256
kpn11-J53 2 4 4 <1 <2 64 >256 >256 8 >256 <0.25 <0.5 0.25 0.5 2 >256
kpn13-J53 >32 >32 >32 1 4 128 ≥64 ≥64 >64 >256 1 >256 0.5 0.125 >256 1
kpn15-J53 4 16 16 ≥16 ≤2 128 ≥64 ≥64 32 128 0.5 ≤1 0.75 0.25 12 32
kpn16-J53 <1 <1 4 ≥16 ≤2 32 ≥64 ≥64 16 64 0.5 ≤1 0.5 0.125 8 16
kpn17-J53 2 8 4 ≥16 ≤2 32 ≥64 ≥64 64 128 ≤0.2 ≤1 0.75 0.125 12 32
kpn18-J53 8 8 16 ≥16 ≤2 32 ≥64 ≥64 32 128 ≤0.2 ≤1 0.5 0.125 16 64
kpn19-J53 >32 >32 >32 <1 <2 >256 >256 >256 >256 >256 <0.25 <0.5 0.25 0.5 2 >256
kpn20-J53 2 2 16 <1 <2 >256 >256 >256 8 >256 <0.25 <0.5 0.25 0.5 2 >256
kpn21-J53 <1 <1 4 ≥16 ≤2 16 ≥64 ≥64 8 128 ≤0.2 ≤1 0.5 0.125 24 32
kpn23-J53 2 2 4 <1 <2 >256 >256 >256 >256 >256 <0.25 <0.5 0.25 0.5 2 >256
kpn24-J53 8 4 8 ≥16 ≤2 32 ≥64 ≥64 32 128 ≤0.2 ≤1 0.5 0.125 24 64
kpn25-J53 4 4 4 <1 <2 >256 >256 >256 >256 >256 <0.25 <0.5 0.25 0.5 2 >256
kpn26-J53 32 32 32 <1 <2 >256 >256 >256 >256 >256 <0.25 <0.5 0.25 0.5 2 >256
kpn27-J53 2 4 >32 <1 <2 >256 >256 >256 8 >256 <0.25 <0.5 0.25 0.5 2 >256
kpn28-J53 >32 >33 >33 <1 <2 >256 >256 >256 >256 >256 <0.25 <0.5 0.25 0.5 2 >256
kpn29-J53 >32 >32 >32 <1 <2 >256 >256 >256 >256 >256 <0.25 <0.5 0.25 0.5 2 >256
kpn30-J53 4 32 32 <1 <2 >256 >256 >256 >256 >256 <0.25 <0.5 0.25 0.5 2 1
kpn31-J53 32 32 >32 <1 <2 >256 >256 >256 >256 >256 <0.25 <0.5 0.25 0.5 2 >256
kpn32-J53 >32 >32 >32 <1 <2 >256 >256 >256 >256 >256 <0.25 <0.5 0.25 0.5 2 >256
kpn33-J53 >32 >32 >32 <1 <2 >256 >256 >256 >256 >256 <0.25 <0.5 0.25 0.5 2 >256
kpn36-J53 >32 8 >32 <1 <2 >256 >256 >256 >256 >256 <0.25 <0.5 0.25 0.5 2 >256
kpn39-J53 16 2 2 ≥16 ≤2 16 32 32 16 128 ≤0.2 ≤1 0.5 0.125 32 32
EC J53 <1 <1 <0.5 <1 <2 <0.5 <1 <1 <1 <1 <0.25 <0.5 0.25 0.5 2 <1

IMP, imipenem; MEM, meropenem; ETP, ertapenem; CN, gentamicin; AK, amikacin; TZP, piperacillin-tazobactam; CRO, cefatriaxone; CAZ, ceftazidime; FEP, cefepime; FOX, cefoxitin; LEV: levofloxacin; SXT, trimethoprim-sulfamethoxazole; TGC, tigecycline; CO, colisin; FOS, fosfomycin; ATM, aztreonam.

Homology analyzed by PFGE and MLST

MLST revealed that the 37 isolates had 5 different sequence types: ST17, ST20, ST54, ST705 and ST290 (Table III) (11). The ST20 and ST54 sequences represented the majority of the clones. PFGE revealed 7 distinct clusters amongst the 37 isolates (Fig. 1). The 3 strains from the umbilical cord all had ST54 sequences, while two strains (Kpn4 and Kpn9) isolated from blood had ST54 and ST290 sequences. Cluster B included 17 isolates, all of which had ST20 sequences. The 12 isolates with ST54 sequences were divided into clusters D and E. A cluster was defined as strains with homology >80%. There were 5 strains isolated from the pediatric ICU, 3 of which had ST705 sequences and were allocated into cluster F. The Kpn35, Kpn37 and Kpn38 samples belonged to ST17 and the same cluster E in PFGE (11).

Figure 1.

Figure 1.

Dendrogram analysis. Dendrogram generated with the Fingerprinting II Informatix software package, demonstrating the relatedness of fingerprints (XbaI-PFGE) for 37 carbapenem-resistant K. pneumoniae strains. The phylogenetic tree was constructed using the Dice coefficient and UPGMA clustering. A genetic similarity index scale is shown in the left of the dendrogram. PFGE types and strain number are included along each PFGE lane. PFGE, pulse-field gel electrophoresis.

Plasmid profiling

The plasmid number and size of all isolates were analyzed by S1-PFGE, which revealed that these isolates contained 2–4 plasmids. As the primary sequences, ST20- and ST54-encoding isolates contained 2 or 3 plasmids, but their transconjugants only had 1 plasmid. The sizes of the plasmid from ST20- and ST54-encoding bacteria were 336 kb and 55 kb, respectively. The blaNDM-1 and blaIMP-4 were located in the 336 kb plasmid and 55 kb plasmid, respectively, as determined by PCR and sequencing.

Discussion

The standard method of treatment for serious infections caused by ESBL-producing Enterobacteriaceae is carbapenem antibiotics, but drug resistance is a critical problem (22). The present study demonstrated that carbapenem-resistant K. pneumoniae primarily manifested in infants within the neonatal unit. Premature birth, low birth weight, low immunity and intrauterine infections are the primary risk factors of nosocomial infection (23). The widespread inappropriate use of carbapenem and cephalosporins is an additional important risk factor (4).

In the current study, all patients were treated with cephalosporins within 2 weeks of admission, and 8 infants were prescribed carbapenem. The use of a ventilator may increase the risk of infection by carbapenem-resistant K. pneumoniae, however 10 patients used a ventilator in the present study. Antibiotic sensitivity testing revealed that carbapenem-resistant K. pneumoniae was resistant to most antibiotics. Only a few antibiotics, including aminoglycosides, fluoroquinolones, colistin, tigecycline and fosfomycin, were effective in vitro.

There is currently no effective drug available to treat carbapenem-resistant Enterobacteriaceae in neonates due to the limited range of drugs available. This it because some antibiotics, such as aminoglycosides, quinolones and tetracyclines, can not be used in pediatric patients because of their side effects. Therefore, infection by carbapenem-resistant Enterobacteriaceae has a very high mortality rate of ~70% in patients with bacteremia (24). In the current study, the prognosis of all neonates was poor; 2 children succumbed to bloodstream infections.

The outbreak of 21 K. pneumoniae isolates expressing NDM-1 were reported in a previous article (11). In addition, the present study described an outbreak of the same clone (ST705) was identified in the pediatric ICU. This strain was resistant to all beta-lactam antibiotics except for azteronam. The current results confirmed that this resistance was induced by the metalloenzyme blaIMP-4, belonging to the Ambler class B of carbapenemases. This strain is able to hydrolyze penicillins, cephalosporins and carbapenems, but not aztreonam. In the neonatal ward, there were 2 strains of carbapenem-resistant K. pneumoniae: ST20 and ST54. The former carried blaNDM-1 and was responsible for an outbreak between August 2012 and July 2013. In comparing the housekeeping genes of ST20 and ST17, only the infB allele was reported to differ, with a base variant at 279 (T-C). This suggested that these 2 sequences are highly homologous. K. pneumoniae of the ST54 strain was identified with 5 isolates expressing only blaNDM-1, 7 isolates expressing only blaIMP-4, and Kpn8 expressing blaNDM-1 and blaIMP-4. The ST54 strains expressing blaNDM-1 were present in samples between May 2012 and July 2012, and the ST54 strains expressing blaIMP-4 were prevalent in samples between 2011 and 2013. The outbreak described in the present study was due to the ST54 strain, expressing blaNDM-1. Critically, 2 isolates expressed both blaNDM-1 and blaIMP-4.

The production of carbapenemase was the primary mechanism by which Enterobacteriaceae bacteria attained resistance to carbapenem antibiotics. Carbapenemase-producing Enterobacteriaceae induce high mortality and are easily spread by acquiring carbapenemases from different species (25,26). In the present studied population, the most common genes expressed were blaNDM-1 and blaIMP-4. Plasmid analysis proved that NDM-1 and IMP-4 were located in 336 kb and 55 kb plasmids, respectively. A transformation test revealed that these are easily transferred between different strains, and may cause spread between bacteria. Previous studies have reported that infection in neonates is caused by blaCTX-M-15-expressing K. pneumoniae in the strains ST20 and ST17 in Spain and Canada (27,28). The outbreak of carbapenem-resistant K. pneumoniae in causing neonatal infection therefore requires additional study.

Previous studies have suggested that the overexpression of ESBLs and AMPC combined with missing outer membrane proteins have an important role in the drug resistance of K. pneumoniae (29,30). Currently, the main known outer membrane proteins in K. pneumoniae include OmpK37, OmpK35 and OmpK36. Of these, OmpK35 and OmpK36 have crucial roles in regulating drug penetration (11). While previous PCR amplification reported gene deletion of OmpK35 in kpn15 and kpn38, SDS-PAGE did not confirm the loss of OmpK35. This suggested that detection of the membrane protein required a combination of PCR and SDS-PAGE methods. Furthermore, it indicated that the resistance to carbapenems by K. pneumoniae was not associated with the outer membrane protein. Carbapenem-resistant K. pneumoniae expressed the carbapenemases gene, and ESBLs and AMPC, also permitting resistance to beta-lactam drugs, suggesting the presence of multi-drug resistance genes.

In conclusion, carbapenem-resistant K. pneumoniae causes neonatal infection, which may be due to simultaneously expressed multiple drug resistance genes. In the present study, blaNDM-1 and blaIMP-4 were the predominating resistance genes. Minimizing spread is a critical clinical challenge. carbapenem-resistant Klebsiella pneumoniae is a severe threat to the healthcare system, and calls for stringent standard infection control practices in healthcare settings, in addition to the reasonable use of antibiotics.

Acknowledgements

The present study was supported by the National Natural Science Foundation of China (grant no. 81401696) and the Shandong Province Science and Technology Development Program of China (grant no. 2012G0021844).

References

  • 1.Saleem AF, Qamar FN, Shahzad H, Qadir M, Zaidi AK. Trends in antibiotic susceptibility and incidence of late-onset Klebsiella pneumoniae neonatal sepsis over a six-year period in a neonatal intensive care unit in Karachi, Pakistan. Int J Infect Dis. 2013;17:e961–e965. doi: 10.1016/j.ijid.2013.04.007. [DOI] [PubMed] [Google Scholar]
  • 2.Schwaber MJ, Lev B, Israeli A, Solter E, Smollan G, Rubinovitch B, Shalit I, Carmeli Y. Israel Carbapenem-Resistant Enterobacteriaceae Working Group: Containment of a country-wide outbreak of carbapenem-resistant Klebsiella pneumoniae in Israeli hospitals via a nationally implemented intervention. Clin Infect Dis. 2011;52:848–855. doi: 10.1093/cid/cir025. [DOI] [PubMed] [Google Scholar]
  • 3.Nicolau DP. Carbapenems: A potent class of antibiotics. Expert Opin Pharmacother. 2008;9:23–37. doi: 10.1517/14656566.9.1.23. [DOI] [PubMed] [Google Scholar]
  • 4.Ulu AC, Kurtaran B, Inal AS, Kömür S, Kibar F, Çiçekdemir HY, Bozkurt S, Gürel D, Kılıç F, Yaman A, et al. Risk factors of carbapenem-resistant Klebsiella pneumoniae infection: A serious threat in ICUs. Med Sci Monit. 2015;21:219–224. doi: 10.12659/MSM.892516. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Kontopidou F, Giamarellou H, Katerelos P, Maragos A, Kioumis I, Trikka-Graphakos E, Valakis C, Maltezou HC. Group for the Study of KPC-producing Klebsiella pneumoniae infections in intensive care units: Infections caused by carbapenem-resistant Klebsiella pneumoniae among patients in intensive care units in Greece: A multi-centre study on clinical outcome and therapeutic options. Clin Microbiol Infect. 2014;20:O117–O123. doi: 10.1111/1469-0691.12341. [DOI] [PubMed] [Google Scholar]
  • 6.Diene SM, Rolain JM. Carbapenemase genes and genetic platforms in Gram-negative bacilli: Enterobacteriaceae, Pseudomonas and Acinetobacter species. Clin Microbiol Infect. 2014;20:831–838. doi: 10.1111/1469-0691.12655. [DOI] [PubMed] [Google Scholar]
  • 7.Steinmann J, Kaase M, Gatermann S, Popp W, Steinmann E, Damman M, Paul A, Saner F, Buer J, Rath P. Outbreak due to a Klebsiella pneumoniae strain harbouring KPC-2 and VIM-1 in a German university hospital, July 2010 to January 2011. Euro Surveill. 2011;16:19944. [PubMed] [Google Scholar]
  • 8.Ho PL, Lo WU, Yeung MK, Lin CH, Chow KH, Ang I, Tong AH, Bao JY, Lok S, Lo JY. Complete sequencing of pNDM-HK encoding NDM-1carbapenemase from a multidrug-resistant Escherichia coli strain isolated in Hong Kong. PLoS One. 2011;6:e17989. doi: 10.1371/journal.pone.0017989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Hu F, Chen S, Xu X, Guo Y, Liu Y, Zhu D, Zhang Y. Emergence of carbapenem-resistant clinical Enterobacteriaceae isolates from a teaching hospital in Shanghai, China. J Med Microbiol. 2012;61:132–136. doi: 10.1099/jmm.0.036483-0. [DOI] [PubMed] [Google Scholar]
  • 10.Chen Z, Wang Y, Tian L, Zhu X, Li L, Zhang B, Yan S, Sun Z. First Report in China of enterobacteriaceae clinical isolates coharboring blaNDM-1 and blaIMP-4 drug resistance genes. Microb Drug Resist. 2015;21:167–170. doi: 10.1089/mdr.2014.0087. [DOI] [PubMed] [Google Scholar]
  • 11.Jin Y, Shao C, Li J, Fan H, Bai Y, Wang Y. Outbreak of Multidrug Resistant NDM-1-Producing Klebsiella pneumoniae from a neonatal unit in Shandong Province, China. PLoS One. 2015;10:e0119571. doi: 10.1371/journal.pone.0119571. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Clinical and Laboratory Standards Institute, corp-author. Method for dilution antimicrobial susceptibility tests for bacteria that grow aerobically. Wayne, PA: CLSI; 2012. approved standard-ninth edition, 2012, M07-A9. [Google Scholar]
  • 13.Clinical and Laboratory Standards Institute, corp-author. Performance standards for antimicrobial susceptibility testing twentieth informational supplement. Wayne, PA: CLSI; 2014. 2014, M100-S24. [Google Scholar]
  • 14.Lee K, Chong Y, Sllin HB, Kim YA, Yong D, Yum JH. Modified Hodge and EDTA disk synergy tests to screen metallo-beta-lactamase producing strains of Pseudomonas and Acinetobacter species. Clin Microbiol Infect. 2001;7:88–91. doi: 10.1046/j.1469-0691.2001.00204.x. [DOI] [PubMed] [Google Scholar]
  • 15.Queenan AM, Bush K. Carbapenemases: The versatile beta-lactamases. Clin Microbiol Rev. 2007;20:440–458. doi: 10.1128/CMR.00001-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Fang H, Ataker F, Hedin G, Dornbusch K. Molecular epidermiology of extended-spectrum beta-lactamases among Escherichia coli isolates collected in a Swedish hospital and its associated health care facilities from 2001 to 2006. J Clin Microbio. 2008;46:707–712. doi: 10.1128/JCM.01943-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Pérez-Pérez FJ, Hanson ND. Detection of plasmid-mediated AmpC beta-lactamase genes in clinical isolates by using multiplex PCR. J Clin Microbio. 2002;40:2153–2162. doi: 10.1128/JCM.40.6.2153-2162.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Robicsek A, Strahilevitz J, Sahm DF, Jacoby GA, Hooper DC. qnr prevalence in ceftazidime-resistant enterobacteriaceae isolates from the United States. Antimicrob Agents Chemother. 2006;50:2872–2874. doi: 10.1128/AAC.01647-05. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Tenover FC, Arbeit RD, Goering RV, Mickelsen PA, Murray BE, Persing DH, Swaminathan B. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: Criteria for bacterial strain typing. J Clin Microbiol. 1995;33:2233–2239. doi: 10.1128/jcm.33.9.2233-2239.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Doumith M, Ellington MJ, Livennore DM, Woodford N. Molecular mechanisms disrupting porin expression in ertapenem-resistant Klebsiella and Enterobacter spp. clinical isolates from the UK. J Antimicrob Chemother. 2009;63:659–667. doi: 10.1093/jac/dkp029. [DOI] [PubMed] [Google Scholar]
  • 21.Hernández-Allés S, Albertí S, Alvarez D, Doménech-Sánchez A, Martínez-Martínez L, Gil J, Tomás JM, Benedí VJ. Porin expression in clinical isolates of Klebsiella pneumoniae. Microbiology. 1999;145:673–679. doi: 10.1099/13500872-145-3-673. [DOI] [PubMed] [Google Scholar]
  • 22.Paterson DL. Recommendation for treatment of severe infection caused by Enterobacteriaceae producing extended-spectrum beta-lactamases (ESBLs) Clin Microbiol Infect. 2000;6:460–463. doi: 10.1046/j.1469-0691.2000.00107.x. [DOI] [PubMed] [Google Scholar]
  • 23.Ghotaslou R, Ghorashi Z, Nahaei MR. Klebsiella pneumoniae in neonatal sepsis: A 3-year-study in the pediatric hospital of Tabriz, Iran. Jpn J Infect Dis. 2007;60:126–128. [PubMed] [Google Scholar]
  • 24.Borer A, Saidel-Odes L, Riesenberg K, Eskira S, Peled N, Nativ R, Schlaeffer F, Sherf M. Attributable mortality rate for carbapenem-resistant Klebsiella pneumoniae bacteremia. Infect Control Hosp Epidemiol. 2009;30:972–976. doi: 10.1086/605922. [DOI] [PubMed] [Google Scholar]
  • 25.Cherkaoui A, Emonet S, Renzi G, Riat A, Greub G, Schrenzel J. ESBL and carbapenemases in Enterobacteriaceae. Rev Med Suisse. 2014;10:2142–2148. (In French) [PubMed] [Google Scholar]
  • 26.Stock I. Infectious diseases caused by carbapenemase-producing Enterobacteriaceae - a particular challenge for antibacterial therapy. [(In German)]. Med Monatsschr Pharm. 2014;37:162–172. quiz 173–174. [PubMed] [Google Scholar]
  • 27.Peirano G, Sang JH, Pitondo-Silva A, Laupland KB, Pitout JD. Molecular epidemiology of extended-spectrum-β-lactamase-producing Klebsiella pneumoniae over a 10 year period in Calgary, Canada. J Antimicrob Chemother. 2012;67:1114–1120. doi: 10.1093/jac/dks026. [DOI] [PubMed] [Google Scholar]
  • 28.Mavroidi A, Liakopoulos A, Gounaris A, Goudesidou M, Gaitana K, Miriagou V, Petinaki E. Successful control of a neonatal outbreak caused mainly by ST20 multidrug-resistant SHV-5-producing Klebsiella pneumoniae, Greece. BMC Pediatr. 2014;14:105. doi: 10.1186/1471-2431-14-105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Delgado-Valverde M, Sojo-Dorado J, Pascual A, Rodríguez-Baño J. Clinical management of infections caused by multidrug-resistant Enterobacteriaceae. Ther Adv Infect Dis. 2013;1:49–69. doi: 10.1177/2049936113476284. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Doménech-Sánchez A, Hernández-Allés S, Martínez-Martínez L, Benedí VJ, Albertí S. Identification and characterization of a new porin gene of Klebsiella pneumoniae: Its role in beta-lactam antibiotic resistance. J Bacteriol. 1999;181:2726–2732. doi: 10.1128/jb.181.9.2726-2732.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Experimental and Therapeutic Medicine are provided here courtesy of Spandidos Publications

RESOURCES