Skip to main content
Journal of Clinical Microbiology logoLink to Journal of Clinical Microbiology
. 2017 Apr 25;55(5):1416–1425. doi: 10.1128/JCM.00054-17

Discovery of Novel Pneumococcal Serotype 35D, a Natural WciG-Deficient Variant of Serotype 35B

K Aaron Geno a, Jamil S Saad b, Moon H Nahm a,b,✉
Editor: Betty A Forbesc
PMCID: PMC5405259  PMID: 28202800

ABSTRACT

Pneumococcus (Streptococcus pneumoniae) remains a significant cause of morbidity and mortality, especially among those at the extremes of age. Its capsular polysaccharide is essential for systemic virulence. Over 90 serologically distinct pneumococcal capsular polysaccharides (serotypes) are recognized, but they are unequal in prevalence. Because antibodies against the capsule are protective, polysaccharide conjugate vaccines, which are constructed against the most prevalent serotypes, have caused great reductions in pneumococcal disease caused by these serotypes. In response, however, the relative prevalences of serotypes have shifted. Certain previously rare serotypes, such as serotype 35B, are increasing in prevalence. Serotype 35B is thus a likely future vaccine candidate, but due to their previous rarity, serotype 35B strains have not been scrutinized for underlying heterogeneity. We studied putative serotype 35B clinical isolates to assess the uniformity of their serological reactions. While most isolates exhibited the accepted serology of serotype 35B, one isolate failed to bind to critical serotyping reagents. We determined that the genetic basis for this aberrant serology was the presence of inactivating mutations in the O-acetyltransferase gene wciG. Complementation studies in a wciG deletion strain verified that the mutant WciG was nonfunctional, and the serology of the mutant could be restored through complementation with a construct encoding a functional WciG. Nuclear magnetic resonance studies confirmed that the capsule of the WciG-deficient isolate lacked O-acetylation but was otherwise identical to serotype 35B. As this isolate expresses a unique serology with unique biochemistry and a stable genetic basis, we named its novel capsule serotype 35D.

KEYWORDS: O-acetylation, Streptococcus pneumoniae, capsular polysaccharide, serogroup 35, serotype 35B, serotype 35D

INTRODUCTION

Streptococcus pneumoniae (pneumococcus) is an important human pathogen that can express many different polysaccharide capsules that protect the organism from opsonophagocytic killing (1). As antibodies to the capsule are protective, currently available vaccines against pneumococcus are designed to elicit antibodies to the capsule and have been highly successful in reducing the incidence of invasive pneumococcal disease (IPD). A pneumococcal polysaccharide-protein conjugate vaccine (PCV) with polysaccharide from the seven most commonly observed serotypes (PCV7) was introduced in the United States in 2000 and reduced the incidence of IPD in children younger than 5 by over 75% (2); the updated 13-valent PCV (PCV13) has reduced the incidence of IPD by an additional 64% in this age group in the United States (3). However, the protection by these vaccines is serotype specific, and their widespread implementation has brought shifts in the serotypes found in both nasopharyngeal carriage and IPD (see, e.g., reference 4).

Because pneumococcal vaccines provide serotype-specific protection, the efficacy of a given vaccine is inherently dependent upon the serotype distribution in the target population. Thus, it is essential to monitor the epidemiology of pneumococcal serotypes to formulate pneumococcal vaccines and to assess their efficacy. The classical serotyping method, the Quellung reaction, is based on the reaction of serotype-specific antisera with the corresponding capsule (5); this method is time-consuming, requires many reagents, and requires a high degree of operator expertise. Since the capsular genetic loci (cps loci) for all known serotypes have been described (6–12), many serotyping methods are now based on detecting the genetic hallmarks of each serotype; such methods are less expensive and require less operator expertise. Yet, current genetic assays rely on the association of certain sequences with certain serotypes (reviewed in reference 13) without evidence that those sequences are responsible for those serotypes. Small genetic differences differentiate serotypes that have only subtle differences in structure yet profoundly different interactions with immunity, both vaccine-elicited and innate. Thus, indirect genetic “serotyping” methods may fail to identify novel serotypes.

Invasive disease by serotype 35B has been rare historically, accounting for 0.5% of IPD in the 2 years prior to PCV7 introduction in the United States (2); consequently, 35B is not included in current pneumococcal vaccines. However, the prevalence of serotype 35B in both IPD and nasopharyngeal carriage has been increasing with the use of PCVs in the United States (see, e.g., references 3 and 4) and other countries (14, 15). Because the genetic approach is an indirect method, we studied the serologic properties of a collection of isolates putatively assigned as serotype 35B genetically. We found that most of these putatively serotype 35B isolates exhibit serology typical of serotype 35B. However, one isolate reproducibly failed to bind to factor serum 35a. We investigated the genetic basis and biochemical structure of this isolate's capsule and discovered a novel serotype, which we have named 35D.

RESULTS

Heterogeneity exists among isolates assigned to serotype 35B by genetic means.

To investigate serologic properties of putative serotype 35B isolates, we identified 30 clinical isolates determined to be serotype 35B by a genetic method (16) (Table 1) and examined them for their abilities to bind commercial serotyping antisera. By flow cytometry, all isolates but one bound to pool G, group 35 antiserum, and factor sera 35a, 35c, and 29b, consistent with the accepted serotype 35B serology (see Table 2 for the accepted serological profiles [17]; representative flow cytometric data are shown in Fig. 1). The remaining isolate, 3431-06, reproducibly failed to bind to group 35 antiserum and factor serum 35a while retaining serotype 35B-like properties with respect to the other factor sera (Fig. 1 and Table 2). (It is worthwhile to note that serotype 29 reacted with factor serum 35c [Table 2]; while 35c is not officially part of the serotype 29 antigenic formula, this binding was reproducible in our hands.) Notably, all putative serotype 35B isolates bound serotype 29 antiserum; thus, as a consequence of lost factor serum 35a binding, strain 3431-06 serologically resembled serotype 29 but lacked the factor serum 35b reactivity observed with serotype 29 (Fig. 1, “29/2,” and Table 2). Therefore, we concluded that strain 3431-06 represented a novel serotype that is similar to, but distinct from, serotypes 29 and 35B. We refer to this novel serotype as serotype 35D.

TABLE 1.

Strains used in this study

Strain fs 35a bindinga GenBank accession no. Reference or sourceb
Clinical isolates (putative serotype 35B by genetic assay [16])
    3009-06 Y KX021817 16
    3094-06 Y 16
    3431-06 N KY084476 16
    3938-06 Y 16
    MNZ753 Y 35
    SJY05-48 Y 36
    SJY06-108 Y 36
    SJY06-89 Y 36
    SJY06-9 Y 36
    SJY07-17 Y 36
    SJY07-31 Y 36
    SJY08-111 Y 36
    SJY08-115 Y 36
    SJY08-128 Y 36
    SJY08-139 Y 36
    SJY08-254 Y 36
    SJY08-300 Y 36
    SJY08-302 Y 36
    SJY08-65 Y 36
    SJY08-73 Y 36
    SJY09-105 Y 36
    SJY10-131 Y 36
    SJY10-161 Y 36
    SJY10-162 Y 36
    SJY10-17 Y 36
    SJY10-57 Y 36
    SJY10-171 Y 36
    SJY10-191 Y 36
    SJY10-283 Y 36
    SJY10-310 Y 36
Reference strains
    35B/2 Y SSI
    29/2 N SSI
Laboratory-derived strains
    KAG1014 N KX096820 This study
    KAG1019 N KY311871 This study
    KAG1022 Y KY379101 This study
    KAG1023 Y KY379102 This study
a

fs, factor serum; Y, yes; N, no.

b

SSI, Statens Serum Institut, Copenhagen, Denmark.

TABLE 2.

Serological profiles of serotypes in this studya

Serotype Pool G Group 35 fs35a fs35b fs35c fs29b fs42a
35B + + + − + + −
35D + − − − + + −
29 + − − + − (+)b + −
a

The serotype 29 and 35B serological profiles are taken from reference 19 except where noted. fs, factor serum.

b

While factor serum 35c is not officially part of the serotype 29 antigenic formula, it reproducibly bound to serotype 29 (see Fig. 1).

FIG 1.

FIG 1

Isolate 3431-06 fails to bind to group 35 antisera and factor serum 35a by flow cytometric serotyping assay. Histograms are presented for the staining of indicated strains (serotype in parentheses) by the indicated serological reagent. Gray shading indicates staining of an irrelevant serotype control (serotype 4 strain TIGR4 [34]) to control for noncapsular antibodies in the typing antisera. Staining of strain 35B/2 (a serotype 35B reference strain) is representative of results obtained with strains listed in Table 1. fs, factor serum.

Isolate 3431-06 is a wciG-deficient variant of serotype 35B.

To determine the genetic basis for the novel serologic properties of isolate 3431-06, we sequenced its cps locus (submitted to GenBank accession no. KY084476) and compared it to a serotype 35B reference cps locus (GenBank accession no. CR931705). The comparison showed that the 3431-06 cps locus has two missense mutations in wciG, which encodes a putative O-acetyltransferase. The mutations result in amino acid substitutions R178K and A227T in WciG. The cps locus showed no further deviations from the reference sequence.

To verify that wciG functionality was responsible for the novel capsule of 3431-06, we deleted wciG in a serotype 35B clinical isolate, 3009-06. The resulting strain, KAG1014, was serologically identical to 3431-06 (Fig. 2). Complementation of KAG1014 with wciG of 3431-06 failed to restore factor serum 35a binding (Fig. 2, KAG1019), while complementation with wciG from serotype 35C (used for technical reasons, see Materials and Methods) was able to restore binding in both KAG1014 and 3431-06 (Fig. 3, KAG1023 and KAG1022). This strongly suggested that the mutant WciG of 3431-06 is nonfunctional and that WciG functionality is the determinant of both group 35 antiserum and factor serum 35a recognition.

FIG 2.

FIG 2

The unique serology of serotype 35D is due to loss of WciG functionality in a serotype 35B background. The flow cytometric staining of bacteria (strain description in parentheses) by the indicated serological reagents is presented as histograms. The serotype 4 isolate TIGR4 (34), with gray shading, was used to control for binding by noncapsular antibodies. A strain staining at or below the irrelevant serotype control was considered negative for binding. fs, factor serum.

FIG 3.

FIG 3

(A) Overlay of 1H NMR spectra of serotypes 35B (top) and 35D (bottom) polysaccharides at 25°C. The serotype 35D spectrum has lost the O-acetyl peak at 2.12 ppm (arrowhead), and shifts in the anomeric region (especially ≥5 ppm [1H]) are observed in consequence (see Table 3). (B) The 1H-13C HMQC spectra of 35B (left) and 35D (right) show the loss of the O-Ac peak at 2.12 ppm (1H).

Isolate 3431-06 capsular polysaccharide lacks O-acetylation.

Genetic and serological evidence suggested that the 35D capsular polysaccharide is a de-O-acetylated serotype 35B capsule. To confirm this biochemically, we purified the capsule from isolate 3431-06 and analyzed it via nuclear magnetic resonance (NMR) spectroscopy. For a direct comparison with the serotype 35D isolate, identical NMR experiments were also collected for serotype 35B polysaccharide. Complete assignments of 1H and 13C signals (Table 3) for serotype 35B and 35D polysaccharides were achieved by two-dimensional (2D) NMR experiments, as described in Materials and Methods. The chemical shifts are very similar to those described for serotype 35B polysaccharide and its O-deacetylated form (18). Although the spectra of serotypes 35B and 35D are largely similar, some significant differences are observed in the anomeric and acetyl regions (Fig. 3A). As shown in Fig. 3B, the 1H-13C signal corresponding to the O-acetyl group at 2.12/20.24 ppm (1H/13C) is observed for serotype 35B but not for serotype 35D, consistent with the loss of capsular O-acetylation for serotype 35D. A second signal corresponding to the N-acetyl group is observed at 2.04/22.37 ppm (1H/13C). Because the chemical shifts of the polysaccharide are very similar except for groups directly affected by acetylation, our data demonstrate that loss of the O-acetyl group does not alter the structure of the polysaccharide, a finding that is consistent with the previously reported structure of the serotype 35B repeat unit.

TABLE 3.

1H and 13C chemical shifts (ppm) of 35B and 35D obtained at 25°C

Residue Label 1H and 13C chemical shifts (ppm)
H1/C1 H1′ H2/C2 H3/C3 H4/C4 H5/C5 H5′ H6a, H6b/C6 (Ac)H/C
35B
    →6-β-d-Glcp-(1→ A 5.27/108.29 4.15/81.29 4.06/76.27 4.04/83.04 3.92/70.95 3.97, 3.67/71.20
    →6-β-d-Galf-2Ac(1→ B 5.17/105.09 4.95/83.67 4.22/75.45 4.07/83.73 3.92/70.89 3.76, 4.06/71.17 2.12/20.24
    →4-β-d-GalpNAc-(1→ C 4.54/102.25 3.95/52.58 3.83/70.47 4.50/73.00 3.76/74.50 3.97, 3.94/60.77 2.04/22.37
    →3-β-d-Glcp-(1→ D 4.54/102.24 3.45/73.06 3.63/82.33 3.44/68.22 3.48/75.70 3.72, 3.90/60.70
    →1-Ribitol-(5-PO4→ E 3.83/67.84 3.72 4.00/70.09 3.78/71.45 3.92/69.18 4.12/66.84 4.05
35D
    →6-β-d-Glcp-(1→ A 5.27/108.29 4.15/81.29 4.06/76.40 4.04/82.84 3.92/70.95 3.97, 3.67/71.20
    →6-β-d-Galf(1→ B 5.03/107.29 4.11/80.89 4.07/76.78 4.00/83.22 3.92/70.89 3.76, 4.06/71.17
    →4-β-d-GalpNAc-(1→ C 4.54/102.25 3.95/52.58 3.83/70.47 4.50/73.00 3.76/74.50 3.97, 3.94/60.77 2.04/22.37
    →3-β-d-Glcp-(1→ D 4.54/102.23 3.45/73.06 3.63/82.33 3.45/68.07 3.48/75.70 3.72, 3.90/60.70
    →1-Ribitol-(5-PO4→ E 3.84/67.84 3.72 4.00/69.90 3.78/71.45 3.92/69.18 4.12/66.84 4.05

DISCUSSION

Herein, we describe a new serotype, 35D, which is genetically very similar to serotype 35B but differs in having inactivating mutations in wciG. wciG encodes a putative O-acetyltransferase, and two minor mutations apparently render WciG inactive. As a result, serotype 35D produces a capsule that differs from 35B polysaccharide in structure and immunoreactivity. The serotype 35D capsule is identical to that of serotype 35B except for the absence of an O-acetyl group at one galactofuranose (Galf) (Fig. 3). Immunologically, serotype 35D is identical to serotype 35B except for its nonreactivity to factor serum 35a and the group 35 antiserum (Fig. 1 and Table 2). Because serotype 35D has a heritable genetic alteration, a unique polysaccharide structure, and a distinct immunologic profile, it represents a novel serotype.

Selecting a name for this serotype was problematic. The new serotype does not react with group 35 antiserum or factor serum 35a, both of which are accepted to react with all members of serogroup 35 (17). In addition, serotype 35D is serologically and chemically similar to serotype 29. Serologically, they differ only by their reactions with factor serum 35b (Table 2), and their polysaccharide structures differ by only one residue (glucose [Glc] versus galactose [Gal]). Indeed, classical serotyping approaches may have mistyped serotype 35D as serotype 29 because of their serologic similarity and the failure of 35D to react with factor serum 35a, a requisite for assignment to serogroup 35 using Quellung serotyping (19). However, the cps locus of 35D is almost identical to the serotype 35B cps locus and quite different from the serotype 29 cps locus. Consequently, many popular genotyping methods, which are increasingly favored over Quellung serotyping, would have assigned a serotype 35D isolate as serotype 35B. Thus, we have chosen to include this new and 98th (by our count) serotype in serogroup 35 as serotype 35D. Serotyping schemes of either type should be revised to take this closely related serotype into account.

Using the serologic properties of serotype 35D, we have attempted to deduce the minimum chemical structures targeted by several factor sera (presented as a schematic in Fig. 4) while excluding currently known structures that are not known to cross-react (13, 17). Since WciG-mediated O-acetylation correlates with factor serum 35a, factor serum 35a must target the O-acetyl group conserved in serogroup 35 members other than 35D. Similarly, factor serum 20b has been shown to recognize WcjE-mediated O-acetylation (20), which is present in both the serotype 35A and 35C repeat units (13; K. A. Geno, C. A. Bush, M. H. Nahm, and J. Yang, unpublished data). Binding of factor serum 35b distinguishes serotype 29, whose first repeat unit sugar is Gal, from serotype 35D, whose first repeat unit sugar is Glc. Therefore, factor serum 35b must target the Galf-Gal(β1→6) motif present in serotypes 29 and 35F. This is consistent with the observation that serotype 47F, which has the same motif (13), contains 35b in its antigenic formula (17). All serotypes presented but 35F contain Galf in (1→1) linkage with a sugar alcohol, a motif that correlates with factor serum 35c reactivity. Factor serum 29b reacts with only serotypes 29, 35B, and 35D, whose capsules contain a ribitol-(5→P→4)-N-acetyl galactosamine motif that seems a likely target for factor serum 29b. Finally, factor serum 42a differentiates serotype 35C from serotype 35A; these serotypes are differentiated only by the presence of a side chain also present in serotype 42 (13); thus, this side chain (and its associated attachment point) is the likely target of factor serum 42a.

FIG 4.

FIG 4

Predicted epitope correlations among serogroup 35 capsules. Capsular structures of serotypes 35F, 35A, 35B, and 35C were previously described (13). Epitopes were deduced by comparisons within serogroup 35 and with the other known structures of pneumococcal capsules (13). *, we have determined that the serotype 35C capsule is acetylated at the indicated sites (K. A. Geno, C. A. Bush, M. H. Nahm, and J. Yang, unpublished data). Gal, galactose; Ac, acetyl; Rib-ol, ribitol; P, phosphate; f, furanose; Man-ol, mannitol; Glc, glucose; GalNAc, N-acetyl galactosamine.

Our studies identified two mutant residues of WciG in strain 3431-06 that appear to render the enzyme inactive, as wciG of 3431-06 was not able to complement a WciG deletion. Because all 17 predicted amino acid sequences for WciG among pneumococci are highly conserved, it is difficult to assess the two residues' relative importance to WciG function. WciG is a predicted integral membrane O-acetyltransferase with 10 transmembrane helices that may form a pore. Thus, we examined the predicted topology of WciG by submitting the WciG protein sequence derived from GenBank accession no. CR931705 to two different prediction programs (TMPRED [http://embnet.vital-it.ch/software/TMPRED_form.html] and Protter [http://wlab.ethz.ch/protter/start/]). Both models predict a protein with 10 transmembrane helices with residue 178 as the first or second residue of outside-in transmembrane helix six and residue 227 as the last residue of inside-out transmembrane helix seven. We thus speculate that the two residues, which are located at the exterior surface of the cell on adjacent helices, disrupt pore function in the membrane.

Membrane-bound O-acetyltransferases modify a wide array of bacterial polysaccharides in both Gram-positive and Gram-negative organisms, including capsular polysaccharides (see, e.g., reference 11), O antigens (21), and peptidoglycan (22). Our discovery of serotype 35D further illustrates that genetic inactivation of membrane-bound O-acetyltransferases is a commonly used mechanism for generating variation in capsular polysaccharides. For example, wcjE-positive and -negative pairs are known to exist in many serotypes (6, 11, 23), and serotype pairs 15B/15C and 18C/18B are differentiated by O-acetyltransferase functionality (6). Here, we have presented the first described serotype arising from wciG inactivation. As 14 other serotypes encode wciG (6), the possibility of such variation within these types should be explored.

As serotype 35B is increasing in prevalence in the wake of conjugate vaccine usage in some parts of the world (3, 4, 14, 15), it is likely to be included in a future generation of PCVs. WciG-mediated O-acetylation seems to be an antigenically dominant epitope for this serogroup, as evidenced by loss of group 35 antiserum recognition in wciG-deficient isolates. Therefore, the serotype 35B polysaccharide is likely to elicit antibodies to the acetyl group. Furthermore, if vaccination elicits antibodies primarily targeting the O-acetyl group of serotype 35B, it may selectively remove serotype 35B while permitting serotype 35D to become prevalent. Thus, serotypes 35B and 35D should be distinguished during vaccine design and manufacturing, as well as for epidemiologic studies performed before and after the introduction of future vaccines.

After the submission of this paper, we became aware of a report from Australia describing four clinical isolates whose genetic and serological profiles match those of serotype 35D (24). In addition, the CDC Active Bacterial Core surveillance (ABCs) program has uncovered two serotype 35B wciG variants exhibiting the serology we describe for serotype 35D (Bernard Beall, CDC ABCs, personal communication). Thus, it appears that at least seven isolates of the novel serotype herein described have been recognized globally, and retrospective studies of serotype 35B or serotype 29 isolates may uncover additional isolates. Notably, six of the seven isolates have unique inactivations of wciG. Thus, as the authors of the Australian report noted, these serotype 35D isolates may reflect microevolution during serotype 35B invasive disease, similar to that proposed for serotype 11A microevolution to serotype 11E (25).

MATERIALS AND METHODS

Bacterial strains and cultivation.

The strains used are listed in Table 1. Unless otherwise specified, strains were streaked to blood agar plates with 5% sheep's blood (Remel) from frozen glycerol stocks and incubated overnight at 37°C with 5% CO2. Fresh colonies were inoculated into Todd-Hewitt broth with 5% yeast extract (THY) and grown to mid-log density before a 1:1 mixture with fresh THY and supplementation to 16% glycerol; 500-μl aliquots were frozen at −80°C for use in the assays described below. When indicated, kanamycin was used at 100 μg/ml, and erythromycin was used at 0.3 μg/ml.

Flow cytometric serotyping assays.

Flow cytometric serotyping assays were performed as previously described (10), with the modification that HBC buffer (Hanks' balanced salt solution [HBSS]-bovine serum albumin-calcium buffer; 1× HBSS without magnesium or calcium, 0.5% bovine serum albumin, 2.2 mM CaCl2 [26]) was used instead of FACS buffer. Briefly, bacterial stocks were washed in HBC, incubated with 1:10,000 dilutions of antisera, washed by centrifugation, stained with a phycoerythrin-conjugated anti-rabbit immunoglobulin secondary antibody (catalog no. 4010-09; Southern Biotech) at a 1:1,000 dilution, washed by centrifugation, and read on a BD FACSCalibur, BD FACSArray, or BD Accuri flow cytometer. Data were analyzed in FCS Express versions 3.0 and 6.0. The indicated serological reagents were obtained from Statens Serum Institut.

Genetic manipulations.

Primer sequences are presented in Table 4. wciG was deleted in serotype 35B isolate 3009-06 through allelic exchange of wciG with Janus cassette (27) with selection for kanamycin resistance. Upstream and downstream flanking regions were amplified from 3009-06 chromosomal DNA using primer sets 5300/3151 and 5093/3150. Janus cassette was amplified from TIGR-JS (8) using primers 5092/3152; fragments were successively joined by overlap extension PCR. The agarose gel-purified product was mixed with an equal volume of 3009-06 lysate (prepared as in reference 28) and transformed into 3009-06, as previously described (29), with the exception that competence-stimulating peptide 2 was used; transformants were plated on THY agar (THY plus 1.5% agar) and overlaid with THY plus 0.8% agar supplemented with kanamycin to 100 μg/ml and 25 μg/ml 2-,3-,5-triphenyltetrazolium chloride to aid visualization. Plates were incubated at 37°C with 5% CO2 overnight. Agar plugs containing colonies were inoculated into THY, grown to mid-log phase, and stocked as described above. Uptake of the construct was verified by DNA sequencing from purified chromosomal DNA.

TABLE 4.

Primers used in this study

Primera Sequence (5′ to 3′)b
5300 CTAAGTATGTGGGTGCCTGCTC
3151 TACAGTATTTCTAATTTTTCCTAATTACTTGTTTTAATTC
5093 TCCAAAAGCATAAAAAAAGGAGAAAAAATGTACGATTATC
3150 GTAAAGACAATCTTAGGAAAATCTTTCAG
5092 GTAATTAGGAAAAATTAGAAATACTGTAGAAAAGAGGAAG
3152 CGGTACTAAACGTCCAAAAGCATAAAAAAAGGAGAAAAAA
5224 TAGCTAACTAGTTAGGAGGAAGGAAATAATAAATGCATAAATTTAAAGATATTAACTTGG
3182 TTTTTCGCATGCTTATAATTTGACGATTCGATTAAAATACG
5240 TAGCTAACTAGTTAGGAGGAAGGAAATAATAAATGAGAAAAAATCGAAATATCAACCTAG
3196 TTTTTCGCATGCTTATAATTTGACGATTCGATTGAAGTAAG
a

All primers are original to this study. Primers beginning with 5 are forward primers with respect to the reference sequence; primers beginning with 3 are reverse primers with respect to the reference sequence.

b

Underlined residues indicate restriction sites.

For complementation of wciG, we utilized a previously described strategy that places the gene to be complemented immediately downstream of aliA (30), which is present downstream of the cps locus. wciG from isolate 3431-06 was amplified using primers 5224/3182. For complementation of wciG in 3431-06, homology to the existing wciG gene prohibited use of the serotype 35B wciG, as it is larger than the aliA flanking region of pAG269, preferentially targeting the plasmid to wciG rather than aliA; thus, wciG from serotype 35C, whose product is predicted to perform the same acetylation but whose gene has lower nucleotide homology, was used. Primer set 5240/3196 was used to amplify wciG from the serotype 35C clinical isolate 5705-06 (GenBank accession no. KX470740), which was obtained from the CDC ABCs program. PCR products were cloned into pCR2.1 using the TOPO TA cloning kit (Invitrogen) and maintained in Escherichia coli TOP10 cells (Invitrogen). Sequences of cloned PCR products were verified by DNA sequencing. Correct plasmids were digested with SpeI/SphI and ligated into pAG269 prior to transformation into E. coli DB11, as previously described (30). Prepared plasmids were transformed into KAG1014 or 3009-06 as described above, substituting erythromycin (0.3 μg/ml) for kanamycin.

DNA sequencing.

DNA sequencing was performed by the Heflin Center Genomics Core Lab at the University of Alabama at Birmingham.

Polysaccharide purification.

Serotype 35B and 35D polysaccharides were purified from strains 3009-06 and 3431-06 by anion-exchange chromatography, as previously described (31). Polysaccharide-containing fractions were determined through an inhibition enzyme-linked immunosorbent assay (ELISA) competing soluble serotype 35B/35D polysaccharide fractions against serotype 35B polysaccharide (ATCC)-coated wells for binding of factor serum 29b. Polysaccharide-containing fractions were pooled, dialyzed against water, and lyophilized.

NMR spectroscopy.

NMR data were collected at 25°C on a Bruker Avance II (700 MHz 1H) spectrometer equipped with a cryogenic triple-resonance probe. NMR samples were prepared by dissolving 2 to 5 mg of lyophilized polysaccharide in 0.5 ml of 99.99% D2O. Complete assignments of 1H and 13C signals for 35B and 35D polysaccharides were achieved by two-dimensional nuclear Overhauser spectroscopy (1H-1H NOESY), correlation spectroscopy (1H-1H COSY), total correlation spectroscopy (1H-1H TOCSY), and heteronuclear multiple quantum coherence (1H-13C HMQC). Data were processed with NMRPIPE (32) and analyzed with NMRView (33). Trimethylsilylpropanoic acid was used as an external reference.

Accession number(s).

Sequence data for relevant isolates were deposited to GenBank under the accession numbers found in Table 1.

ACKNOWLEDGMENTS

This work was funded by NIH grants HL105346 (to K.A.G.) and AG050607 (to M.H.N.) and NIH contract HHSN272201200005C (to M.H.N.). The NIH did not participate in experimental design, data collection and interpretation, or the publication of these findings.

The University of Alabama at Birmingham (UAB) has intellectually property rights to some reagents developed in the laboratory of M.H.N., and all study authors are UAB employees. We declare no additional conflicts of interest.

REFERENCES

  • 1.Hyams C, Camberlein E, Cohen JM, Bax K, Brown JS. 2010. The Streptococcus pneumoniae capsule inhibits complement activity and neutrophil phagocytosis by multiple mechanisms. Infect Immun 78:704–715. doi: 10.1128/IAI.00881-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Pilishvili T, Lexau C, Farley MM, Hadler J, Harrison LH, Bennett NM, Reingold A, Thomas A, Schaffner W, Craig AS, Smith PJ, Beall BW, Whitney CG, Moore MR, Active Bacterial Core surveillance/Emerging Infections Program Network. 2010. Sustained reductions in invasive pneumococcal disease in the era of conjugate vaccine. J Infect Dis 201:32–41. doi: 10.1086/648593. [DOI] [PubMed] [Google Scholar]
  • 3.Moore MR, Link-Gelles R, Schaffner W, Lynfield R, Lexau C, Bennett NM, Petit S, Zansky SM, Harrison LH, Reingold A, Miller L, Scherzinger K, Thomas A, Farley MM, Zell ER, Taylor TH Jr, Pondo T, Rodgers L, McGee L, Beall B, Jorgensen JH, Whitney CG. 2015. Effect of use of 13-valent pneumococcal conjugate vaccine in children on invasive pneumococcal disease in children and adults in the USA: analysis of multisite, population-based surveillance. Lancet Infect Dis 15:301–309. doi: 10.1016/S1473-3099(14)71081-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Sharma D, Baughman W, Holst A, Thomas S, Jackson D, da Gloria Carvalho M, Beall B, Satola S, Jerris R, Jain S, Farley MM, Nuorti JP. 2013. Pneumococcal carriage and invasive disease in children before introduction of the 13-valent conjugate vaccine: comparison with the era before 7-valent conjugate vaccine. Pediatr Infect Dis J 32:196. doi: 10.1097/INF.0b013e3182788fdd. [DOI] [PubMed] [Google Scholar]
  • 5.Neufeld F, Haendel L. 1910. Weitere untersuchungen uber pneumokokken-heilsera. III. Mitteilung Arbeiten aus dem Kaiserlichen Gesundheitsamte 34:293–304. [Google Scholar]
  • 6.Bentley SD, Aanensen DM, Mavroidi A, Saunders D, Rabbinowitsch E, Collins M, Donohoe K, Harris D, Murphy L, Quail MA, Samuel G, Skovsted IC, Kaltoft MS, Barrell B, Reeves PR, Parkhill J, Spratt BG. 2006. Genetic analysis of the capsular biosynthetic locus from all 90 pneumococcal serotypes. PLoS Genet 2:e31. doi: 10.1371/journal.pgen.0020031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Bratcher PE, Kim KH, Kang JH, Hong JY, Nahm MH. 2010. Identification of natural pneumococcal isolates expressing serotype 6D by genetic, biochemical and serological characterization. Microbiology 156:555–560. doi: 10.1099/mic.0.034116-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Park IH, Park S, Hollingshead SK, Nahm MH. 2007. Genetic basis for the new pneumococcal serotype, 6C. Infect Immun 75:4482–4489. doi: 10.1128/IAI.00510-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Oliver MB, van der Linden MP, Kuntzel SA, Saad JS, Nahm MH. 2013. Discovery of Streptococcus pneumoniae serotype 6 variants with glycosyltransferases synthesizing two differing repeating units. J Biol Chem 288:25976–25985. doi: 10.1074/jbc.M113.480152. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Park IH, Geno KA, Yu J, Oliver MB, Kim KH, Nahm MH. 2015. Genetic, biochemical, and serological characterization of a new pneumococcal serotype, 6H, and generation of a pneumococcal strain producing three different capsular repeat units. Clin Vaccine Immunol 22:313–318. doi: 10.1128/CVI.00647-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Calix JJ, Nahm MH. 2010. A new pneumococcal serotype, 11E, has a variably inactivated wcjE gene. J Infect Dis 202:29–38. doi: 10.1086/653123. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Calix JJ, Porambo RJ, Brady AM, Larson TR, Yother J, Abeygunwardana C, Nahm MH. 2012. Biochemical, genetic, and serological characterization of two capsule subtypes among Streptococcus pneumoniae serotype 20 strains: discovery of a new pneumococcal serotype. J Biol Chem 287:27885–27894. doi: 10.1074/jbc.M112.380451. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Geno KA, Gilbert GL, Song JY, Skovsted IC, Klugman KP, Jones C, Konradsen HB, Nahm MH. 2015. Pneumococcal capsules and their types: past, present, and future. Clin Microbiol Rev 28:871–899. doi: 10.1128/CMR.00024-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Cohen R, Varon E, Doit C, Schlemmer C, Romain O, Thollot F, Bechet S, Bonacorsi S, Levy C. 2015. A 13-year survey of pneumococcal nasopharyngeal carriage in children with acute otitis media following PCV7 and PCV13 implementation. Vaccine 33:5118–5126. doi: 10.1016/j.vaccine.2015.08.010. [DOI] [PubMed] [Google Scholar]
  • 15.Ubukata K, Chiba N, Hanada S, Morozumi M, Wajima T, Shouji M, Iwata S, Invasive Pneumococcal Diseases Surveillance Study Group. 2015. Serotype changes and drug resistance in invasive pneumococcal diseases in adults after vaccinations in children, Japan, 2010–2013. Emerg Infect Dis 21:1956–1965. doi: 10.3201/eid2111.142029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Yu J, Lin J, Kim KH, Benjamin WH Jr, Nahm MH. 2011. Development of an automated and multiplexed serotyping assay for Streptococcus pneumoniae. Clin Vaccine Immunol 18:1900–1907. doi: 10.1128/CVI.05312-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Henrichsen J. 1995. Six newly recognized types of Streptococcus pneumoniae. J Clin Microbiol 33:2759–2762. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Beynon LM, Richards JC, Perry MB, Kniskern PJ. 1995. Characterization of the capsular antigen of Streptococcus pneumoniae serotype 35B. Can J Chem 73:41–48. doi: 10.1139/v95-006. [DOI] [Google Scholar]
  • 19.Statens Serum Institut. 2013. Streptococcus pneumoniae: textbook in diagnosis, serotyping, virulence factors and enzyme-linked immunosorbent assay (ELISA) for measuring pneumococcal antibodies. Statens Serum Institut, Hillerød, Denmark. [Google Scholar]
  • 20.Lin FL, Vinogradov E, Deng C, Zeller S, Green BA, Jansen KU, Pavliak V. 2013. Identification of the common antigenic determinant shared by Streptococcus pneumoniae serotypes 33A, 35A, and 20 capsular polysaccharides. Carbohydr Res 380:101–107. doi: 10.1016/j.carres.2013.08.001. [DOI] [PubMed] [Google Scholar]
  • 21.Lerouge I, Vanderleyden J. 2002. O-antigen structural variation: mechanisms and possible roles in animal/plant-microbe interactions. FEMS Microbiol Rev 26:17–47. doi: 10.1111/j.1574-6976.2002.tb00597.x. [DOI] [PubMed] [Google Scholar]
  • 22.Crisóstomo MI, Vollmer W, Kharat AS, Inhulsen S, Gehre F, Buckenmaier S, Tomasz A. 2006. Attenuation of penicillin resistance in a peptidoglycan O-acetyl transferase mutant of Streptococcus pneumoniae. Mol Microbiol 61:1497–1509. doi: 10.1111/j.1365-2958.2006.05340.x. [DOI] [PubMed] [Google Scholar]
  • 23.Calix JJ, Saad JS, Brady AM, Nahm MH. 2012. Structural characterization of Streptococcus pneumoniae serotype 9A capsule polysaccharide reveals role of glycosyl 6-O-acetyltransferase wcjE in serotype 9V capsule biosynthesis and immunogenicity. J Biol Chem 287:13996–14003. doi: 10.1074/jbc.M112.346924. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Staples M, Graham RM, Hicks V, Strachan J, Gonçalves da Silva A, Peverall J, Wicks V, Jennison AV. 3 January 2017. Discovery of Streptococcus pneumoniae serogroup 35 variants in Australian patients. Clin Microbiol Infect doi: 10.1016/j.cmi.2016.12.029. [DOI] [PubMed] [Google Scholar]
  • 25.Calix JJ, Dagan R, Pelton SI, Porat N, Nahm MH. 2012. Differential occurrence of Streptococcus pneumoniae serotype 11E between asymptomatic carriage and invasive pneumococcal disease isolates reflects a unique model of pathogen microevolution. Clin Infect Dis 54:794–799. doi: 10.1093/cid/cir953. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Brady AM, Calix JJ, Yu J, Geno KA, Cutter GR, Nahm MH. 2014. Low invasiveness of pneumococcal serotype 11A is linked to ficolin-2 recognition of O-acetylated capsule epitopes and lectin complement pathway activation. J Infect Dis 210:1155–1165. doi: 10.1093/infdis/jiu195. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Sung CK, Li H, Claverys JP, Morrison DA. 2001. An rpsL cassette, Janus, for gene replacement through negative selection in Streptococcus pneumoniae. Appl Environ Microbiol 67:5190–5196. doi: 10.1128/AEM.67.11.5190-5196.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Saunders CW, Guild WR. 1980. Properties and transforming activities of two plasmids in Streptococcus pneumoniae. Mol Gen Genet 180:573–578. doi: 10.1007/BF00268062. [DOI] [PubMed] [Google Scholar]
  • 29.Hardy GG, Caimano MJ, Yother J. 2000. Capsule biosynthesis and basic metabolism in Streptococcus pneumoniae are linked through the cellular phosphoglucomutase. J Bacteriol 182:1854–1863. doi: 10.1128/JB.182.7.1854-1863.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Geno KA, Hauser JR, Gupta K, Yother J. 2014. Streptococcus pneumoniae phosphotyrosine phosphatase CpsB and alterations in capsule production resulting from changes in oxygen availability. J Bacteriol 196:1992–2003. doi: 10.1128/JB.01545-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Burton RL, Geno KA, Saad JS, Nahm MH. 2016. Pneumococcus with the “6E” cps locus produces serotype 6B capsular polysaccharide. J Clin Microbiol 54:967–971. doi: 10.1128/JCM.03194-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Delaglio F, Grzesiek S, Vuister GW, Zhu G, Pfeifer J, Bax A. 1995. NMRPipe: a multidimensional spectral processing system based on UNIX pipes. J Biomol NMR 6:277–293. [DOI] [PubMed] [Google Scholar]
  • 33.Johnson BA, Blevins RA. 1994. NMR View: a computer program for the visualization and analysis of NMR data. J Biomol NMR 4:603–614. doi: 10.1007/BF00404272. [DOI] [PubMed] [Google Scholar]
  • 34.Tettelin H, Nelson KE, Paulsen IT, Eisen JA, Read TD, Peterson S, Heidelberg J, DeBoy RT, Haft DH, Dodson RJ, Durkin AS, Gwinn M, Kolonay JF, Nelson WC, Peterson JD, Umayam LA, White O, Salzberg SL, Lewis MR, Radune D, Holtzapple E, Khouri H, Wolf AM, Utterback TR, Hansen CL, McDonald LA, Feldblyum TV, Angiuoli S, Dickinson T, Hickey EK, Holt IE, Loftus BJ, Yang F, Smith HO, Venter JC, Dougherty BA, Morrison DA, Hollingshead SK, Fraser CM. 2001. Complete genome sequence of a virulent isolate of Streptococcus pneumoniae. Science 293:498–506. doi: 10.1126/science.1061217. [DOI] [PubMed] [Google Scholar]
  • 35.Kim KH, Hong JY, Lee H, Kwak GY, Nam CH, Lee SY, Oh E, Yu J, Nahm MH, Kang JH. 2011. Nasopharyngeal pneumococcal carriage of children attending day care centers in Korea: comparison between children immunized with 7-valent pneumococcal conjugate vaccine and non-immunized. J Korean Med Sci 26:184–190. doi: 10.3346/jkms.2011.26.2.184. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Song JY, Nahm MH, Cheong HJ, Kim WJ. 2014. Impact of preceding flu-like illness on the serotype distribution of pneumococcal pneumonia. PLoS One 9:e93477. doi: 10.1371/journal.pone.0093477. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES