Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2017 Apr 25.
Published in final edited form as: J Appl Toxicol. 2015 Sep 11;36(6):827–835. doi: 10.1002/jat.3216

Altered expression of histone deacetylases, inflammatory cytokines and contractile-associated factors in uterine myometrium of Long Evans rats gestationally exposed to benzo[a]pyrene

Archana Laknaur a, Terri-Lee Foster b, Lesley E Bobb b, Aramandla Ramesh c, Gwinnett M Ladson b, Darryl B Hood d, Ayman Al-Hendy a, Chandrasekhar Thota b,*
PMCID: PMC5404737  NIHMSID: NIHMS854900  PMID: 26358852

Abstract

Etiology of preterm birth (PTB) is multifactorial; therefore, decreasing the incidence of PTB is a major challenge in the field of obstetrics. Epidemiological studies have reported an association between toxicants and PTB. However, there are no studies on the role of benzo[a]pyrene (BaP), an environmental toxicant, in the incidence of PTB. We first assessed the effects of BaP (150 and 300 μg kg−1 body weight) dosed via gavage from day 14 to 17 of pregnancy on gestation length in Long Evans rats. We further assessed the histopathology of the uterus, expression of inflammatory cytokines, contractile-associated factors, histone deacetylases (HDACs) and NFқB-p65 in myometrium collected on day 22 postpartum versus vehicle-treated controls. In our study, rats exposed to BaP delivered prematurely (P < 0.05) compared to control. Hematoxylin and eosin staining of uterus showed squamous metaplasia, glandular and stromal hyperplasia in BaP-exposed rats versus control. The concentrations of BaP metabolites measured by high-pressure liquid chromatography were higher in uterine myometrium of BaP-exposed rats while they were undetectable in controls. Quantitative real-time polymerase chain reaction showed significant increases in mRNA expression of interleukin-1β and -8, tumor necrosis factor-α, connexin 43, cyclo-oxygenase-2 and prostaglandin F2α receptor as compared to controls (P < 0.05). Western blot analysis revealed that BaP exposure caused decreases in class I HDACs 1 and 3 and increases in class II HDAC 5, cyclo-oxygenase-2 and nuclear translocation of NFκB-p65 relative to controls. Our results suggest that gestational exposure to BaP increases incidence of PTB through epigenetic changes that causes increases in the expression of contractile-associated factors through the NFκB pathway.

Keywords: Preterm birth, Benzo(a)pyrene, inflammatory cytokines, connexin 43, Cox2, Histone deacetylases, NFқB, Environmental toxicant, Rats, Uterine myometrium

Introduction

Despite recent advances in medical sciences, the incidence of preterm birth (PTB) remains high (11.7%) costing US$26 billion dollars annually. Epidemiological studies reported an association between environment pollution and PTB as well as environment-induced epigenetic changes and PTB (Bobak 2000; Hansen et al., 2006; Huel et al., 1993; Huynh et al., 2006; Sagiv et al., 2005; Wang et al., 2000). Of the environmental pollutants, polycyclic aromatic hydrocarbons (PAHs) deserve special mention because of their release from automobile exhausts and combustion-related activities. As a good majority of combustion-derived particle sizes fall in the fine and ultrafine (particulate matter < 0.1) category, and the ability of PAHs to adsorb to these particles (Levy et al., 2003) put people who are smokers and inhale contaminated air from occupational settings and vehicular emissions at a greater risk than others. Therefore, exposure to environmental pollutants, such as PAHs are high among populations who live near sources of anthropogenic sources of pollution such as hazardous waste sites, incineration plants and people working in industries such as petroleum handling, coke oven plants, aluminum manufacturing, graphite electrode manufacturing, etc. (Chuang et al., 1999; Wernette and Nieves 1992). Particles with adsorbed PAHs deposit in the lungs, escape phagocytosis by alveolar macrophages and translocate to extrapulmonary organs through circulation (Janerich et al., 1990; Martinez et al., 1994; Schuster-Kolbe and Ludwig 1994). Studies in humans and animal models indicate that PAHs cross the placenta and reach fetal organs (Archibong et al., 2002; Choi et al., 2006; Huel et al., 1993; Perera et al., 2003). It has been suggested that these compounds interfere with placental development and disrupt function of cellular macromolecules such as DNA, RNA and proteins (Choi et al., 2006; Wang et al., 2000). For example, DNA-adducts formed by PAHs in cord blood leukocytes have been linked to decreased birth weights, lengths and head circumferences (Perera et al., 2003). Studies using both animals and humans have shown that PAH exposure adversely affects growth, development and cognitive functions (Choi et al., 2006; Etzel 1997; Weitzman et al., 2002). Despite a large number of studies in this area, studies on disposition of PAH/metabolites in uterine tissue and effects of the metabolites on gestation is absent in the literature.

Exposure to PAHs have been reported to induce proinflammatory cytokines and cause histone modifications, which lead to functionally relevant changes in the genome but do not involve a change in the nucleotide sequence itself (Hou et al., 2012; Veldhoen et al., 2008). Histone acetylation was reported to increase while de-acetylation was reported to decrease the NFқB activity (Greene and Chen 2004). Activation of NFқB in turn was reported to increase inflammatory cytokines locally in the tissues (Karin and Greten 2005). Studies from our laboratory and others have suggested that inflammation increases mRNA and protein content of oxytocin receptor, prostaglandin receptor, connexin 43 and cyclo-oxygenase-2 (COX-2) in the myometrium, that are essential in the parturition process (Romero et al., 2006; Thota et al., 2014). As proinflammatory cytokines have been reported to play a role in full-term as well as in spontaneous preterm deliveries (Gandley et al., 2010; Romero et al., 2008), we hypothesize that exposure to environmental pollutants during pregnancy potentiates epigenetic changes through histone modifications and enhance production of proinflammatory cytokines and expression of contractile-associated factors thereby increasing the risk for PTB.

Environmental tobacco smoke containing several PAHs, including BaP has been reported to alter vascular function (Gandley et al., 2010). BaP has also been implicated in impaired fetal development (Martinez et al., 1994; Weitzman et al., 2002). In utero exposure to BaP has also been shown to impair fertility in F1 mice and was shown to be positively associated with decreases in gonad size and altered folliculogenesis (Archibong et al., 2012; MacKenzie and Angevine 1981). In spite of these findings that suggest a positive correlation between PAH exposure and increases in the incidence of PTB, there have been no studies on the effects of in utero BaP exposure on gestation and on morphological and molecular changes in myometrium postexposure. Therefore, in this study, we assessed the effects of in utero BaP exposure on (1) incidence of PTB, (2) histopathology of uterus, expression of inflammatory cytokines, (3) contractile-associated factors, (4) histone deacetylases (HDACs) and (5) NFκB-p65 in myometrial tissue in postnatal day 22 (PND22) rats.

Materials and methods

Chemicals and reagents

BaP (98% pure) and its metabolite standards (BaP diols, -phenols and -quinones) were purchased from Sigma Chemical Co. (St. Louis, MO, USA) and the National Cancer Institute Chemical Carcinogen Repository (Midwest Research Institute, Kansas City, MO, USA) respectively. Solvents (high-pressure liquid chromatography [HPLC] grade) were obtained from Fisher Scientific Co. (Kennesaw, GA, USA). SYBR green was purchased from Bio-Rad (Hercules, CA, USA).

Animal exposure

Timed-pregnant Long-Evans rats were obtained from Harlan Sprague–Dawley (St. Louis, MO, USA) on gestation day (GD) 11 and were housed in the animal care facility in a climate-controlled room with a 12/12 h light/dark cycle schedule. They were fed standard rat chow and water ad libitum. All the animal care and use protocols were approved by the Institutional Animal Care and Use Committee of Meharry Medical College. Pregnant rats were randomly assigned to control and experimental groups. Dams were given peanut oil alone (control), or 150 and 300 μg kg−1 BaP (Sigma Chemical Co., St. Louis, MO, USA) in a total volume of 0.875 ml peanut oil by oral gavage once daily from GD14 to 17 (Brown et al., 2007). Pregnant rats were observed for labor and delivery from day 17 once every 4 h during the day. The time and day of delivery of the first pup were recorded in control as well as in exposure groups. On an average, deliveries occurring 12–24 h previous term deliveries in controls were considered as pre-term deliveries (Roizen et al., 2008; Wang et al., 2008). Pups were weaned on postpartum day 21. Both the control and BaP-exposed rats were killed on PND22 and uterine tissues were dissected. Part of the uterus was fixed in buffered 10% formalin. Endometrial tissue was separated and discarded and the remaining uterine myometrial tissue was snap frozen in liquid nitrogen and stored at −80 °C until analysis.

Extraction and analyses of myometrial tissue for benzo[a]pyrene metabolites

We subjected myometrium obtained from both control and BaP-exposed rats to liquid–liquid extraction with methanol, chloroform and water. The extracts after further processing and cleanup were analyzed by a reverse phase HPLC method to measure the concentrations of BaP metabolites as described earlier (Ramesh et al., 2001). Six different metabolites, BaP 4,5 diol, BaP 7,8 diol, BaP 9,10 diol, BaP 3,6 dione, 3-hydroxy BaP and 9-hydroxy BaP, were measured and the values are represented as ng g−1 tissue.

Histopathology

To assess the effect of BaP exposure on the histopathology of the uterus we performed hematoxylin and eosin staining. Uterine tissue sections were briefly deparaffinized using xylene and rehydrated. They were first subjected to hematoxylin followed by eosin staining. Slides were then dehydrated using xylene and mounted using Permount. Uterine sections from control and experimental groups were observed under a confocal microscope in a bright field (TE2000-E; Nikon, Tochigi, Japan). All images were captured at × 20 magnification under similar conditions.

Total RNA isolation and reverse transcription

Total RNA was extracted from uterine myometrium obtained from the vehicle- and BaP-treated rats using RNeasy kit as per the supplier’s instructions (Qiagen, Gaithersburg, MD, USA). After removing genomic DNA contamination using DNAse1 (Qiagen), we used 1 μg total RNA to prepare complementary DNA. RNA was mixed briefly with 3.0 nmol of oligodeoxythymine, 200 μmol l−1 deoxyribonucleotide triphosphate, 10 U of avian myeloblastosis virus reverse transcriptase, 5 U of RNase inhibitor in a total volume of 20 μl and subjected to reverse transcription in a thermal cycler set at 25 °C for 10 min and at 42 °C for 60 min for one cycle.

Quantitative polymerase chain reaction

To assess the expression of cytokine, inflammatory genes and contractile-associated proteins, we measured mRNA expression levels of IL-1β, IL-8, TNFα, connexin 43, cox-2 and prostaglandin receptor in the myometrium of rats exposed to BaP (0, 150 and 300 μg kg−1 body weight) by quantitative polymerase chain reaction (PCR). PCR primers used were obtained from published literature (Table 1). All primer sets used for quantitative PCR generated a single amplicon. Briefly, 50 ng of complementary DNA were added to the master mix containing appropriate primers and SYBR green. Quantitative PCR was performed in a Bio-Rad MyiQ5. After an initial denaturation step, cDNA was amplified at 95 °C for 15 s and 60 °C for 1 min for 40 cycles using gene-specific primers. The GAPDH values of the respective samples were used to normalize the data.

Table 1.

Primers for chemokine, cytokines and contractile-associated factors

Primers Accession no. Forward primer Reverse primer
TNFα NM_012675.3 5′-AAATGGGCTCCCTCTCATCAGTTC-3′ (339–362) 5′ TCTGCTTGGTGGTTTGCTACGAC 3′ (446–427)
IL-1β NM_031512.2 5′-CACCTCTCAAGCAGAGCACAG-3′ (773–793) 5′ GGGTTCCATGGTGAAGTCAAC3′ (851–831)
IL-8 NM_011339.2 5′-AATTTCCACCGGCAATGAAGC-3′ (339–359) 5′ AGGTCTCCCGAATTGGAAAGG 3′ (452–432)
Connexin 43 NM_012567.2 5′-TGTAACACTCAACAACCTGGC-3′ (356–376) 5′-GGTTTTCTCCGTGGGACGTGA-3′ (817–797)
Prostaglandin receptor F2α NM_013115.1 5′-TCAGCAGCACAGGCAAGGCA-3′ (835–854) 5′-TGGCCATCGTCACCAGAAAGGGA-3′ (944–922)
Cox-2 NM_017232.3 5′-ATGACGAGCGACTGTTCCAA-3′ (929–948) 5′-TGAAGTGGTAACCGCTCAGG-3′ (1030–1011)
GAPDH NG_007904.2 5′-GTATTGGGCGCCTGGTCACC-3′ (146–165) 5′-CGC TCC TGG AAG ATG GTG ATG G-3′ (353–332)
Open in a new tab

Cox-2, cyclo-oxygenase 2; IL, interleukin; TNF, tumor necrosis factor.

Whole cell lysate preparation

We prepared whole cell lysates from myometrial tissue of rats, as described earlier (Thota et al., 2014). Briefly, 25 mg of myometrium tissue was ground to powder in liquid nitrogen using pestle and mortar. An ice-cold RIPA buffer containing × 1 protease inhibitor cocktail, 1 mM sodium vanadate and 1 mM sodium fluoride (Sigma) was added to the homogenized tissue and triturated using a p1000 micropipette. The whole cell lysate was stored at −80 °C until further use.

Cytosol and nuclear protein preparation

Cytosol and nuclear fractions of myometrium were prepared using NE-PER nuclear and cytoplasmic extraction reagent (Thermo Scientific, Rockford, IL, USA) according to the suppliers’ instructions. Myometrial tissue was cut into pieces weighing about 20–100 mg. After a brief wash with phosphate-buffered saline, tissue pieces were ground in CER I reagent using pestle and mortar. The ground tissue was vortexed for 15 s at high speed (16 000 g) on a bench top centrifuge followed by a10 min incubation on ice. Next CER II reagent was added to the tubes, vortexed and incubated again for 1 min on ice. Tubes were then centrifuged at 16 000 g for 5 min and the supernatant (cytoplasmic fraction) was transferred immediately into a clean prechilled tube and stored at −80 °C until use. Nuclear pellets were suspended in ice-cold NER reagent and vortexed for 15 s every 10 min for a total of 40 min. Tubes were then centrifuged at high speed (16 000 g) for 10 min and the supernatant (nuclear fraction) was stored immediately at −80 °C until further use.

Western blot analysis

Western blot analysis was performed using equal amounts of protein. Whole cell lysates, cytosolic and nuclear fractions were resolved on a 10% Tris-Bis gels and transferred on to PVDF membranes. Western blot analysis was performed using primary antibodies against cox-2 (1 : 500; Cayman Chemicals, Ann Arbor, MI), HDACs 1, 3, 4 and 5 (1 : 1000; Cell Signaling, Beverly, MA) and NFқB-p65 (2 ng ml−1; Abcam, Cambridge, MA). Intensity of protein signals observed in autoradiographs was quantified using image documentation system (ProteinSimple, Santa Clara, CA, USA) and normalized with the corresponding β-actin (1 : 5000; Sigma) values.

Statistical analysis

Statistical analysis of quantitative PCR data was performed using the Bio-Rad iQ5 Optical System Software Version 2.0. Two-way ANOVA was used to evaluate differences in metabolite concentrations between the controls and BaP treatments. One-way ANOVA was used to evaluate differences between treatments and control. The data are represented as the mean ± SEM of five separate experiments.

Results

Rats treated with benzo[a]pyrene delivered preterm

Rats exposed to 150 μg of BaP from embryonic day 14 to 17 during pregnancy delivered at 21.20 ± 0.35 and those exposed to 300 μg kg−1 delivered at 20.90 ± 0.35 days as compared to rats in the control (vehicle) group that delivered at 22.25 ± 0.35 days of gestation (P < 0.05).

Concentrations of benzo[a]pyrene metabolites in myometrial tissue of benzo[a]pyrene-exposed rats are significantly higher

The BaP metabolites detected in myometrium samples were BaP 4,5-diol, BaP 7,8-diol, BaP 9,10-diol, BaP 3,6-dione, 3-hydroxy BaP and 9-hydroxy BaP. The concentrations of the above BaP metabolites measured showed a dose-dependent increase with the 300 μg kg−1 BaP treatment group registering greater concentrations than its 150 μg kg−1 counterpart (Fig. 1).

Figure 1.

Figure 1

Open in a new tab

Metabolite composition of BaP in myometrial tissue obtained from Long Evans rats pre-exposed to BaP. Six different metabolites: BaP 4,5 diol, BaP 7,8 diol, BaP 9,10 diol, BaP 3,6 diol, 3-hydroxy BaP and 9-hydroxy BaP were measured in myometrium in rats gavaged with 150 and 300 μg kg−1 body weight of BaP from gestation day 14 to 17 and killed on day 22 postpartum. The values are represented as ng g−1 tissue. Sum of individual concentrations of BaP metabolites formed (n = 5 for each treatment category) is represented as total. Groups with asterisks (**P < 0.01) are significantly different from the vehicle-treated control. BaP, benzo[a]pyrene.

Immunohistochemical analysis of rat uterine tissues exposed in utero to benzo[a]pyrene showed structural abnormalities

We performed hematoxylin and eosin staining to assess the effects of BaP exposure on histopathology of uterus. On examination under a microscope after staining, we observed hyperplasia in the glandular region of the uterus in rats treated with 150 μg and stromal hyperplasia and squamous metaplasia in rats treated with 300 μg of BaP compared to rats in the control (vehicle) group (Fig. 2).

Figure 2.

Figure 2

Open in a new tab

H&E staining of uterus obtained from Long Evans rats pre-exposed benzo(a)Pyrene [B(a)P]. Pregnant rats were gavaged with 150, and 300ug/kg body wt. of B(a)P once every day from D14–17 of pregnancy. Dams were sacrificed on day 22 and uterus collected was subjected to H&E staining. Uterus from rats treated with 150ug of B(a)P showed hyperplasia in stromal region compared to control while those treated with 300ug of B(a)P showed hyperplasia in glandular region (lower left) and metaplasia in squamous epithelium (lower right).

Messenger RNA expression of proinflammatory markers was significantly higher in uterine myometrial tissue of benzo[a]pyrene-exposed rats

To assess if changes observed in the morphology of the uterus are because of increased expression of inflammatory markers and contractile-associated factors we measured their mRNA expression using the PCR technique. Real-time PCR analysis of cDNA obtained from myometrium showed a significant (P < 0.05) increase in mRNA expression of IL-1β, IL-8 and TNFα (Fig. 3) and connexin 43, cox-2 and prostaglandin receptor 2α (Fig. 4) in BaP-treated rats compared to the vehicle-treated controls.

Figure 3.

Figure 3

Open in a new tab

Effect of BaP on the MRNA expression of chemokine and cytokine genes in myometrial tissue obtained from Long Evans rats. Pregnant rats were gavaged with 150 and 300 μg kg−1 body weight of BaP once every day from gestation day 14 to 17. Myometrium tissue was collected on day 22 postpartum and the effects on IL-8, IL-1β and TNFα were assessed using reverse transcription and qPCR analysis. Data were normalized to respective GAPDH values. The bars represent the mean ± SEM from five replicates in each group. Groups with asterisks (*P < 0.05; **P < 0.01) are significantly different from control. BaP, benzo[a]pyrene; IL, interleukin; TNF, tumor necrosis factor. [Correction added on 16 October 2015, after first online publication: “BaP (μg)” corrected to “BaP (μg kg −1)” in the x-axis legend.]

Figure 4.

Figure 4

Open in a new tab

Effect of BaP on the mRNA expression of contractile-associated genes in myometrial tissue obtained from Long Evans rats. Pregnant rats were gavaged with 150 and 300 μg kg−1 body weight of BaP from gestation days 14 to 17. Myometrium tissue was collected on day 22 postpartum and the effects on the prostaglandin F2α receptor, cox-2 and connexin-43 were assessed using reverse transcription and qPCR analysis. The data were normalized to respective GAPDH values. The bars represent the mean ± SEM from five replicates in each group. Groups with asterisks (*P < 0.05;**P < 0.01) are significantly different from control. BaP, benzo[a]pyrene; Cont, control.

Upregulation of contractile-associated factor protein expression in benzo[a]pyrene-exposed rats

To confirm the changes observed in cox-2 mRNA expression we performed Western analysis.

Results showed a significant increase (P < 0.05) in cox-2 expression in rats treated with 300 μg of BaP-versus vehicle-treated controls (Fig. 5).

Figure 5.

Figure 5

Open in a new tab

Effect of BaP on the protein expression of cox-2 in myometrial tissue obtained from Long Evans rats. Pregnant rats were gavaged with 150 and 300 μg kg−1 body weight of BaP from gestation day 14 to 17. Myometrium tissue was collected on day 22 postpartum and the effect on cox-2 expression was assessed using Western analysis. The data were normalized to respective β-actin values. The bars represent the mean ± SEM from five replicates in each group. Groups with asterisks (**P < 0.01) are significantly different from control. BaP, benzo[a]pyrene; Cont, control.

Histone deacetylase expression is differentially regulated in benzo[a]pyrene-exposed rats

Because epigenetic changes have been reported to play a role in increased inflammation, we measured protein expression of HDACs in the myometrium of rats treated with BaP. Western analysis of whole cell lysate obtained from rat myometrium exposed to BaP showed a significant decrease (P < 0.05) in HDACs 1 and 3, while HDAC 5 showed a significant increase (P < 0.05) compared to the control. No significant increases were observed in HDAC 4 (Fig. 6).

Figure 6.

Figure 6

Open in a new tab

Effect of BaP on the protein expression of HDACs in myometrial tissue obtained from Long Evans rats. Pregnant rats were gavaged with 150 and 300 μg kg−1 body weight of BaP from gestation day 14 to 17. Myometrium tissue was collected day 22 postpartum and the effects on class 1 HDACs 1 and 3 and class 2 HDACs 4, 5 and 6 were assessed using Western analysis. The data were normalized to respective β-actin values. The bars represent the mean ± SEM from five replicates in each group. Groups with asterisks (*P < 0.05;**P < 0.01) are significantly different from control. BaP, benzo[a]pyrene; HDACs, histone deacetylases.

Benzo[a]pyrene-treatment enhanced nuclear translocation of NFκB-p65 in rats

Furthermore, to assess if changes in HDACs affect the NFқB pathway, we measured NFқB-p65 in cytosolic and nuclear fractions in myometrium obtained from both control and BaP-exposed rats. The expression of NFқB-p65 was significantly higher (P < 0.05) in the nuclear fraction and lower (P < 0.05) in the cytosolic fraction of myometrium obtained from BaP-exposed versus controls (Fig. 7).

Figure 7.

Figure 7

Open in a new tab

Effect of BaP on the expression of NFқB-p65 in myometrial tissue obtained from Long Evans rats. Pregnant rats were gavaged with BaP from gestation day 14 to 17. Cytosolic and nuclear fractions prepared from myometrium tissue collected on day 22 postpartum were subjected to Western analysis using NFқB-p65 antibodies. The data were normalized to respective β-actin values. The bars represent the mean ± SEM from five replicates in each group. Groups with asterisks (*P < 0.05;**P < 0.01) are significantly different from control. BaP, benzo[a]pyrene.

Discussion

The BaP doses used in this study were chosen based on published reports and allowing for scenarios of exposure to episodic release of high levels of BaP into the general or occupational environment in some circumstances. Diet-related BaP intake by humans have been reported to range from 8.4 μg person−1 day−1 (Falco et al., 2003) to 17 μg person−1 day−1 (de Vos et al., 1990). An additional intake of 0.1 μg day−1 is expected for smokers, who use a pack of cigarettes per day, as mainstream smoke yield of BaP per cigarette amounts to 10 ng per cigarette (Grimmer et al., 1987). In this context, a 3 h stay in pubs/taverns exposes patrons to 6.3 ng m−3 BaP released from environmental tobacco smoke (Besaratinia et al., 2002; Bolte et al., 2008) with a greater propensity of repeated exposure of waitresses and bartenders to BaP in unrestricted smoking areas in these establishments. Coke oven workers are exposed to 42 μg m−3 BaP (Lewtas et al., 1997). Mean concentrations of BaP in the ambient air of highly polluted cities have been estimated to peak at about 20 μg m−3 (Chorazy et al., 1994). Furthermore, indoor exposure to BaP from cooking oil fumes range between 19 and 23 μg m−3 (Chiang et al., 1999). In rural areas of poor countries, where women use firewood for cooking and home heating, exposes them to 100 μg BaP m−3 (Viau et al., 2000). Therefore, either individual or cumulative exposure of women to all the above-mentioned BaP sources in some settings cannot be ignored, which may poses a hazard to their successful child-bearing abilities.

Our results demonstrate that in utero exposure to BaP results in preterm delivery of offspring. HPLC analysis of myometrial tissue samples obtained from BaP-exposed rats showed higher concentrations of BaP metabolites. We documented increases in inflammatory cytokines IL-1β, IL-8 and TNFα, inflammatory markers cox-2, contractile-associated protein connexin 43 and prostaglan-din receptor PGF2α in BaP-exposed rats. Our studies revealed a robust downregulation in the expression of HDACs 1 and 3, and upregulation in HDAC 5 protein expression in BaP-exposed rats. Additionally, BaP-exposed rats demonstrated a propensity for upregulation of NFқB protein expression in the nuclear fraction with an apparent corresponding decrease in the cytosolic fraction in myometrial tissue, as compared to the control rats. Results from this study suggest that BaP exposure during pregnancy increase the incidence of PTB by precipitating epigenetic changes that probably enhance expression of inflammatory cytokines and contractile-associated factors via the NFқB pathway.

BaP-exposed rats in our study showed a significant reduction in gestation length as compared to controls. To our knowledge, this is the first report on the length of gestation in rats treated with BaP. Other studies reported decreases in fetal survival and fetal growth in F-344 rats exposed to BaP through inhalation (Archibong et al., 2002, 2012). BaP was reported to metabolize in uterine tissues (Ramesh et al., 2001). Increase observed in BaP metabolites in uterine myometrium of rats pre-exposed to BaP in our study indicates that these BaP metabolites are probably involved in the disruption of myometrial function leading to increased incidence in PTB. Increases in BaP metabolites have been reported to affect fetal survival and growth negatively (Bobak 2000; Choi et al., 2008; Geer et al., 2012; Martinez et al., 1994; Perera et al., 2003). Within this context, it is of interest to note that, exposure to tobacco smoke- and traffic-related air toxicants has been reported to cause preterm deliveries (Fantuzzi et al., 2007; Machado et al., 2014; Padula et al., 2014; Wilhelm et al., 2011). Findings from this study support the contention that disposition of BaP metabolites in myometrium contribute to the incidence of PTB. Based on our current findings, we believe that increased incidence of PTB in a minority population is at least partially due to higher exposure to PAHs in this population (Chuang et al., 1999; Wernette and Nieves 1992).

We observed glandular hyperplasia in rats treated with 150 μg and stromal hyperplasia in the uterus of rats exposed to 300 μg of BaP kg body weight. Similar changes in the glandular cells of the airway tract were reported in mice exposed to tobacco smoke suggesting that exposure to environmental pollutants produces systemic effects (Jones and Reid 1978). Furthermore, increases observed in the expression of inflammatory cytokines IL-1β, IL-8 and TNFα in rats exposed to BaP in the present study and PAHs in other studies (N’Diaye et al., 2006; Veldhoen et al., 2008), suggests that environmental pollutants have the potential to increase the inflammatory response. We assessed if an increase in inflammation observed in dams treated with BaP lead to increase in contractile-associated factors. Results from our study showed an increase in connexin 43and cox-2 an enzyme involved in the synthesis of prostaglandin F2α receptor in BaP-exposed rats. This along with the increases observed in aortic smooth muscle cell contractions subsequent to BaP treatment (Yan et al., 2000), suggests that BaP causes contractions through increases in contractile-associated factors. To our knowledge, this is the first such study reporting increases in biochemical factors involved in parturition subsequent to BaP exposure. These results suggest that BaP enhances the expression of inflammatory cytokines, which in turn increase contractile-associated factors. However, additional studies are needed to understand the molecular level mechanism involved in BaP-induced increases in contractile-associated factors in the uterus during the process of parturition.

Because exposure to environmental pollutants cause epigenetic changes that can negatively impact the normal development and function of the uterus, we assessed the expression of HDACs in the myometrium of PND22 rats exposed to BaP during pregnancy. The results showed an overall modulation of protein expression with downregulation of class I HDAC 1and 3 and upregulation in class II HDAC 5 in BaP-exposed rats. Despite the limitations to the interpretation of our findings, we support the contention that selective acetylation and deacetylation of genes and selective transcription leads to increases in inflammatory and contractile-associated factors (Teneng et al., 2011). Supporting this contention, increases in HDAC 3 have been reported to repress transcriptional activity of NFκB, while decreases in HADC 3 were reported to cause increases in inflammatory response (Chen et al., 2001; Greene and Chen 2004; Rahman and Adcock 2006). Long-term exposures to HDAC inhibitors have been reported to decrease NFқB DNA binding and decrease in proinflammatory markers (Lindstrom et al., 2008). Even though HDAC 5 is reported to play a role in skeletal myogenesis (McKinsey et al., 2000), there are no reports to date on its role in myometrial contractions in the pregnant uterus. Therefore, further investigation is needed to assess its role. Taken together, these reports are supportive of the findings in the present study towards in utero BaP exposure being a risk factor for PTB. Decrease in HDACs 1 and 3 and a consequent increase in cytokines and contractile factors in BaP-exposed rats in our study further confirms the role of HDACs in the repression of transcription. Additional studies are needed to elucidate the mechanism involved in HDACs 1- and 3-induced nuclear translocation of NFқB-p65 in BaP-exposed rats. However, this finding is strongly suggestive of our contention that the inflammatory response was mediated by NFқB. While increases in HDAC 3 have been reported to repress transcriptional activity of NFκB, long-term exposures to HDAC inhibitors have been reported to decrease NFқB DNA binding and thus, decrease proinflammatory markers suggesting a controversial role for HDACs in mediating inflammation responses (Chen et al., 2001; Lindstrom et al., 2008).

From a human exposure standpoint, our studies have serious implications. Exposure of women to BaP and other PAHs emanated during cooking and home heating with biomass or fossil fuels rich in PAHs (Zhang and Smith 1996) place them at a greater risk concerning their fertility and childbearing. The same analogy could be applied to women who smoke and work in unregulated occupational settings. As epigenetic changes imposed by BaP exposure from the above-mentioned exposure scenarios adversely affect the uterine function, additional studies are warranted to characterize fully the effects of in utero exposure to BaP on the role of individual HDACs.

Acknowledgments

This study was funded by National Institute on Minority Health and Health Disparities (NIMHD) RCMI 5G12RR003032-27 and MeTRC 5U54MD007593.

Footnotes

Conflicts of interest

The authors did not report any conflict of interest.

References

  1. Archibong AE, Inyang F, Ramesh A, Greenwood M, Nayyar T, Kopsombut P, Hood DB, Nyanda AM. Alteration of pregnancy related hormones and fetal survival in F-344 rats exposed by inhalation to benzo(a)pyrene. Reprod Toxicol. 2002;16:801–808. doi: 10.1016/s0890-6238(02)00058-8. [DOI] [PubMed] [Google Scholar]
  2. Archibong AE, Ramesh A, Inyang F, Niaz MS, Hood DB, Kopsombut P. Endocrine disruptive actions of inhaled benzo(a)pyrene on ovarian function and fetal survival in fisher F-344 adult rats. Reprod Toxicol. 2012;34:635–643. doi: 10.1016/j.reprotox.2012.09.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Besaratinia A, Maas LM, Brouwer EMC, Moonen EJC, Dekok TMCM, Wesseling GJ, Loft S, Kleinjans JCS, van Schooten FJ. A molecular dosimetry approach to assess human exposure to environmental tobacco smoke in pubs. Carcinogenesis. 2002;23:1171–1176. doi: 10.1093/carcin/23.7.1171. [DOI] [PubMed] [Google Scholar]
  4. Bobak M. Outdoor air pollution, low birth weight, and prematurity. Environ Health Perspect. 2000;108:173. doi: 10.1289/ehp.00108173. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Bolte G, Heitmann D, Kiranoglu M, Schierl R, Diemer J, Koerner W, Fromme H. Exposure to environmental tobacco smoke in German restaurants, pubs and discotheques. J Expo Sci Environ Epidemiol. 2008;18:262–271. doi: 10.1038/sj.jes.7500590. [DOI] [PubMed] [Google Scholar]
  6. Brown LA, Khoshbouei H, Goodwin JS, Irvin-Wilson CV, Ramesh A, Sheng L, McCallister MM, Jiang GCT, Aschner M, Hood DB. Downregulation of early ionotrophic glutamate receptor subunit developmental expression as a mechanism for observed plasticity deficits following gestational exposure to benzo(a)pyrene. Neurotoxicology. 2007;28:965–978. doi: 10.1016/j.neuro.2007.05.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Chen LF, Fischle W, Verdin E, Greene WC. Duration of nuclear NF-kappaB action regulated by reversible acetylation. Science. 2001;293:1653–1657. doi: 10.1126/science.1062374. [DOI] [PubMed] [Google Scholar]
  8. Chiang T-A, Wu P-F, Ko Y-C. Identification of carcinogens in cooking oil fumes. Environ Res A. 1999;81:18–22. doi: 10.1006/enrs.1998.3876. [DOI] [PubMed] [Google Scholar]
  9. Choi H, Jedrychowski W, Spengler J, Camann DE, Whyatt RM, Rauh V, Tsai WY, Perera FP. International studies of prenatal exposure to polycyclic aromatic hydrocarbons and fetal growth. Environ Health Perspect. 2006;114:1744–1750. doi: 10.1289/ehp.8982. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Choi H, Rauh V, Garfinkel R, Tu Y, Perera FP. Prenatal exposure to airborne polycyclic aromatic hydrocarbons and risk of intrauterine growth restriction. Environ Health Perspect. 2008;116:658–666. doi: 10.1289/ehp.10958. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Chorazy M, Szeliga J, Strozyk M, Cimander B. Ambient air pollutants in upper Silesia: partial chemical composition and biological activity. Environ Health Perspect. 1994;102(Suppl 4):61–66. doi: 10.1289/ehp.94102s461. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Chuang JC, Callahan PJ, Lyu CW, Wilson NK. Polycyclic aromatic hydrocarbon exposures of children in low-income families. J Expo Anal Environ Epidemiol. 1999;9:85–98. doi: 10.1038/sj.jea.7500003. [DOI] [PubMed] [Google Scholar]
  13. de Vos RH, van Dokkum W, Schouten A, deJong-Berkhout P. Polycyclic aromatic hydrocarbons in Dutch total diet samples (1984–1986) Food Chem Toxicol. 1990;28:263–268. doi: 10.1016/0278-6915(90)90038-o. [DOI] [PubMed] [Google Scholar]
  14. Etzel RA. Active and passive smoking: hazards for children. Cent Eur J Public Health. 1997;5:54–56. [PubMed] [Google Scholar]
  15. Falco G, Domingo JL, Llobet JM, Teixido C, Muller L. Polycyclic aromatic hydrocarbons in foods: Human exposure through the diet in Catalonia, Spain. J Food Prot. 2003;60:2325–2331. doi: 10.4315/0362-028x-66.12.2325. [DOI] [PubMed] [Google Scholar]
  16. Fantuzzi G, Aggazzotti G, Righi E, Facchinetti F, Bertucci E, Kanitz S, Barbone F, Sansebastiano G, Battaglia MA, Leoni V, Fabiani L, Triassi M, Sciacca S. Preterm delivery and exposure to active and passive smoking during pregnancy: a case-control study from Italy. Paediatr Perinat Epidemiol. 2007;21:194–200. doi: 10.1111/j.1365-3016.2007.00815.x. [DOI] [PubMed] [Google Scholar]
  17. Gandley RE, Jeyabalan A, Desai K, McGonigal S, Rohland J, DeLoia JA. Cigarette exposure induces changes in maternal vascular function in a pregnant mouse model. Am J Physiol Regul Integr Comp Physiol. 2010;298:R1249–R1256. doi: 10.1152/ajpregu.00274.2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Geer LA, Weedon J, Bell ML. Ambient air pollution and term birth weight in Texas from 1998 to 2004. J Air Waste Manag Assoc. 2012;62:1285–1295. doi: 10.1080/10962247.2012.707632. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Greene WC, Chen LF. Regulation of NF-kappaB action by reversible acetylation. Novartis Found Symp. 2004;259:208–217. discussion 218–225. [PubMed] [Google Scholar]
  20. Grimmer G, Naujack KW, Dettbarn G. Gas chromatographic determination of polycyclic aromatic hydrocarbon, aza-arenes, aromatic amines in the particles and vapor phase of mainstream smoke of cigarettes. Toxicol Lett. 1987;35:117–124. doi: 10.1016/0378-4274(87)90095-6. [DOI] [PubMed] [Google Scholar]
  21. Hansen C, Neller A, Williams G, Simpson R. Maternal exposure to low levels of ambient air pollution and preterm birth in Brisbane, Australia. BJOG. 2006;113:935–941. doi: 10.1111/j.1471-0528.2006.01010.x. [DOI] [PubMed] [Google Scholar]
  22. Hou L, Zhang X, Wang D, Baccarelli A. Environmental chemical exposures and human epigenetics. Int J Epidemiol. 2012;41:79–105. doi: 10.1093/ije/dyr154. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Huel G, Godin J, Frery N, Girard F, Moreau T, Nessmann C, et al. Arylhydrocarbon hydroxylase activity in human placenta and threatened preterm delivery. J Exp Anal Environ Epidemiol. 1993;3:187–199. [PubMed] [Google Scholar]
  24. Huynh M, Woodruff TJ, Parker JD, Schoendorf KC. Relationships between air pollution and preterm birth in California. Paediatr Perinat Epidemiol. 2006;20:454–461. doi: 10.1111/j.1365-3016.2006.00759.x. [DOI] [PubMed] [Google Scholar]
  25. Janerich DT, Thompson WD, Varela LR, Greenwald P, Chorost S, Tucci C, et al. Lung cancer and exposure to tobacco smoke in the household. N Engl J Med. 1990;323:632–636. doi: 10.1056/NEJM199009063231003. [DOI] [PubMed] [Google Scholar]
  26. Jones R, Reid L. Secretory cell hyperplasia and modification of intracellular glycoprotein in rat airways induced by short periods of exposure to tobacco smoke, and the effect of the antiinflammatory agent phenylmethyloxadiazole. Lab Invest. 1978;39:41–49. [PubMed] [Google Scholar]
  27. Karin M, Greten F. NF-kappaB: linking inflammation and immunity to cancer development and progression. Nat Rev Immunol. 2005;5:749–759. doi: 10.1038/nri1703. [DOI] [PubMed] [Google Scholar]
  28. Levy JI, Bennett D, Melly S, Spengler J. Influence of traffic patterns on particulate matter and polycyclic aromatic hydrocarbon concentrations in Roxbury, Massachusetts. J Expo Anal Environ Epidemiol. 2003;13:364–371. doi: 10.1038/sj.jea.7500289. [DOI] [PubMed] [Google Scholar]
  29. Lewtas J, Walsh D, Williams R, Dobias L. Air pollution exposure-DNA adduct dosimetry in humans and rodents: evidence for non-linearity at high doses. Mutat Res. 1997;378:51–63. doi: 10.1016/s0027-5107(97)00097-3. [DOI] [PubMed] [Google Scholar]
  30. Lindstrom TM, Mohan AR, Johnson MR, Bennett PR. Histone deacetylase inhibitors exert time-dependent effects on nuclear factor-kappaB but consistently suppress the expression of proinflammatory genes in human myometrial cells. Mol Pharmacol. 2008;74:109–121. doi: 10.1124/mol.107.042838. [DOI] [PubMed] [Google Scholar]
  31. Machado JB, Chatkin JM, Zimmer AR, Goulart AP, Thiesen FV. Cotinine and polycyclic aromatic hydrocarbons levels in the amniotic fluid and fetal cord at birth and in the urine from pregnant smokers. PLoS One. 2014;9(12):e116293. doi: 10.1371/journal.pone.0116293. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. MacKenzie KM, Angevine DM. Infertility in mice exposed in utero to benzo(a)pyrene. Biol Reprod. 1981;24:183–191. doi: 10.1095/biolreprod24.1.183. [DOI] [PubMed] [Google Scholar]
  33. Martinez FD, Wright AL, Taussig LM. The effect of paternal smoking on the birth weight of newborns whose mothers did not smoke. Am J Public Health. 1994;84:1489–1491. doi: 10.2105/ajph.84.9.1489. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. McKinsey TA, Zhang CL, Lu J, Olson EN. Signal-dependent nuclear export of a histone deacetylase regulates muscle differentiation. Nature. 2000;408:106–111. doi: 10.1038/35040593. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. N’Diaye M, Le Ferrec E, Lagadic-Gossmann D, Corre S, Gilot D, Lecureur V, Monteiro P, Rauch C, Galibert MD, Fardel O. Aryl hydrocarbon receptor- and calcium-dependent induction of the chemokine CCL1 by the environmental contaminant benzo[a]pyrene. J Biol Chem. 2006;281:19906–19915. doi: 10.1074/jbc.M601192200. [DOI] [PubMed] [Google Scholar]
  36. Padula AM, Noth EM, Hammond SK, Lurmann FW, Yang W, Tager IB, Shaw GM. Exposure to airborne polycyclic aromatic hydrocarbons during pregnancy and risk of preterm birth. Environ Res. 2014;135:221–226. doi: 10.1016/j.envres.2014.09.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Perera FP, Rauh V, Tsai WY, Kinney P, Camann D, Barr D, et al. Effects of transplacental exposure to environmental pollutants on birth outcomes in a multi-ethnic population. Environ Health Perspect. 2003;111:201–205. doi: 10.1289/ehp.5742. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Rahman I, Adcock IM. Oxidative stress and redox regulation of lung inflammation in COPD. Eur Respir J. 2006;28:219–242. doi: 10.1183/09031936.06.00053805. [DOI] [PubMed] [Google Scholar]
  39. Ramesh A, Inyang F, Hood DB, Archibong AE, Knuckles ME, Nyanda AM. Metabolism, bioavailability, and toxicokinetics of benzo(alpha) pyrene in F-344 rats following oral administration. Exp Toxicol Pathol. 2001;53:275–290. doi: 10.1078/0940-2993-00192. [DOI] [PubMed] [Google Scholar]
  40. Roizen JD, Asada M, Tong M, Tai HH, Muglia LJ. Preterm birth without progesterone withdrawal in 15-hydroxyprostaglandin dehydrogenase hypomorphic mice. Mol Endocrinol. 2008;22:105–112. doi: 10.1210/me.2007-0178. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Romero R, Espinoza J, Goncalves LF, Kusanovic JP, Friel LA, Nien JK. Inflammation in preterm and term labour and delivery. Semin Fetal Neonatal Med. 2006;11:317–326. doi: 10.1016/j.siny.2006.05.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Romero R, Espinoza J, Rogers WT, Moser A, Nien JK, Kusanovic JP, Gotsch F, Erez O, Gomez R, Edwin S, Hassan SS. Proteomic analysis of amniotic fluid to identify women with preterm labor and intra-amniotic inflammation/infection: the use of a novel computational method to analyze mass spectrometric profiling. J Matern Fetal Neonatal Med. 2008;21:367–388. doi: 10.1080/14767050802045848. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Sagiv SK, Mendola P, Loomis D, Herring AH, Neas LM, Savitz DA, Poole C. A time-series analysis of air pollution and preterm birth in Pennsylvania, 1997–2001. Environ Health Perspect. 2005;113:602–606. doi: 10.1289/ehp.7646. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Schuster-Kolbe J, Ludwig H. Smoking and the risk of cancer. Wien Med Wochenschr. 1994;144:540–544. [PubMed] [Google Scholar]
  45. Teneng I, Montoya-Durango DE, Quertermous JL, Lacy ME, Ramos KS. Reactivation of L1 retrotransposon by benzo(a)pyrene involves complex genetic and epigenetic regulation. Epigenetics. 2011;6:355–367. doi: 10.4161/epi.6.3.14282. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Thota C, Laknaur A, Farmer T, Ladson G, Al-Hendy A, Ismail N. Vitamin D regulates contractile profile in human uterine myometrial cells via NF-kappaB pathway. Am J Obstet Gynecol. 2014;210:347e1–347.e10. doi: 10.1016/j.ajog.2013.11.027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Veldhoen M, Hirota K, Westendorf AM, Buer J, Dumoutier L, Renauld JC, Stockinger B. The aryl hydrocarbon receptor links TH17-cell-mediated autoimmunity to environmental toxins. Nature. 2008;453:106–109. doi: 10.1038/nature06881. [DOI] [PubMed] [Google Scholar]
  48. Viau C, Hakizimana G, Bouchard M. Indoor exposure to polycyclic aromatic hydrocarbons and carbon monoxide in traditional houses in Burundi. Int Arch Occup Environ Health. 2000;73:331–338. doi: 10.1007/s004209900112. [DOI] [PubMed] [Google Scholar]
  49. Wang X, Chen D, Niu T, Wang Z, Wang L, Ryan L, Smith T, Christiani DC, Zuckerman B, Xu X. Genetic susceptibility to benzene and shortened gestation: evidence of gene-environment interaction. Am J Epidemiol. 2000;152:693–700. doi: 10.1093/aje/152.8.693. [DOI] [PubMed] [Google Scholar]
  50. Wang H, Xie H, Dey SK. Loss of cannabinoid receptor CB1 induces preterm birth. PLoS One. 2008;3:e3320. doi: 10.1371/journal.pone.0003320. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Weitzman M, Byrd RS, Aligne CA, Moss M. The effects of tobacco exposure on children’s behavioral and cognitive functioning: implications for clinical and public health policy and future research. Neurotoxicol Teratol. 2002;24:397–406. doi: 10.1016/s0892-0362(02)00201-5. [DOI] [PubMed] [Google Scholar]
  52. Wernette DR, Nieves LA. Breathing polluted air: minority disproportionately exposed. EPA J. 1992;18:16–17. [Google Scholar]
  53. Wilhelm M, Ghosh JK, Su J, Cockburn M, Jerrett M, Ritz B. Traffic-related air toxics and preterm birth: a population-based case-control study in Los Angeles County, California. Environ Health. 2011;10:89. doi: 10.1186/1476-069X-10-89. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Yan Z, Subbaramaiah K, Camilli T, Zhang F, Tanabe T, McCaffrey TA, Dannenberg AJ, Weksler BB. Benzo[a]pyrene induces the transcription of cyclooxygenase-2 in vascular smooth muscle cells, Evidence for the involvement of extracellular signal-regulated kinase and NF-kappaB. J Biol Chem. 2000;275:4949–4955. doi: 10.1074/jbc.275.7.4949. [DOI] [PubMed] [Google Scholar]
  55. Zhang J, Smith KR. Hydrocarbon emissions and health risks from cook stoves in developing countries. J Expo Anal Environ Epidemiol. 1996;6:147–161. [PubMed] [Google Scholar]

RESOURCES