Abstract
Type 2 diabetes (T2D) is defined by high levels of glucose in the blood. The collagen IV level is associated with conditions of hyperglycemia and insulin resistance. Collagen type IV α3 chain (COL4A3) is a structural protein of the extracellular matrix (ECM). Matrix metallopeptidase 9 (MMP-9) is an enzyme that degrades the extracellular matrix and its activity is moderated by TIMP metallopeptidase inhibitor 1 (TIMP-1). The aim of the current study was to examine the association between genetic polymorphisms of COL4A3 (rs55703767), MMP-9 (rs17576) and TIMP-1 (rs6609533) in patients with T2D. This case-control study was performed on 120 Iranian patients with T2D and 120 healthy individuals. Genotypes were analyzed using the amplification refractory mutation system-polymerase chain reaction technique. The findings demonstrated significant differences between genotypic and allelic distributions of COL4A3 (G/T) and MMP-9 (A/G) polymorphisms as follows: COL4A3 (G/T); TT vs. GG, odds ratio (OR)=0.235, 95% confidence interval (CI)=0.063–0.0802 (P=0.013) and T vs. G, OR=0.592, 95% CI=0.371–0.943 (P=0.026); MMP-9 (A/G); AG vs. GG, OR=2.429, 95% CI=1.232–4.820 (P=0.008) and A vs. G, OR=2.176, 95% CI=1.155–4.130 (P=0.013). No significant association was identified between TIMP-1 (A/G) polymorphism and T2D in females and males. Thus, the genotypic and allelic distributions of COL4A3 (G/T) and MMP-9 (A/G) polymorphisms were associated with T2D. In addition, no significant association was identified in the genotypic distribution of the TIMP-1 (A/G) gene in females and in males. Further studies in other ethnic groups are required to confirm these findings.
Keywords: collagen type IV α3 chain, gene polymorphism, matrix metallopeptidase 9, TIMP metallopeptidase inhibitor 1, type 2 diabetes
Introduction
Type 2 diabetes (T2D) is a metabolic disease, which is distinguished by high levels of blood sugar and occurs when the pancreas is unable to produce enough insulin or the body is unable to use the insulin that is produced (insulin resistance) (1,2). The signs and symptoms of T2D include excessive urination, polydipsia, polyphagia, weight loss, blurry vision and fatigue (3,4). The prevalence of diabetes has been estimated to increase from 171 million in 2000 to 366 million by 2030 and is associated with macro- and microvascular disorders (3,5,6). T2D has numerous risk factors, including ageing, genetics, family history, previous gestational diabetes, ethnicity, nourishment and poverty (3,7). As one of the most well-known polygenic diseases, certain candidate genes have been detected for the risks and complex traits of T2D (8). The extracellular matrix is important to the structure and function of various cell types; furthermore, it contributes to processes, such as cell adhesion, cellular proliferation, differentiation, migration and apoptosis (9). Type IV collagen is a structural glycoprotein and the primary component of basement membranes (BMs). Each collagen molecule comprises three chains (10,11). In diabetes mellitus, marked alterations in the synthesis and structure of the extracellular matrix have been detected. A previous study has shown that collagen IV levels are associated with hyperglycemia and insulin resistance (12). Collagen type IV α3 chain (COL4A3) is expressed in the alveolar BM (13). It is located at position 2q35-q37 and contains 51 exons (14). Matrix metalloproteinases (MMP) are zinc-dependent endopeptidases that degrade matrix and non-matrix proteins (15). MMPs regulate numerous normal and pathological activities (16). The MMP-9 gene is located on chromosome 20q12.2–13.1 and contains 13 exons and 12 introns (17). The activities of MMPs are regulated by tissue inhibitors of metalloproteinases (TIMPs) (18). TIMP-1 is a secreted glycoprotein, which binds to active MMPs and inhibits their proteolytic activity (19,20). In addition, TIMP-1 was mapped to X11p11.23–11.4 (21). The purpose of the current study was to investigate the possible association between T2D and COL4A3 (rs55703767, G/T), MMP-9 (rs17576, A/G) and TIMP-1 (rs6609533, A/G) gene polymorphisms in an Iranian population.
Materials and methods
Subjects
This case-control study was performed on 120 patients with T2D and 120 healthy individuals. The mean ages were 56.34±10.8 years. Approval was obtained from the ethics committee of Zahedan University of Medical Sciences (Zahedan, Iran) and written informed consent was obtained from all participants. T2D was diagnosed according to medical records and fasting blood glucose (FBG) levels using the American Diabetic association (ADA) criteria (22); our studies have been described previously (23,24) and confirmed by at least two endocrinologists from the Diabetic Clinic at the Ali-Asghar Hospital (Zahedan, Iran). Healthy subjects were in good health and free of any comorbidity. Blood samples (5 ml) were collected from all patients and controls after a 12-h fast (between 7:00 and 9:00 am), and stored in ethylenediaminetetraacetic acid-containing tubes for DNA extraction and measurement of clinical characteristics. The FBG, cholesterol, triglyceride (TG), high-density lipoprotein-cholesterol (HDL-C), low-density lipoprotein-cholesterol (LDL-C), creatinine, and urea are presented in Table I.
Table I.
Demographic characteristics of T2D patients.
| Characteristic | T2D (n=120) | Controls (n=120) | P-value |
|---|---|---|---|
| Age (years) | 56.57±10.602 | 56.11±11.075 | 0.744 |
| Gender (f/m) | 91/29 | 88/32 | 0.767 |
| Duration of illness (years) | 9.91±6.90 | – | – |
| Fasted blood sugar (mg/dl) | 172.51±77.32 | 75.53±12.04 | 0.001 |
| TG (mg/dl) | 152.47±73.50 | 120.25±10.12 | 0.001 |
| TC (mg/dl) | 175.79±38.29 | 190.09±15.04 | 0.001 |
| HDL-C (mg/dl) | 59.02±6.74 | 60.36±4.53 | 0.116 |
| LDL-C (mg/dl) | 89.82±13.00 | 90.22±6.03 | 0.878 |
| Urea (mg/dl) | 31.33±10.95 | 30.23±6.12 | 0.185 |
| Creatinine (mg/dl) | 1.02±0.264 | 1.01±0.233 | 0.352 |
T2D, type 2 diabetes; TG, triglyceride; TC, total cholesterol; HDL-C, high-density lipoprotein-cholesterol; LDL-C, low-density lipoprotein-cholesterol; f, female; m, male.
COL4A3, MMP-9 and TIMP-1 polymorphism genotyping
Genomic DNA was extracted from peripheral blood according to the salting-out method (25). The quality of the extracted DNA was confirmed using electrophoresis (at 80 V for ~30–40 min) on 2% agarose gel and the quantity of DNA by spectrophotometry (ratio, 260/280 nm; absorption, 1.7–1.9), the isolated DNA was stored at −20°C until further use. The COL4A3 (rs55703767), MMP-9 (rs17576) and TIMP-1 (rs6609533) polymorphisms were genotyped using the amplification refractory mutation system polymerase chain reaction (ARMS-PCR) method.
Genotyping the rs55703767 polymorphism of the COL4A3 (G/T) gene
Evaluation of the polymorphism, COL4A3 (rs55703767) was performed using ARMS-PCR (the primers)(Pishgam Biotech Co., Tehran, Iran) are presented in Table II. For this purpose, two tubes were used to define the variant as follows: Tube 1 contained wild-allele-specific reverse primer G and a common forward primer; tube 2 contained mutant-allele-specific reverse primer T and a common forward primer. PCR was performed in a final volume of 20 µl using 2 µl genomic DNA, 7 DNase-free water (SinaClon BioScience Co., Tehran, Iran), 0.5 µl each primer and 10 µl Master Mix (Ampliqon A/S, Odense, Denmark). The amplification was performed with a primary denaturation step at 95°C for 5 min, followed by 33 cycles at 95°C for 30 sec, 54°C for 35 sec, and 72°C for 30 sec with a final extension at 72°C for 10 min. The PCR products were assayed by electrophoresis (at 50 V for ~30–40 min) on a 2% agarose gel and the product size was 216 bp.
Table II.
Primers used for the identification of SNPs.
| SNP | Orientation | Sequence (5′-3′) | Amplicon size (bp) |
|---|---|---|---|
| COL4A3 (rs55703767) G/T | R (G allele) | AGGATTACCTTAATGCCACC | |
| R (T allele) | AGGATTACCTTAATGCCACA | 216 | |
| F (universal) | CTGCATTTGGGAATCATAGT | ||
| MMP-9 (rs17576) A/G | F (A allele) | CCCAGGACTCTACACCAA | |
| F (G allele) | CCCAGGACTCTACACCAG | 275 | |
| R (universal) | GTGGAAAGACAAACTGATGG | ||
| TIMP-1 (rs6609533) A/G | F (A allele) | CTGTGTCCAATACCGTGTGATAA | |
| F (G allele) | CTGTGTCCAATACCGTGTGATAG | 306 | |
| R (universal) | GGCTTCAAGATAGTCACTGG |
SNP, single nucleotide polymorphism; COL4A3, collagen type IV α3 chain; MMP-9, matrix metallopeptidase 9; TIMP-1, TIMP metallopeptidase inhibitor 1; F, forward; R, reverse.
Genotyping the rs17576 polymorphism of the MMP-9 (A/G) gene
To detect the MMP-9 (rs17576) variant, two tubes were used as follows: Tube 1 contained wild-allele-specific forward primer G and a common reverse primer, and tube 2 contained mutant-allele-specific forward primer A and a common reverse primer. PCR was performed in a final volume of 20 µl using 1 µl each primer, 10 µl Master Mix, 2 µl genomic DNA and 6 µ DNase-free water and the PCR cycling condition were as follows: Primary denaturation at 95°C for 5 min, followed by 30 cycles at 95°C for 30 sec, 53°C for 25 sec, and 72°C for 30 sec with a final extension at 72°C for 5 min. The PCR products were assayed by electrophoresis (at 50 V for ~30–40 min) on a 2% agarose gel and the product size was 275 bp.
Genotyping the rs6609533 polymorphism of the TIMP-1 (A/G) gene
DNA amplification was performed using two tubes. Tube 1 contained wild-allele-specific forward primer A and a common reverse primer, and tube 2 contained mutant-allele-specific forward primer G and a common reverse primer. PCR was performed in a final volume of 20 µl using 0.5 µl each primer, 10 µl Master Mix, 2 µl genomic DNA and 7 µl DNase-free water. The PCR cycling conditions were as follows: Primary denaturation at 95°C for 5 min, followed by 32 cycles at 95°C for 30 sec, 61°C for 25 sec, and 72°C for 35 sec with a final extension at 72°C for 5 min. The PCR products were assayed by electrophoresis (at 50 V for ~ 30–40 min) on a 2% agarose gel and the product size was 306 bp.
Statistical analysis
The statistical analysis of the data was calculated using the SPSS version 19.0 software (IBM SPSS, Armonk, NY, USA). The association between genotypes and T2D was assayed by calculating the OR and 95% CI using the χ2 test. P<0.05 was considered to indicate a statistically significant difference. In addition, Hardy Weinberg equilibrium (HWE) was calculated through comparison between observed and expected frequencies of genotypes associated with the investigated polymorphisms.
Results
Study population
The case and control groups were matched regarding age (patient group: 56.57±10.602 years; control group: 56.11±11.075; P=0.744) and gender [patient group (female/male)=91/29 and control group (female/male)=88/32; P=0.767] (Table I).
Frequency of the COL4A3 (rs55703767) genetic polymorphism
Table III presents the allelic and genotypic distributions of the COL4A3 (rs55703767), MMP-9 (rs17576) and TIMP-1 (rs6609533) polymorphisms in the patients and control subjects. The frequency distribution of the COL4A3 (G/T) genotypes in T2D patients were as follows: GG, 69.2%; GT, 27.5%; and TT, 3.3% and the distribution in the controls were: GG, 60.8%; GT, 26.7%; and TT, 12.5%. Statistically significant differences concerning the genotypic distribution of the COL4A3 polymorphism (rs55703767) were identified. The frequency of the TT genotype was significantly different between the patients and the control subjects (OR=0.235, 95% CI=0.063–0.0802; P=0.013). In addition, a statistically significant difference in the T allele frequency was observed between patients with T2D and the control subjects (OR=0.592, 95% CI=0.371–0.943; P=0.026). These results demonstrated that the COL4A3 (rs55703767) polymorphism was associated with T2D.
Table III.
Genotype and allele frequencies of selected polymorphisms in COL4A3, MMP-9 and TIMP-1 genes.
| SNP | Patients, n (%) | Controls, n (%) | OR (95% CI) | P-value |
|---|---|---|---|---|
| COL4A3 (rs55703767) G/T | ||||
| GG | 83 (69.2) | 73 (60.8) | Ref. | – |
| GT | 33 (27.5) | 32 (26.7) | 1.1 (0.593–2.05) | 0.769 |
| TT | 4 (3.3) | 15 (12.5) | 0.235 (0.063–0.0802) | 0.013 |
| Allele frequency | ||||
| G | 199 (82.9) | 178 (74.1) | Ref. | – |
| T | 41 (17) | 62 (25.8) | 0.592 (0.371–0.943) | 0.026 |
| MMP-9 (rs17576) A/G | ||||
| GG | 84 (70) | 102 (85) | Ref. | – |
| AG | 36 (30) | 18 (15) | 2.429 (1.232–4.820) | 0.008 |
| AA | 0 | 0 | – | 1.000 |
| Allele frequency | ||||
| G | 204 (85) | 222 (92.5) | Ref. | – |
| A | 36 (15) | 18 (7.5) | 2.176 (1.155–4.130) | 0.013 |
| TIMP-1 (rs6609533) A/G in females | ||||
| AA | 27 (29.7) | 27 (30.7) | Ref. | – |
| AG | 44 (48.3) | 25 (28.4) | 1.760 (0.852–3.634) | 0.126 |
| GG | 20 (22) | 36 (40.9) | 0.556 (0.259–1.192) | 0.131 |
| Allele frequency | ||||
| A | 98 (53.8) | 79 (44.9) | Ref. | – |
| G | 84 (46.2) | 97 (55.1) | 0.698 (0.461–1.058) | 0.092 |
| TIMP-1 (rs6609533) A/G in males | ||||
| AA | 17 (58.6) | 15 (46.9) | Ref. | – |
| GG | 12 (41.4) | 17 (53.1) | 0.62 (0.23–1.72) | 0.360 |
P<0.05 was considered to indicate statistically significant differences. SNP, single nucleotide polymorphism; OR, odds ratio; CI, confidence interval; COL4A3, collagen type IV α3 chain; MMP-9, matrix metallopeptidase 9; TIMP-1, TIMP metallopeptidase inhibitor 1.
Frequency of the MMP-9 (rs17576) genetic polymorphism
In the current study, the allelic and genotypic distributions of the MMP-9 (rs17576) polymorphism were significantly different between the T2D patients and control subjects. Significant differences in the distribution of the AG genotype frequency were observed in the patients with T2D and the healthy individuals (OR=2.429, 95% CI=1.232–4.820; P=0.008). The current findings indicated that the AG genotype increased the risk of susceptibility to T2D. The AA genotype was not observed in the current study. Furthermore, a statistically significant difference was identified in the A allele frequency (OR=2.176, 95% CI=1.155–4.130; P=0.013). The A allele was a risk factor for susceptibility to T2D.
Frequency of the TIMP-1 (rs6609533) genetic polymorphism
The TIMP-1 gene is located on the X chromosome; therefore, males and females were analyzed separately. No significant difference in the distribution of the AG genotype frequency was identified between the T2D patients and control subject groups in females. In addition, no significant difference in distribution of the genotype frequency was identified for TIMP-1 (A/G) in males. Furthermore, no statistically significant differences were identified in the allele frequencies in females.
The Hardy-Weinberg equilibrium (HWE) of the COL4A3, MMP-9 and TIMP-1 polymorphism were evaluated using the χ2 test for each of the single nucleotide polymorphisms (SNPs) as follows: COL4A3 (case; P=0.748, χ2=0.1, control; P<0.05, χ2=11.1), MMP-9 (case; P=0.0532, χ2=3.74, control; P=0.374, χ2=0.79), and TIMP-1 (case; P<0.05, χ2=8.52, control; P<0.05, χ2=40.63).
Dominant, recessive and overdominant model analyses were performed (Table IV) for the COL4A3 (rs55703767) G/T and the TIMP-1 (RS6609533) A/G, and the result indicated that, of the COL4A3 (rs55703767) G/T, the TT genotype was associated with T2D in the recessive model (P=0.0068) while, in TIMP-1 (RS6609533) A/G, the AG genotype was associated with T2D in the overdominant model (P=0.062). No significant association with T2D was identified in the other models.
Table IV.
Single nucleotide polymorphism association with T2D patients and control subjects.
| SNP | T2D, n (%) | Control, n (%) | P-value | OR (95% CI) |
|---|---|---|---|---|
| COL4A3 (rs55703767) G/T | ||||
| Dominant | ||||
| GG | 83 (69.2) | 73 (60.8) | ||
| GT + TT | 37 (30.8) | 47 (39.2) | 0.18 | 0.69 (0.41–1.18) |
| Recessive | ||||
| GG + GT | 116 (96.7) | 105 (87.5) | ||
| TT | 4 (3.3) | 15 (12.5) | 0.0068 | 0.24 (0.07–0.75) |
| Overdominant | ||||
| GG + TT | 87 (72.5) | 88 (73.3) | ||
| GT | 33 (27.5) | 32 (26.7) | 0.88 | 1.04 (0.59–1.85) |
| TIMP-1 (RS6609533) A/G | ||||
| Dominant | ||||
| AA | 39 (32.5) | 44 (36.7) | ||
| AG + GG | 81 (67.5) | 76 (63.3) | 0.498 | 1.202 (0.706–2.048) |
| Recessive | ||||
| AA + AG | 83 (69.2) | 69 (57.5) | ||
| GG | 37 (30.8) | 51 (42.5) | 0.062 | 0.603 (0.355–1.025) |
| Overdominant | ||||
| AA + GG | 76 (63.3) | 95 (79.2) | ||
| AG | 44 (36.7) | 25 (20.8) | 0.062 | 0.603 (0.355–1.025) |
P<0.05 was considered to indicate a statistically significant difference. T2D, type 2 diabetes; OR, odds ratio; CI, confidence interval; OR, odds ratio; CI, confidence interval; COL4A3, collagen type IV α3 chain; MMP-9, matrix metallopeptidase 9; TIMP-1, TIMP metallopeptidase inhibitor 1.
Discussion
T2D is a growing health challenge worldwide and is the most widespread form of diabetes (26). T2D is characterized by hyperglycemia and results from a combination of resistance to insulin action and insufficient insulin secretion (27). Previous studies demonstrated that genetic polymorphisms may reveal individual differences in T2D risk (28). Type IV collagen is a major component of the ECM and various different physiological situations, including ageing, diabetes, scarring, and fibrosis are associated with it (29); in T2D, the biosynthesis of type IV collagen is increased (30). The levels of extracellular matrix components are a reflection of the balance between the rate of synthesis and the degradation of matrix proteins. Degradation is attained through MMPs, which are regulated by TIMPs (9). Alterations in connective tissue metabolism may associate with the development of diabetic complications, such as neuropathy, nephropathy and retinopathy (12). Rana et al (31) proposed that thin BM nephropathy (TBMN) results from mutations in COL4A3. Numerous different COL4A3 mutations cause TBMN and the identification of polymorphisms in this gene is particularly important (31). Hou et al (32) identified that a novel mutation (3725G>A, G1242D) of COL4A3 exerted an underlying pathogenic role in the heterozygous form in TBMN (29). Ahluwalia et al (33) demonstrated that MMP-9 polymorphisms were associated with the risk of diabetic nephropathy (DN). Nazir et al (34) found that genetic variants of MMP-9 had a significant positive association with DN and that this gene may contribute to the pathophysiology of DN (34). The results of Pan et al (35) indicated that the TIMP-1 SNPs, rs4898 and rs6609533 were associated with an increased risk of early aseptic loosening susceptibility (35). Kumar et al (36) observed that the SNP rs6609533 of the TIMP-1 gene interacted with pim-3 proto-oncogene, serine/threonine kinase, resulting in a possible risk for the development of chronic obstructive pulmonary disease (36).
In conclusion, the T allele of COL4A3 (G/T) (with a protective role) and the A allele of MMP-9 (A/G) (as a risk factor) were associated with T2D. However, no significant association was identified between the G allele of TIMP-1 (A/G) and the risk/protective characteristics of T2D in females in the evaluated population. However, further studies with larger sample sizes and various ethnic groups are required to confirm these findings.
Acknowledgements
The present study was funded by a dissertation grant (grant no. 7224) from the Deputy for Research, University of Medical Sciences (Zahedan, Iran).
References
- 1.Galavi HR, Saravani R, Alamdari AR, Ranjbar N, Damani E, Khodakhier TN. Evaluating the Effect of the rs2229238 and the rs4845625 Interleukin 6 Receptor Gene Polymorphisms on Body Mass Index and the Risk of Type 2 Diabetes in an Iranian Study Population. Int J High Risk Behav Addict. 2016;5:e33289. doi: 10.5812/ijhrba.33289. [DOI] [Google Scholar]
- 2.Matough FA, Budin SB, Hamid ZA, Alwahaibi N, Mohamed J. The role of oxidative stress and antioxidants in diabetic complications. Sultan Qaboos Univ Med J. 2012;12:5–18. doi: 10.12816/0003082. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.McNaughton D. ‘Diabesity’ down under: Overweight and obesity as cultural signifiers for type 2 diabetes mellitus. Crit Public Health. 2013;23:274–288. doi: 10.1080/09581596.2013.766671. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Saravani S, Miri H, Saravani R, Yari D, Nakhaee A, Mahjoubifard M. Association of catalase (rs7943316) and glutathione peroxidase-1 (rs1050450) polymorphisms with the risk of type 2 diabetes (T2DM) Mol Gen Microbiol Virol. 2015;30:216–220. doi: 10.3103/S0891416815040096. [DOI] [Google Scholar]
- 5.Lakhan SE, Kirchgessner A. The emerging role of dietary fructose in obesity and cognitive decline. Nutr J. 2013;12:114. doi: 10.1186/1475-2891-12-114. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Azmy R, Dawood A, Kilany A, El-Ghobashy Y, Ellakwa AF, El-Daly M. Association analysis of genetic variations of eNOS and α2β1 integrin genes with type 2 diabetic retinopathy. Appl Clin Genet. 2012;5:55–65. doi: 10.2147/TACG.S31979. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Saravani R, Esmaeeli E, Tamendani MK, Nejad MN. Oxytocin Receptor Gene Polymorphisms in Patients With Diabetes. Gene, Cell and Tissue. 2015;2:e27904. doi: 10.17795/gct-27904. [DOI] [Google Scholar]
- 8.Tang L, Wang L, Liao Q, Wang Q, Xu L, Bu S, Huang Y, Zhang C, Ye H, Xu X, et al. Genetic associations with diabetes: Meta-analyses of 10 candidate polymorphisms. PLoS One. 2013;8:e70301. doi: 10.1371/journal.pone.0070301. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Khan T, Muise ES, Iyengar P, Wang ZV, Chandalia M, Abate N, Zhang BB, Bonaldo P, Chua S, Scherer PE. Metabolic dysregulation and adipose tissue fibrosis: Role of collagen VI. Mol Cell Biol. 2009;29:1575–1591. doi: 10.1128/MCB.01300-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Heidet L, Arrondel C, Forestier L, Cohen-Solal L, Mollet G, Gutierrez B, Stavrou C, Gubler MC, Antignac C. Structure of the human type IV collagen gene COL4A3 and mutations in autosomal Alport syndrome. J Am Soc Nephrol. 2001;12:97–106. doi: 10.1681/ASN.V12197. [DOI] [PubMed] [Google Scholar]
- 11.Saravani R, Hasanian-Langroudi F, Validad MH, Yari D, Bahari G, Faramarzi M, Khateri M, Bahadoram S. Evaluation of possible relationship between COL4A4 gene polymorphisms and risk of keratoconus. Cornea. 2015;34:318–322. doi: 10.1097/ICO.0000000000000356. [DOI] [PubMed] [Google Scholar]
- 12.Muona P, Jaakkola S, Zhang RZ, Pan TC, Pelliniemi L, Risteli L, Chu ML, Uitto J, Peltonen J. Hyperglycemic glucose concentrations up-regulate the expression of type VI collagen in vitro. Relevance to alterations of peripheral nerves in diabetes mellitus. Am J Pathol. 1993;142:1586–1597. [PMC free article] [PubMed] [Google Scholar]
- 13.Kim KM, Park SH, Kim JS, Lee WK, Cha SI, Kim CH, Kang YM, Jung TH, Kim IS, Park JY. Polymorphisms in the type IV collagen α3 gene and the risk of COPD. Eur Respir J. 2008;32:35–41. doi: 10.1183/09031936.00076207. [DOI] [PubMed] [Google Scholar]
- 14.Štabuc-Šilih M, Ravnik-Glavač M, Glavač D, Hawlina M, Stražišar M. Polymorphisms in COL4A3 and COL4A4 genes associated with keratoconus. Mol Vis. 2009;15:2848–2860. [PMC free article] [PubMed] [Google Scholar]
- 15.Marson BP, Lacchini R, Belo V, Mattos SG, da Costa BP, Poli-de-Figueiredo CE, Tanus-Santos JE. Functional matrix metalloproteinase (MMP)-9 genetic variants modify the effects of hemodialysis on circulating MMP-9 levels. Clin Chim Acta. 2012;414:46–51. doi: 10.1016/j.cca.2012.08.014. [DOI] [PubMed] [Google Scholar]
- 16.Kowluru RA, Zhong Q, Santos JM. Matrix metalloproteinases in diabetic retinopathy: Potential role of MMP-9. Expert Opin Investig Drugs. 2012;21:797–805. doi: 10.1517/13543784.2012.681043. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Wu HD, Bai X, Chen DM, Cao HY, Qin L. Association of Genetic Polymorphisms in Matrix Metalloproteinase-9 and Coronary Artery Disease in the Chinese Han Population: A Case-Control Study. Genet Test Mol Biomarkers. 2013;17:707–712. doi: 10.1089/gtmb.2013.0109. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Nagase H, Visse R, Murphy G, Cao H-y, Qin L. Structure and function of matrix metalloproteinases and TIMPs. Cardiovasc Res. 2006;69:562–573. doi: 10.1016/j.cardiores.2005.12.002. [DOI] [PubMed] [Google Scholar]
- 19.Rivera S, Tremblay E, Timsit S, Canals O, Ben-Ari Y, Khrestchatisky M. Tissue inhibitor of metalloproteinases-1 (TIMP-1) is differentially induced in neurons and astrocytes after seizures: Evidence for developmental, immediate early gene, and lesion response. J Neurosci. 1997;17:4223–4235. doi: 10.1523/JNEUROSCI.17-11-04223.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Goldbergova MP, Parenica J, Jarkovsky J, Kala P, Poloczek M, Manousek J, Kluz K, Kubkova L, Littnerova S, Tesak M, et al. The association between levels of tissue inhibitor of metalloproteinase-1 with acute heart failure and left ventricular dysfunction in patients with ST elevation myocardial infarction treated by primary percutaneous coronary intervention. Genet Test Mol Biomarkers. 2012;16:1172–1178. doi: 10.1089/gtmb.2012.0120. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Brew K, Nagase H. The tissue inhibitors of metalloproteinases (TIMPs): An ancient family with structural and functional diversity. Biochimica et Biophysica Acta (BBA) Mol Cell Res. 2010;1803:55–71. doi: 10.1016/j.bbamcr.2010.01.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Association AD. American Diabetes Association: Standards of medical care in diabetes. Diabetes Care. 2004;27:S15–S35. doi: 10.2337/diacare.27.2007.S15. (Suppl 1) [DOI] [PubMed] [Google Scholar]
- 23.Saravani R, Irani Z, Galavi HR. Evaluation of transcription factor 7 like 2 polymorphisms and haplotypes in risk of type 2 diabetes. Rev Rom Med Lab. 2016;24:423–430. [Google Scholar]
- 24.Saravani R, Galavi HR, Ranjbar N, Alamdari A. ATP-binding cassette transporter A1 polymorphisms and haplotypes in risk of type 2 diabetes. Gene, Cell and Tissue. 2016;4:e43677. doi: 10.17795/gct-43677. [DOI] [Google Scholar]
- 25.Mousavi M, Saravani R, Modrek MJ, Shahrakipour M, Sekandarpour S. Detection of Toxoplasma gondii in Diabetic Patients Using the Nested PCR Assay via RE and B1 Genes. Jundishapur Journal of Microbiology. 2016;9:e29493. doi: 10.5812/jjm.29493. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Ghoshal K, Bhattacharyya M. Adiponectin: Probe of the molecular paradigm associating diabetes and obesity. World J Diabetes. 2015;6:151–166. doi: 10.4239/wjd.v6.i1.151. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Tripathi BK, Srivastava AK. Diabetes mellitus: Complications and therapeutics. Med Sci Monit. 2006;12:RA130–RA147. [PubMed] [Google Scholar]
- 28.Staiger H, Machicao F, Stefan N, Tschritter O, Thamer C, Kantartzis K, Schäfer SA, Kirchhoff K, Fritsche A, Häring HU. Polymorphisms within novel risk loci for type 2 diabetes determine β-cell function. PLoS One. 2007;2:e832. doi: 10.1371/journal.pone.0000832. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Osman OS, Selway JL, Harikumar PE, Stocker CJ, Wargent ET, Cawthorne MA, Jassim S, Langlands K. A novel method to assess collagen architecture in skin. BMC Bioinformatics. 2013;14:260. doi: 10.1186/1471-2105-14-260. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Sternberg M, Grigorova-Borsos AM, Guillot R, Kassab JP, Bakillah A, Urios P, Cohen-Forterre L, Mozère G, André J, Leblond V, et al. Changes in collagen type IV metabolism in diabetes. C R Seances Soc Biol Fil. 1993;187:247–257. (In French) [PubMed] [Google Scholar]
- 31.Rana K, Tonna S, Wang YY, Sin L, Lin T, Shaw E, Mookerjee I, Savige J. Nine novel COL4A3 and COL4A4 mutations and polymorphisms identified in inherited membrane diseases. Pediatr Nephrol. 2007;22:652–657. doi: 10.1007/s00467-006-0393-y. [DOI] [PubMed] [Google Scholar]
- 32.Hou P, Chen Y, Ding J, Li G, Zhang H. A novel mutation of COL4A3 presents a different contribution to Alport syndrome and thin basement membrane nephropathy. Am J Nephrol. 2007;27:538–544. doi: 10.1159/000107666. [DOI] [PubMed] [Google Scholar]
- 33.Ahluwalia TS, Khullar M, Ahuja M, Kohli HS, Bhansali A, Mohan V, Venkatesan R, Rai TS, Sud K, Singal PK. Common variants of inflammatory cytokine genes are associated with risk of nephropathy in type 2 diabetes among Asian Indians. PLoS One. 2009;4:e5168. doi: 10.1371/journal.pone.0005168. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Nazir N, Siddiqui K, Al-Qasim S, Al-Naqeb D. Meta-analysis of diabetic nephropathy associated genetic variants in inflammation and angiogenesis involved in different biochemical pathways. BMC Med Genet. 2014;15:103. doi: 10.1186/s12881-014-0103-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Pan F, Hua S, Luo Y, Yin D, Ma Z. Genetic susceptibility of early aseptic loosening after total hip arthroplasty: The influence of TIMP-1 gene polymorphism on Chinese Han population. J Orthop Surg. 2014;9:108. doi: 10.1186/s13018-014-0108-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Kumar M, Bhadoria DP, Dutta K, Singh S, Gupta J, Kumar R, Chhillar AK, Yadav V, Singh B, Sharma GL. Combinatorial effect of TIMP-1 and α1AT gene polymorphisms on development of chronic obstructive pulmonary disease. Clin Biochem. 2011;44:1067–1073. doi: 10.1016/j.clinbiochem.2011.06.986. [DOI] [PubMed] [Google Scholar]