Corrigendum: Characterization of a P1-like bacteriophage carrying CTX-M-27 in Salmonella spp. resistant to third generation cephalosporins isolated from pork in China

Scientific Reports 7: Article number: 40710 10.1038/srep40710; published online: January 18 2017; updated: April 26 2017

This Article contains errors in the Materials and Methods section under subheading ‘Prevalence investigation of P1-like bacteriophage in Salmonella isolates’, where incorrect primers were quoted.

“The presence of the insertion sequence on the other nontypeable plasmids carrying bla_CTX-M-27 gene was detected using the following primers: IS-fw (AGAATCATCGC CGAAGGGCTGTAACTGGTTTT) and IS-rev (GCGAACATCATCCGTTGCACT CTCTTTGT)”.

should read:

“The presence of the insertion sequence on the other nontypeable plasmids carrying bla_CTX-M-27 gene was detected using the following primers: IR-fw-(GTTGCTGGCTGACGCCTATGAAG) and IR-rev-(ATGTTTGCCATTTCATAGGGGAG)”.