Molecular Confirmation of the Relationship between Candida guilliermondii Fks1p Naturally Occurring Amino Acid Substitutions and Its Intrinsic Reduced Echinocandin Susceptibility

ABSTRACT

Candida guilliermondii shows intrinsic reduced echinocandin susceptibility. It harbors two polymorphisms (L633M and T634A) in the Fks1p hot spot 1 region. Our objective was to confirm that the reduced echinocandin susceptibility of C. guilliermondii is due to those naturally occurring substitutions. We constructed a Saccharomyces cerevisiae mutant in which a region of the FKS1 gene (including hot spot 1) was replaced with that from C. guilliermondii. The chimeric mutants showed 32-fold increases in echinocandin MIC values, confirming the hypothesis.

TEXT

Echinocandins are the treatment of choice for candidemia, since most Candida spp. are susceptible to these drugs (1–4). However, some highly prevalent Candida spp., such as species of the Candida parapsilosis complex and Candida guilliermondii, show natural reduced echinocandin susceptibility (RES) (5–7). Echinocandin drugs interact with the Fksp subunits of the β-1,3-glucan synthase complex, inhibiting the biosynthesis of the principal cell wall glucan. Clinical resistance was linked to hot spot mutations in Fksp (5). It was molecularly confirmed that the C. parapsilosis sensu lato RES phenotype is due to a naturally occurring substitution (P660A) in the hot spot 1 region of Fks1p (8). C. guilliermondii harbors two polymorphisms (L633M and T634A) in the same Fks1p region; it was assumed that the RES in this species is attributable to these amino acid substitutions, but the hypothesis was never confirmed (5).

The objective of this work was to verify that the intrinsic RES of C. guilliermondii is due to the naturally occurring amino acid changes in the hot spot 1 region of Fks1p. To reach this goal, we constructed a Saccharomyces cerevisiae strain with a hybrid FKS1 gene. A region of the FKS1 gene that includes hot spot 1 was replaced with that from C. guilliermondii. We then evaluated the echinocandin susceptibility.

S. cerevisiae BY4742 was used as the parental strain to obtain S. cerevisiae LMDM 537 (BY4742 FKS1 deletant in which codons 453 to 649 were replaced with URA3, i.e., fks1Δ453–649::URA3) (8). C. guilliermondii ATCC 6260 (Meyerozyma guilliermondii) was used to obtain the 695-nucleotide (nt) region of the FKS1 gene, which was fused to generate the chimeric FKS1 gene (S. cerevisiae-C. guilliermondii). DNA was extracted by phenol-based extraction (9). Caspofungin (CSF) and anidulafungin (ANF) susceptibility tests were performed following CLSI guidelines (10–12), with modifications. For S. cerevisiae susceptibility evaluations, RPMI 1640 broth and Mueller-Hinton 2% glucose-methyl blue agar were replaced by YPD broth (1% yeast extract, 2% peptone, 2% glucose) and YPD agar (YPD broth plus 1.5% agar), respectively. Also, the incubation temperature was changed to 30°C. These modifications were necessary since S. cerevisiae strains did not grow properly with the CLSI-proposed culture media and temperature (8).

A two-step method for PCR-based FKS1 mutagenesis was employed to generate a S. cerevisiae FKS1 chimeric mutant (8, 13, 14). Briefly, the first step consisted of partial deletion of the FKS1 gene of S. cerevisiae BY4742 using an URA3 cassette. The deletion included the Fks1p hot spot 1 region (amino acid residues 453 to 649). This disruption leads to FK506 (tacrolimus) and echinocandin hypersensitivity (8, 15). The transformation was performed and the deletion was confirmed using methodologies described previously (8, 16). The second step of the method was the replacement of the partially deleted S. cerevisiae FKS1 gene (fks1Δ453–649::URA3) by a construction that included a 695-nt portion of the C. guilliermondii FKS1 gene (nt 1591 to nt 2286 of the sequence reported in GenBank under accession number XM_001487741.1) surrounded by S. cerevisiae FKS1 regions from nt 1123 to nt 1611 and from nt 2308 to nt 2548 (S. cerevisiae FKS1 sequence reported in GenBank under accession number U12893.1). This construction was designed to yield, after homologous recombination, a functional FKS1 gene encoding a chimeric Fks1p (S. cerevisiae fks1Δ537–762::C. guilliermondii fks1 531–762) (Fig. 1). The transformation vector was obtained by four PCRs, including amplification of the C. guilliermondii FKS1 fragment (695 nt), the 488-nt portion of the 5′ region of S. cerevisiae FKS1, and the 240 nt of the 3′ fragment of S. cerevisiae FKS1 using the primer pairs Fus5-FKS1-Sc-CguiF/Fus3-FKS1-Sc-CguiR, Fus5-FKS1-Sc-CguiR/FKS1-375, and Fus3-FKS1-Sc-CguiF/LMDM85, respectively. The last PCR was designed to fuse the three fragments using FKS1-375 and LMDM85 primers (see Table 1 for primer details). PCRs were performed in a 25-μl volume, following the manufacturer's instructions for the Pegasus DNA polymerase (PBL, Buenos Aires, Argentina), in an Applied Biosystems thermocycler (Tecnolab-AB, Buenos Aires, Argentina). The construction was cloned into a PGEM-T Easy vector (Promega; Biodynamics, Buenos Aires, Argentina) to yield the plasmid LMDM-P113. S. cerevisiae LMDM 537 (BY4742 fks1Δ453–649::URA3) was transformed with 1 μg of the LMDM-P113 plasmid, following the protocol (lithium acetate) described by Geitz et al. (17). Transformants were selected on FK506 plates and screened for the loss of URA3 as described previously (8). The RES phenotype was screened for using YPD agar with 0.25 μg/ml CSF. Seven chimeric mutants showing the expected phenotype, i.e., uracil auxotrophic, FK506 resistant, and able to grow in the presence of 0.25 μg/ml CSF, were obtained. The FKS1 reconstitution was assessed in all seven mutants by PCR using the primers FKS1-305F and Cg/h-R. These primers hybridize to the S. cerevisiae FKS1 gene (around 900 nt upstream of the start codon) and C. guilliermondii FKS (near hot spot 1). The expected PCR band of 872 nt would be obtained only if the chimeric FKS1 gene was present (Fig. 1). The FKS1 reconstitution was confirmed by sequencing. A revertant control strain (LMDM 537R) was obtained by transforming a 1,000-bp PCR fragment into the S. cerevisiae LMDM 537 strain (17). This fragment was amplified using S. cerevisiae BY4742 DNA and the primers FKS1-375 and FKS1-707R (Table 1). The amplified fragment included the S. cerevisiae FKS1 hot spot 1 region. Homologous recombination produced a strain with a functional FKS1 that was FK506 resistant.

FIG 1.

(A) Clustal alignment of the deduced Fks1p sequences of S. cerevisiae BY4742, S. cerevisiae harboring the chimeric FKS1, and C. guilliermondii ATCC 6260. Black lines show where the C. guilliermondii FKS1 fragment was fused with the S. cerevisiae gene. The black box shows the FKS1 hot spot 1 region. (B) PCR confirmation of the FKS1 reconstitution. Lane 1, markers; lanes 2 to 7, 872-nt PCR fragment of the chimeric FKS1 gene obtained by using the FKS1-305F and Cg/h-R primers and DNA isolated from uracil-auxotrophic and CSF- and FK506-resistant S. cerevisiae transformants. (C, D, and E) Diffusion susceptibility testing using caspofungin disks, following CLSI guidelines (11), for S. cerevisiae BY4742 (C), S. cerevisiae harboring the chimeric FKS1 (D), and C. guilliermondii ATCC 6260 (E).

TABLE 1.

Primers used in this study

Primer	Target organism	Orientation (5′→3′)	Sequence (5′→3′)	Purpose	Reference
FKS1-453-URA3F	S. cerevisiae	Sense	AAAGAGACCCGTACTTGGTTACATTTGGTCACCAACTTCAGAGTGCACCATACCACAGCT	Generation of S. cerevisiae FKS1-deleted mutant	8
FKS1-649-URA3R	S. cerevisiae	Antisense	GTATTCACCTGTACACCTCATTGCAGTGGTGGACAAAATTGGTATTTCACACCGCATAGG	Generation of S. cerevisiae FKS1-deleted mutant	8
URA3iR	S. cerevisiae	Antisense	TGCCTTTAGCGGCTTAACTG	Confirmation of S. cerevisiae FKS1 deletion	8
FKS1-375	S. cerevisiae	Sense	GGTCGTTTTGTCAAGCGTGA	Confirmation of S. cerevisiae FKS1 deletion, chimeric FKS1 construction, and S. cerevisiae FKS1 reconstruction	8
FKS1-707R	S. cerevisiae	Antisense	ATTTCCCAACAGAGAAAATGG	S. cerevisiae FKS1 reconstruction	8
LMDM85	S. cerevisiae	Antisense	CGTAGTGAGGAGTCAATACTGTG	Chimeric FKS1 construction	This study
Fus5-FKS1-Sc-CguiF	S. cerevisiae and C. guilliermondii	Sense	CGTAGATTCTGGTTTTTATGCATCATCTTCGTGGTTAACTTGGCCCC	Chimeric FKS1 construction	This study
Fus5-FKS1-Sc-CguiR	S. cerevisiae and C. guilliermondii	Antisense	GGGGCCAAGTTAACCACGAAGATGATGCATAAAAACCAGAATCTACG	Chimeric FKS1 construction	This study
Fus3-FKS1-Sc-CguiF	S. cerevisiae and C. guilliermondii	Sense	GTACAGAGAACATTTGTTGGCTATTGACCATGTACAAAAATTACTATATC	Chimeric FKS1 construction	This study
Fus3-FKS1-Sc-CguiR	S. cerevisiae and C. guilliermondii	Antisense	GATATAGTAATTTTTGTACATGGTCAATAGCCAACAAATGTTCTCTGTAC	Chimeric FKS1 construction	This study
FKS1-305F	S. cerevisiae	Sense	CCCTGGAAAGAGTTCGTCATATC	Confirmation of FKS1 chimeric reconstitution	This study
Cg/h-R	C. guilliermondii	Antisense	CAAACCACCCAAAGGCATAAC	Confirmation of FKS1 chimeric reconstitution	This study

Parental and revertant S. cerevisiae strains (BY4742 and LMDM 537R, respectively) showed very low CSF and ANF MIC values (0.008 μg/ml), while the seven chimeric strains showed 32-fold higher MICs for both echinocandins (0.25 μg/ml). These values mimicked the C. guilliermondii ATCC 6260 RES phenotype (MICs of 0.25 μg/ml).

C. guilliermondii causes 1.4% of all Candida infections worldwide but is more prevalent in South America (>4%) (6, 18–20). Despite the RES phenotype, most of these infections are treated with echinocandins, since this yeast is also less susceptible to fluconazole than other Candida spp. (21). Most of these infections respond well to echinocandin therapy. However, C. guilliermondii breakthrough infections during caspofungin therapy have been reported (22). Under such circumstances, there is a concern that the use of echinocandins would contribute to an increased prevalence of this species.

It is well known that echinocandin clinical resistance is linked to FKS hot spot substitutions (5). The 32-fold increases in echinocandins MICs observed for the seven chimeric S. cerevisiae mutants support the assumption that L633M and T634A polymorphisms at C. guilliermondii Fks1p hot spot 1 are responsible for the observed RES in this species.