Our findings show, for the first time, that transporters of the water-soluble vitamin ascorbic acid (i.e., the vitamin C transporters SVCT-1 and SVCT-2) are differentially expressed along the length of the intestinal tract and that the pattern of expression is mediated, at least in part, by transcriptional and epigenetic mechanism(s) affecting both Slc23a1 and Slc23a2 genes.
Keywords: vitamin C, uptake, intestine, differential expression, SVCT-1, SVCT-2
Abstract
Mammalian cells utilize two transporters for the uptake of ascorbic acid (AA), Na+-dependent vitamin C transporter SVCT-1 and SVCT-2. In the intestine, these transporters are involved in AA absorption and are expressed at the apical and basolateral membrane domains of the polarized epithelia, respectively. Little is known about the differential expression of these two transporters along the anterior-posterior axis of the intestinal tract and the molecular mechanism(s) that dictate this pattern of expression. We used mouse and human intestinal cDNAs to address these issues. The results showed a significantly lower rate of carrier-mediated AA uptake by mouse colon than jejunum. This was associated with a significantly lower level of expression of SVCT-1 and SVCT-2 at the protein, mRNA, and heterogeneous nuclear RNA (hnRNA) levels in the colon than the jejunum, implying the involvement of transcriptional mechanism(s). Similarly, expression levels of SVCT-1 and SVCT-2 mRNA and hnRNA were significantly lower in human colon. We also examined the levels of expression of hepatocyte nuclear factor 1α and specificity protein 1, which drive transcription of the Slc23a1 and Slc23a2 promoters, respectively, and found them to be markedly lower in the colon. Furthermore, significantly lower levels of the activating markers for histone (H3) modifications [H3 trimethylation of lysine 4 (H3K4me3) and H3 triacetylation of lysine 9 (H3K9ac)] were observed in the Slc23a1 and Slc23a2 promoters in the colon. These findings show, for the first time, that SVCT-1 and SVCT-2 are differentially expressed along the intestinal tract and that this pattern of expression is, at least in part, mediated via transcriptional/epigenetic mechanisms.
NEW & NOTEWORTHY Our findings show, for the first time, that transporters of the water-soluble vitamin ascorbic acid (i.e., the vitamin C transporters SVCT-1 and SVCT-2) are differentially expressed along the length of the intestinal tract and that the pattern of expression is mediated, at least in part, by transcriptional and epigenetic mechanism(s) affecting both Slc23a1 and Slc23a2 genes.
vitamin c [ascorbic acid (AA)] is indispensable for normal human health and well-being. This water-soluble vitamin is an essential micronutrient for normal cell function, growth, and development, serving as a cofactor for several important enzymes, as well as a potent antioxidant (26). Vitamin C deficiency is rare in developed countries, but it occurs in the elderly, smokers, and alcoholics (1, 16, 33, 34). Deficiencies of vitamin C lead to a variety of clinical abnormalities, including scurvy, delayed wound healing, bone and connective tissue disorders, and vasomotor instability (26). Optimization of vitamin C body homeostasis appears to protect against gallbladder disease, cardiovascular disease, cancer, and cataract formation (6, 12, 30, 35). Furthermore, as damage caused by oxidative stress has been linked to several diseases, including inflammatory bowel disease, the antioxidant properties of vitamin C may counteract damage caused by excessive reactive oxygen species (3–5, 13). Therefore, studies aimed at understanding the molecular mechanisms involved in maintaining and regulating vitamin C body homeostasis are important for designing effective strategies to optimize vitamin C homeostasis.
Humans cannot synthesize vitamin C de novo but, rather, obtain the vitamin from exogenous sources via intestinal absorption. Although mice can synthesize vitamin C endogenously, they also rely on a dietary source for vitamin C to meet their micronutrient requirement as demonstrated by vitamin C transporter knockout models (8, 36). Absorption of vitamin C across the intestinal epithelia occurs via a Na+-dependent carrier-mediated process (2, 18, 44). The molecular basis of uptake was defined after the cloning of two Na+-dependent vitamin C transporters, SVCT-1 and SVCT-2 (products of the SLC23A1 and SLC23A2 genes, respectively) (9, 27, 45, 46). Significant similarity [60% amino acid identity (32)] exists between human SVCT-1 and SVCT-2 and their mouse homologs. Hydropathy analysis predicts that these two transporters are members of the major facilitator superfamily with a 12-transmembrane-spanning topology and cytoplasmic NH2- and COOH-terminal domains. Both isoforms harbor multiple consensus sites for glycosylation and phosphorylation (15, 28, 39, 45, 46). Both transporter isoforms are expressed in the intestine: SVCT-1 is expressed at the apical intestinal membrane domain, and SVCT-2 is localized basolaterally (2, 18, 38).
Absorption of nutrients and expression of their transporters along the anterior-posterior axis of the gut is region-specific. The differential expression of transporters can, in part, be attributed to transcriptional and epigenetic mechanisms [including histone (H3) modifications, DNA methylation, and microRNA] (17, 22, 23, 43). Little is known about the rate of AA absorption in the two extreme ends of the intestinal tract, how the transporters involved in AA absorption (i.e., SVCT-1 and SVCT-2) are expressed, and the molecular mechanisms that dictate their pattern of expression. Here, we used mouse and human intestinal preparations as models to address these issues. Our results showed a markedly lower carrier-mediated AA uptake in the colon than the jejunum and lower levels of expression of SVCT-1 and SVCT-2 at the protein, mRNA, and heterogeneous nuclear RNA (hnRNA) levels. This reduction correlated with lower levels of expression of the transcription factors hepatocyte nuclear factor (HNF) 1α and specificity protein 1 (Sp1), which drive the expression of Slc23a1 and Slc23a2, respectively, as well as specific epigenetic modulation of the involved genes.
MATERIALS AND METHODS
Materials.
[14C]AA (13 mCi/mmol, radiochemical purity <98%) was purchased from American Radiolabeled Chemicals (St. Louis, MO); human jejunum and colon (from a pool of 5–7 individuals, 18–61 yr old) cDNA from Clontech (Mountain View, CA) and BioChain (Newark, CA); anti-SVCT-1, SVCT-2, HNF1α, and Sp1 polyclonal and anti-β-actin monoclonal primary antibodies from Santa Cruz Biotechnology (Santa Cruz, CA); and TATA box-binding protein (TBP) polyclonal antibody from Abcam (Cambridge, MA). The secondary antibodies anti-rabbit IRDye 800 and anti-mouse IRDye 680 were obtained from LI-COR Biosciences (Lincoln, NE). Oligonucleotide primers were obtained from Sigma Genosys (Woodland, TX).
[14C]AA uptake in vitro by mouse jejunal and colonic segments.
AA uptake was determined in jejunum and colon tissues from 10- to 12-wk-old male wild-type C57BL/6 mice (Jackson Laboratory). The animals were euthanized, and jejunal and colonic sheets were prepared and then incubated in Krebs-Ringer buffer containing [14C]AA (32 µM) at pH 7.4 for 3 min as described previously (40, 41). Protein concentration of each intestinal portion of the sample was determined using a Bio-Rad protein assay kit. Portions of the scraped jejunal and colonic mucosa were stored in RIPA buffer (Sigma) for protein expression studies or TRIzol (Invitrogen) for mRNA analysis. Animal studies were approved by the Institutional Animal Care and Use Committee at the Veterans Affairs Medical Center, Long Beach, CA.
Quantitative real-time PCR analysis.
Total RNA (1 µg) isolated from mouse jejunum and colon was treated with DNase I, and the cDNA was prepared using an i-Script cDNA synthesis kit (Bio-Rad). Quantitative real-time PCR (RT-qPCR) was performed using the SYBR Green PCR kit and a real-time PCR detection system (model CFX96, Bio-Rad). The gene-specific primers for human and mouse SVCT-1, SVCT-2, HNF1α, Sp1, TBP, and β-actin are listed in Table 1. Relative expression levels of SVCT-1 and SVCT-2 were determined by normalization of cycle threshold (Ct) values with corresponding β-actin (14). Relative expression levels of HNF1α and Sp1 were determined by normalization of Ct values with corresponding TBP (14).
Table 1.
Combination of primers used to amplify coding region of the respective genes by RT-qPCR
| Primers (5′–3′) |
||
|---|---|---|
| Gene Name | Forward | Reverse |
| Real-time PCR | ||
| hSVCT-1 | TCATCCTCTTCTCCCAGTACCT | AGAGCAGCCACACGGTCAT |
| hSVCT-2 | TCTTTGTGCTTGGATTTTCGAT | ACGTTCAACACTTGATCGATTC |
| hβ-Actin | CATCCTGCGTCTGGACCT | TAATGTCACGCACGATTTCC |
| mSVCT-1 | CAGCAGGGACTTCCACCA | CCACACAGGTGAAGATGGTA |
| mSVCT-2 | AACGGCAGAGCTGTTGGA | GAAAATCGTCAGCATGGCAA |
| mβ-Actin | ATCCTCTTCCTCCCTGGA | TTCATGGATGCCACAGGAM |
| mHNF1 | GCCCCTTCATGGCAACCA | CTCTCCCAGGCCAACGT |
| mSp1 | TATGTTGTGGCTGCTACC | TGTGGGATTACTTGATACTGAA |
| mTBP | TGACTCCTGGAATTCCCATC | TGTGTGGGTTGCTGAGATGT |
| hnRNA primers | ||
| hSVCT-1 | TGGAGACGGAGTTTTGCT | GGAGGCTAAGGTGGGAGA |
| hSVCT-2 | CCTCCTCCTCAGATCCTTCC | AAGATCCAGGGAGAGGGAAA |
| hβ-Actin | TTCCTGGGTGAGTGGAG | GGACTCCATGCCTGAGAG |
| mSVCT-1 | GCTTCCAGGCTCTAGATGGT | GGGCAAAATCTTCGTTGGGT |
| mSVCT-2 | ACTCTTGTCCATGGCTCTGG | GGGCAAAATCTTCGTTGGGT |
| mβ-Actin | AGATGACCCAGGTCAGTATC | GAGCAGAAACTGCAAAGAT |
| ChIP-qPCR | ||
| Slc23a1 (−88 to +08) | GCTATGGACCTGGTTACA | TCTGAGGAGAAAAGAAGAG |
| Slc23a2 (−239 to −146) | TCCTGCAGGGTAGAAAGGAG | ACCCTTCCCCACACACCT |
| Promoter cloning | ||
| Slc23a1 | GGGGTACCCGGGTAGCATAGAAGATACTCAG | CCGCTCGAGTCTGAGGAGAAAAGAAGAG |
| Slc23a2 | CTAGCTAGCTCCTGCAGGGTAGAAAGGAG | CCGCTCGAGCAGCCGCCTGCAAAATGG |
Bold face, bold italic, and underlined text indicates restriction site sequences for KpnI, XhoI, and NheI, respectively. SVCT, Na+-dependent vitamin C transporter; HNF1, hepatocyte nuclear factor 1; Sp1, specificity protein 1; TBP, TATA box-binding protein; hnRNA, heterogeneous nuclear RNA; ChIP, chromatin immunoprecipitation; qPCR, quantitative PCR.
Generation of Slc23a1 and Slc23a2 promoter constructs.
The Slc23a1 and Slc23a2 promoter constructs were generated by PCR using mouse genomic DNA and the primer combinations shown in Table 1 under PCR conditions described previously (28, 29). PCR products and the pGL3-basic vector (Promega, Madison, WI) were digested with KpnI-NheI and XhoI, and the digested products were separated on gels and ligated using a rapid ligation kit (Roche, Nutley, NJ). The subcloned construct was verified by sequencing performed by a commercial vendor (Laragen, Culver City, CA).
Firefly luciferase activity.
The Slc23a1 and Slc23a2 promoter-luciferase reporter (3 µg of DNA), along with 100 ng of the transfection control plasmid Renilla luciferase-thymidine kinase (pRL-TK, Promega, Sunnyvale, CA), was transiently co-transfected into Caco-2 cells (from a 72-yr-old adult man) grown in 12-well plates at 80–90% confluence using 3 µl of Lipofectamine 2000 (Invitrogen). Caco-2 cells were lysed 48 h after transfection, and Renilla-normalized firefly luciferase activity was measured using the Dual-Luciferase assay kit (Promega) and a luminometer (Promega).
hnRNA analysis.
The expression levels of human and mouse SVCT-1 and SVCT-2 hnRNA in the jejunum and colon were determined using cDNA (synthesized from human and mouse RNA samples) and gene-specific hnRNA primers (Table 1) that anneal to the sequence in the intron region (11, 41). Using a mouse jejunum RNA sample treated with DNase I, we also performed a negative control without reverse transcriptase, and we subjected this sample to real-time PCR with internal control β-actin primer and found no amplification where the band is expected for β-actin (data not shown). RT-qPCR was performed as described previously (37, 42).
Western blot analysis.
Samples of mouse jejunal and colonic scraped mucosa were lysed in RIPA buffer (Sigma) containing cOmplete protease inhibitor cocktail (Roche), and the soluble protein fraction was isolated after sonication followed by centrifugation (12,000 rpm, 10 min). Protein (60 μg) was loaded on a NuPAGE 4–12% minigel (Invitrogen) for electrophoresis. The separated protein was transferred on an Immobilon polyvinylidene difluoride membrane and blocked in blocking buffer (LI-COR Biosciences). Subsequently, the blot was probed with SVCT-1 (1:200 dilution), SVCT-2 (1:200 dilution), HNF1α (1:200 dilution), Sp1 (1:200 dilution), and TBP (1:3,000 dilution) polyclonal antibodies and β-actin monoclonal antibody (1:5,000 dilution). After three washes in PBS-Tween 20, the blot was incubated with secondary antibodies [anti-rabbit IRDye 800 and/or anti-mouse IRDye 680 (1:30,000 dilution)] for 45 min at room temperature. Immunoreactive bands were captured using an Odyssey infrared imaging system (LI-COR Biosciences).
Chromatin immunoprecipitation assay and qPCR.
Chromatin immunoprecipitation (ChIP) assays were performed using the Simple ChIP enzymatic chromatin immunoprecipitation kit (Cell Signaling, Danvers, MA). Briefly, jejunal and colonic mucosa from a pool of six to eight mice were used. Chromatin was cross-linked with 1% formaldehyde (final concentration), and the reaction was terminated by addition of glycine stop solution. Two milliliters of ice-cold PBS containing protease inhibitor cocktail was added to the cells, which were centrifuged at 1,500 rpm for 5 min and resuspended in 1 ml of ice-cold buffer A containing DTT and protease inhibitor cocktail. Nuclei were prepared, and chromatin was digested with micrococcal nuclease. Samples were sonicated to shear DNA into fragments and centrifuged at 10,000 rpm for 10 min; then the chromatin was analyzed for proper digestion and concentration. Five micrograms of the digested chromatin were incubated overnight with 2 µg of the specific antibody [H3 trimethylation of lysine 4 (H3K4me3) and H3 triacetylation of lysine 9 (H3K9ac) and a repressive marker, H3 trimethylation of lysine 27 (H3K27me3), and IgG (Millipore, Billerica, MA)]. Finally, immunoprecipitated samples were subjected to DNA purification and analyzed by qPCR using Slc23a1 and Slc23a2 promoter-specific primers (Table 1) to amplify the region −88 to +08 bp and −239 to −146 bp, respectively, relative to the transcription start site [relative to transcription start site (TSS) as +1] using the PCR conditions described previously (28, 42).
Statistical analysis.
Values are means ± SE from at least three independent experiments using at least three different sets of mice or batches of Caco-2 cells. Statistical significance was calculated using Student's t-test and set at P < 0.05.
RESULTS
Region-specific AA uptake by mouse jejunal and colonic segments.
Figure 1 shows carrier-mediated AA transport in mouse jejunal and colonic segments. AA uptake was significantly (P < 0.02) lower in colonic than jejunal segments (Fig. 1). To determine the basis for this effect, the relative expression of SVCT-1 and SVCT-2 in each sample of mouse jejunum and colon was analyzed by Western blotting. Individual blots resolved a lower expression of both SVCT-1 and SVCT-2 in the colon than the jejunum. After quantification by densitometry, the cumulative data set showed a considerably lower level of expression of SVCT-1 and SVCT-2 transporters in the colonic than the jejunal segment (P < 0.01 for both; Fig. 2). Next, we examined SVCT-1 and SVCT-2 mRNA levels in mouse jejunal and colonic mucosa and found a significantly (P < 0.01) lower level of expression of SVCT-1 and SVCT-2 mRNA in colonic than jejunal mucosa (Fig. 3, A and C). Examination of SVCT-1 and SVCT-2 mRNA expression in human jejunal and colonic mucosa recapitulated the data from the mouse: results showed a significantly (P < 0.01) lower level of SVCT-1 and SVCT-2 expression in the human colonic than jejunal segment (Fig. 3, B and D). Finally, we assessed the levels of hnRNA for SVCT-1 and SVCT-2. Levels of hnRNA (the first product of the gene transcription) expression are reflective of the rate of transcription of individual genes (11). Results showed significantly (P < 0.01 for mouse) lower levels of SVCT-1 and SVCT-2 hnRNA expression in mouse and human colonic than jejunal samples (Fig. 4). Overall, measurements of protein, mRNA, and hnRNA levels were consistent with the functional uptake measurements showing lower AA uptake in the distal intestinal tract (Fig. 1). Our findings suggest that the decrease in colonic AA uptake can be attributed to the lower level of transcription of both Slc23a1 and Slc23a2 genes in the colon than the jejunum.
Fig. 1.
Region-specific carrier-mediated [14C]ascorbic acid (AA) uptake by mouse jejunal and colonic segments. Jejunal and colonic segments were prepared from wild-type mice, and the initial rate of carrier-mediated [14C]AA (32 µM) uptake was determined. Values are means ± SE of multiple determinations from ≥4 (n = 4) mice. *P < 0.02.
Fig. 2.
Region-specific expression of Na+-dependent vitamin C transporter SVCT-1 and SVCT-2 proteins in mouse jejunal and colonic mucosa. SVCT-1 and SVCT-2 proteins (60 µg) were isolated from jejunum and colon of wild-type mice and subjected to Western blot analysis. Proteins from jejunum and colon were separated on a NuPAGE 4–12% minigel and transferred to a polyvinylidene difluoride membrane. Blots were incubated with anti-SVCT-1 (A) and SVCT-2 (B) rabbit polyclonal and anti-β-actin monoclonal primary antibodies for detection of specific bands. MW, molecular weight. Values are means ± SE of ≥4 separate samples from 4 (n = 4) different mice. *P < 0.01.
Fig. 3.
Region-specific expression of SVCT-1 and SVCT-2 mRNA in mouse and human jejunal and colonic mucosa. Real-time quantitative PCR was performed using mouse (A and C) and human (B and D) SVCT-1 and SVCT-2 gene-specific primers, and results were normalized to mouse and human β-actin, respectively. Values are means ± SE of multiple samples. *P < 0.01.
Fig. 4.
Region-specific expression of mouse and human SVCT-1 and SVCT-2 heterogeneous nuclear RNA (hnRNA) in jejunal and colonic mucosa. Real-time quantitative PCR was performed using mouse (A and C) and human (B and D) SVCT-1 and SVCT-2 hnRNA gene-specific primers, and results were normalized to mouse and human β-actin, respectively. Expression levels of hSVCT-1 and hSVCT-2 hnRNA were determined from a pool of 5–7 individuals. Values are means ± SE of multiple samples. *P < 0.01.
Molecular mechanism(s) involved in region-specific expression of SVCT-1 and SVCT-2 in mouse jejunal and colonic segments.
The variation in SVCT-1 and SVCT-2 expression could be caused by several mechanisms, including regional variation in the expression of transcription factor(s) that are essential for normal activity of the Slc23a1 and Slc23a2 promoters, or a variety of epigenetic mechanisms. Previous studies have demonstrated that the transcription factors HNF1α and Sp1 regulate the basal activity of the SLC23A1 and SLC23A2 promoters, respectively (19, 25, 29). These data indicate that the differential expression of HNF1α and Sp1 in mouse intestine merits examination. Western blot analysis showed significantly lower HNF1α and Sp1 protein expression (P < 0.01 for both) in the colon than the jejunum (Fig. 5, A and B). RT-qPCR results also showed significantly lower expression levels of HNF1α and Sp1 mRNA (P < 0.01 for both) in the colon than the jejunum (Fig. 5, C and D).
Fig. 5.
Region-specific expression of hepatocyte nuclear factor (HNF) 1α and specificity protein 1 (Sp1) in mouse jejunal and colonic segments. A and B: Western blots of protein samples prepared from mouse jejunum and colon and densitometric quantification of blots. Blots were incubated separately with HNF1α- and Sp1-specific polyclonal antibodies. C and D: results from real-time quantitative PCR using mouse HNF1α and Sp1 gene-specific primers and cDNA synthesized from mouse jejunal and colonic RNA samples. Values are means ± SE of multiple samples. *P < 0.01.
Next, we studied H3 modifications in mouse jejunal and colonic samples. First, we used the Eukaryotic Promoter Database (10) to identify the putative promoter region of Slc23a1 and Slc23a2 (−202 to +08 bp for Slc23a1 and −239 to −31 bp for Slc23a2 relative to the TSS). The putative Slc23a1 and Slc23a2 promoters were cloned into the pGL3-basic vector. The cloned promoter constructs were transfected into Caco-2 cells, and levels of luminescence were significantly (P < 0.01 for both) higher for these than for those cloned into the pGL3-basic empty vector (Fig. 6, A and B), validating the ability of these predicted regions to act as promoters for both genes. To evaluate region-specific H3 modifications in both samples, the activating markers H3K4me3 and H3K9ac and the repressive marker H3K27me3 were examined. ChIP was performed using specific antibodies for these H3 modifications; then the predicted promoter regions of mouse Slc23a1 (−88 to +08 bp relative to the TSS) and Slc23a2 (−239 to −146 bp relative to the TSS) genes were analyzed by qPCR. The results showed a significant (P < 0.01) decrease in H3K4me3 and H3K9ac and a marked increase in H3K27me3 levels in mouse colon compared with jejunum for Slc23a1 (Fig. 6C) and a marked decrease in H3K4me3 and H3K9ac levels, but no significant change in H3K27me3 levels, between the colon and the jejunum (Fig. 6D).
Fig. 6.
Mouse Slc23a1 and Slc23a2 promoter-luciferase activity in Caco-2 cells and chromatin immunoprecipitation (ChIP) quantitative PCR analysis of histone (H3) modification in mouse jejunal and colonic segments. A and B: pGL3-Slc23a1 and pGL3-Slc23a2 plasmids were transiently transfected into Caco-2 cells, firefly luciferase activity was determined, and data were normalized relative to Renilla luciferase activity. C and D: samples were scraped from mouse jejunal and colonic mucosa, and formaldehyde cross-linked chromatin was immunoprecipitated using antibodies specific to histone H3: H3K4me3, H3K9ac, and H3K27me3. DNA was purified from the immunoprecipitated complexes, and the purified DNA fragments were subjected to quantitative PCR. Results from separate PCR amplification of mouse Slc23a1 promoter spanning the region −88 to +08 bp (C) and mouse Slc23a2 promoter spanning the region −239 to −146 bp (D) were normalized relative to input DNA and expressed as percentage of enrichment relative to H3. Values are means ± SE of multiple samples. *P < 0.01, **P < 0.05.
DISCUSSION
The molecular mechanisms responsible for regional variation in expression of the vitamin C transporters SVCT-1 and SVCT-2 in the jejunum and colon are not well established. We used mouse and human intestinal cDNAs to examine these issues. Our results showed a significantly lower carrier-mediated AA uptake in the colon than the jejunum. This decrease was associated with a markedly lower level of expression of both SVCT-1 and SVCT-2 at protein, mRNA, and hnRNA levels. These findings suggest that the lower level of AA uptake in the colon is attributable, in part, to differential levels of transcription of the Slc23a1 and Slc23a2 genes between these regions.
Recent studies have demonstrated that the region-specific expression of transporters can occur via a variety of mechanisms, including differential expression of relevant transcription factor(s) and a variety of epigenetic mechanism(s), including histone modifications, DNA methylation, and regulation by microRNA(s) (17, 22–24, 43). We have shown that changes in transcription factor abundance and histone modifications are relevant to the control of expression levels of SVCT-1 and SVCT-2 in the colon and the jejunum.
First, we found markedly lower levels of expression of two transcription factors (HNF1α and Sp1) in the colon than the jejunum (cis-regulatory elements of both transcription factors are conserved in mouse and human Slc23a1 and Slc23a2 gene promoters), and these transcription factors have been shown to drive basal promoter activity of the SLC23A1 and SLC23A2 genes (19, 25, 29). Second, we examined the epigenetic mechanism(s) that may contribute to region-specific expression of SVCT-1 and SVCT-2. Our results showed lower levels of expression of H3K4me3 and H3K9ac (euchromatin markers) in the colon than the jejunum for both Slc23a1 and Slc23a2 genes. On the other hand, expression of H3K27me3 (a heterochromatin marker) was higher in the colon than the jejunum for Slc23a1, but no marked change was observed for Slc23a2. Interestingly, vitamin C has been shown to regulate the epigenome, suggesting a possible role of vitamin C itself in the regional expression of genes (7, 21, 47). Such observations support a potential contribution of histone modifications to differential regional expression of the vitamin C transporters and regulation of vitamin C homeostasis.
It is also important to acknowledge the potential role of other epigenetic regulatory mechanisms. For example, DNA methylation has been shown to regulate cell-specific human SVCT-2 (hSVCT-2) exon 1a promoter activity (24), and, reciprocally, vitamin C is itself an important regulator of DNA global methylation status by virtue of its action as a cofactor for Tet methylcytosine dioxygenase (20). MicroRNA expression profiles in human small and large intestine demonstrate differential microRNA expression between normal small and large intestinal tissues (48), such that regulation of microRNA may also play a role in differential gene expression. Indeed, preliminary in silico analysis of the SLC23A1 and SLC23A2 3′-untranslated region utilizing a variety of prediction algorithms (Targetscan, MicroCosm, miRDB, miRGen, and miRanda) revealed many predicted microRNA seed sites in both SLC23A1 (e.g., miR103a and miR107) and SLC23A2 [e.g., miR141 and miR200a (31)] 3′-untranslated regions. The microRNAs miR103, miR107, miR141, and miR200a are relatively enriched in the small intestine compared with the large intestine (48), meriting future investigation.
In conclusion, the results of these investigations showed, for the first time, that SVCT-1 and SVCT-2 are expressed in a region-specific manner within the intestine and that this expression pattern is, at least in part, mediated by transcriptional and epigenetic regulatory mechanism(s) of both Slc23a1 and Slc23a2 genes.
GRANTS
This study was supported by National Institutes of Health Grants DK-107474 (V. S. Subramanian), DK-58057 and DK-56057 (H. M. Said), and GM-088790 (J. S. Marchant) and a grant from the Department of Veterans Affairs.
DISCLOSURES
No conflicts of interest, financial or otherwise, are declared by the authors.
AUTHOR CONTRIBUTIONS
V.S.S. developed the concept and designed the research; V.S.S., P.S., and A.J.W. performed the experiments; V.S.S., P.S., J.S.M., and H.M.S. analyzed the data; V.S.S., P.S., and H.M.S. interpreted the results of the experiments; V.S.S. and P.S. prepared the figures; V.S.S., P.S., J.S.M., and H.M.S. drafted the manuscript; V.S.S., P.S., A.J.W., J.S.M., and H.M.S. edited and revised the manuscript; V.S.S., P.S., A.J.W., J.S.M., and H.M.S. approved the final version of the manuscript.
REFERENCES
- 1.Alcantara-Martos T, Delgado-Martinez AD, Vega MV, Carrascal MT, Munuera-Martinez L. Effect of vitamin C on fracture healing in elderly Osteogenic Disorder Shionogi rats. J Bone Joint Surg Br 89B: 402–407, 2007. doi: 10.1302/0301-620X.89B3.18007. [DOI] [PubMed] [Google Scholar]
- 2.Boyer JC, Campbell CE, Sigurdson WJ, Kuo SM. Polarized localization of vitamin C transporters, SVCT1 and SVCT2, in epithelial cells. Biochem Biophys Res Commun 334: 150–156, 2005. doi: 10.1016/j.bbrc.2005.06.069. [DOI] [PubMed] [Google Scholar]
- 3.Buffinton GD, Doe WF. Altered ascorbic acid status in the mucosa from inflammatory bowel disease patients. Free Radic Res 22: 131–143, 1995. doi: 10.3109/10715769509147535. [DOI] [PubMed] [Google Scholar]
- 4.Buffinton GD, Doe WF. Depleted mucosal antioxidant defences in inflammatory bowel disease. Free Radic Biol Med 19: 911–918, 1995. doi: 10.1016/0891-5849(95)94362-H. [DOI] [PubMed] [Google Scholar]
- 5.Bulger EM, Helton WS. Nutrient antioxidants in gastrointestinal diseases. Gastroenterol Clin North Am 27: 403–419, 1998. doi: 10.1016/S0889-8553(05)70010-8. [DOI] [PubMed] [Google Scholar]
- 6.Carr AC, Frei B. Toward a new recommended dietary allowance for vitamin C based on antioxidant and health effects in humans. Am J Clin Nutr 69: 1086–1107, 1999. [DOI] [PubMed] [Google Scholar]
- 7.Chen J, Guo L, Zhang L, Wu H, Yang J, Liu H, Wang X, Hu X, Gu T, Zhou Z, Liu J, Liu J, Wu H, Mao SQ, Mo K, Li Y, Lai K, Qi J, Yao H, Pan G, Xu GL, Pei D. Vitamin C modulates TET1 function during somatic cell reprogramming. Nat Genet 45: 1504–1509, 2013. doi: 10.1038/ng.2807. [DOI] [PubMed] [Google Scholar]
- 8.Corpe CP, Tu H, Eck P, Wang J, Faulhaber-Walter R, Schnermann J, Margolis S, Padayatty S, Sun H, Wang Y, Nussbaum RL, Espey MG, Levine M. Vitamin C transporter Slc23a1 links renal reabsorption, vitamin C tissue accumulation, and perinatal survival in mice. J Clin Invest 120: 1069–1083, 2010. doi: 10.1172/JCI39191. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Daruwala R, Song J, Koh WS, Rumsey SC, Levine M. Cloning and functional characterization of the human sodium-dependent vitamin C transporters hSVCT1 and hSVCT2. FEBS Lett 460: 480–484, 1999. doi: 10.1016/S0014-5793(99)01393-9. [DOI] [PubMed] [Google Scholar]
- 10.Dreos R, Ambrosini G, Périer RC, Bucher P. The Eukaryotic Promoter Database: expansion of EPDnew and new promoter analysis tools. Nucleic Acids Res 43, D1: D92–D96, 2015. doi: 10.1093/nar/gku1111. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Elferink CJ, Reiners JJ Jr. Quantitative RT-PCR on CYP1A1 heterogeneous nuclear RNA: a surrogate for the in vitro transcription run-on assay. Biotechniques 20: 470–477, 1996. [DOI] [PubMed] [Google Scholar]
- 12.Harrison SA, Torgerson S, Hayashi P, Ward J, Schenker S. Vitamin E and vitamin C treatment improves fibrosis in patients with nonalcoholic steatohepatitis. Am J Gastroenterol 98: 2485–2490, 2003. doi: 10.1111/j.1572-0241.2003.08699.x. [DOI] [PubMed] [Google Scholar]
- 13.Hengstermann S, Valentini L, Schaper L, Buning C, Koernicke T, Maritschnegg M, Buhner S, Tillinger W, Regano N, Guglielmi F, Winklhofer-Roob BM, Lochs H. Altered status of antioxidant vitamins and fatty acids in patients with inactive inflammatory bowel disease. Clin Nutr 27: 571–578, 2008. doi: 10.1016/j.clnu.2008.01.007. [DOI] [PubMed] [Google Scholar]
- 14.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(−ΔΔCT) method. Methods 25: 402–408, 2001. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
- 15.Liang W-J, Johnson D, Jarvis SM. Vitamin C transport systems of mammalian cells. Mol Membr Biol 18: 87–95, 2001. doi: 10.1080/09687680110033774. [DOI] [PubMed] [Google Scholar]
- 16.Lykkesfeldt J, Priemé H, Loft S, Poulsen HE. Effect of smoking cessation on plasma ascorbic acid concentration. BMJ 313: 91, 1996. doi: 10.1136/bmj.313.7049.91. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Malhotra P, Soni V, Kumar A, Anbazhagan AN, Dudeja A, Saksena S, Gill RK, Dudeja PK, Alrefai WA. Epigenetic modulation of intestinal cholesterol transporter Niemann-Pick C1-like 1 (NPC1L1) gene expression by DNA methylation. J Biol Chem 289: 23132–23140, 2014. doi: 10.1074/jbc.M113.546283. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Maulén NP, Henríquez EA, Kempe S, Cárcamo JG, Schmid-Kotsas A, Bachem M, Grünert A, Bustamante ME, Nualart F, Vera JC. Up-regulation and polarized expression of the sodium-ascorbic acid transporter SVCT1 in post-confluent differentiated CaCo-2 cells. J Biol Chem 278: 9035–9041, 2003. doi: 10.1074/jbc.M205119200. [DOI] [PubMed] [Google Scholar]
- 19.Michels AJ, Hagen TM. Hepatocyte nuclear factor 1 is essential for transcription of sodium-dependent vitamin C transporter protein 1. Am J Physiol Cell Physiol 297: C1220–C1227, 2009. doi: 10.1152/ajpcell.00348.2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Minor EA, Court BL, Young JI, Wang G. Ascorbate induces ten-eleven translocation (Tet) methylcytosine dioxygenase-mediated generation of 5-hydroxymethylcytosine. J Biol Chem 288: 13669–13674, 2013. doi: 10.1074/jbc.C113.464800. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Monfort A, Wutz A. Breathing-in epigenetic change with vitamin C. EMBO Rep 14: 337–346, 2013. doi: 10.1038/embor.2013.29. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Mutch DM, Anderle P, Fiaux M, Mansourian R, Vidal K, Wahli W, Williamson G, Roberts M-A. Regional variations in ABC transporter expression along the mouse intestinal tract. Physiol Genomics 17: 11–20, 2004. doi: 10.1152/physiolgenomics.00150.2003. [DOI] [PubMed] [Google Scholar]
- 23.Nabokina SM, Ramos MB, Said HM. Mechanism(s) involved in the colon-specific expression of the thiamine pyrophosphate (TPP) transporter. PLos One 11: e0149255, 2016. doi: 10.1371/journal.pone.0149255. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Qiao H, May JM. CpG methylation at the USF-binding site mediates cell-specific transcription of human ascorbate transporter SVCT2 exon 1a. Biochem J 440: 73–84, 2011. doi: 10.1042/BJ20110392. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Qiao H, May JM. Regulation of the human ascorbate transporter SVCT2 exon 1b gene by zinc-finger transcription factors. Free Radic Biol Med 50: 1196–1209, 2011. doi: 10.1016/j.freeradbiomed.2011.02.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Packer L, Fuchs J. Vitamin C in Health and Disease. New York: Dekker, 1997. [Google Scholar]
- 27.Rajan DP, Huang W, Dutta B, Devoe LD, Leibach FH, Ganapathy V, Prasad PD. Human placental sodium-dependent vitamin C transporter (SVCT2): molecular cloning and transport function. Biochem Biophys Res Commun 262: 762–768, 1999. doi: 10.1006/bbrc.1999.1272. [DOI] [PubMed] [Google Scholar]
- 28.Reidling JC, Subramanian VS, Dahhan T, Sadat M, Said HM. Mechanisms and regulation of vitamin C uptake: studies of the hSVCT systems in human liver epithelial cells. Am J Physiol Gastrointest Liver Physiol 295: G1217–G1227, 2008. doi: 10.1152/ajpgi.90399.2008. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Reidling JC, Rubin SA. Promoter analysis of the human ascorbic acid transporters SVCT1 and 2: mechanisms of adaptive regulation in liver epithelial cells. J Nutr Biochem 22: 344–350, 2011. doi: 10.1016/j.jnutbio.2010.03.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Rondanelli M, Opizzi A, Perna S, Faliva MA. Update on nutrients involved in maintaining healthy bone. Endocrinol Nutr 60: 197–210, 2013. doi: 10.1016/j.endonu.2012.09.006. [DOI] [PubMed] [Google Scholar]
- 31.Sangani R, Periyasamy-Thandavan S, Kolhe R, Bhattacharyya MH, Chutkan N, Hunter M, Isales C, Hamrick M, Hill WD, Fulzele S. MicroRNAs-141 and 200a regulate the SVCT2 transporter in bone marrow stromal cells. Mol Cell Endocrinol 410: 19–26, 2015. doi: 10.1016/j.mce.2015.01.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Savini I, Rossi A, Pierro C, Avigliano L, Catani MV. SVCT1 and SVCT2: key proteins for vitamin C uptake. Amino Acids 34: 347–355, 2008. doi: 10.1007/s00726-007-0555-7. [DOI] [PubMed] [Google Scholar]
- 33.Schectman G, Byrd JC, Gruchow HW. The influence of smoking on vitamin C status in adults. Am J Public Health 79: 158–162, 1989. doi: 10.2105/AJPH.79.2.158. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Schleicher RL, Carroll MD, Ford ES, Lacher DA. Serum vitamin C and the prevalence of vitamin C deficiency in the United States: 2003-2004 National Health and Nutrition Examination Survey (NHANES). Am J Clin Nutr 90: 1252–1263, 2009. doi: 10.3945/ajcn.2008.27016. [DOI] [PubMed] [Google Scholar]
- 35.Simon JA, Hudes ES. Serum ascorbic acid and gallbladder disease prevalence among US adults: the Third National Health and Nutrition Examination Survey (NHANES III). Arch Intern Med 160: 931–936, 2000. doi: 10.1001/archinte.160.7.931. [DOI] [PubMed] [Google Scholar]
- 36.Sotiriou S, Gispert S, Cheng J, Wang Y, Chen A, Hoogstraten-Miller S, Miller GF, Kwon O, Levine M, Guttentag SH, Nussbaum RL. Ascorbic-acid transporter Slc23a1 is essential for vitamin C transport into the brain and for perinatal survival. Nat Med 8: 514–517, 2002. doi: 10.1038/0502-514. [DOI] [PubMed] [Google Scholar]
- 37.Srinivasan P, Subramanian VS, Said HM. Mechanisms involved in the inhibitory effect of chronic alcohol exposure on pancreatic acinar thiamin uptake. Am J Physiol Gastrointest Liver Physiol 306: G631–G639, 2014. doi: 10.1152/ajpgi.00420.2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Subramanian VS, Marchant JS, Boulware MJ, Said HM. A C-terminal region dictates the apical plasma membrane targeting of the human sodium-dependent vitamin C transporter-1 in polarized epithelia. J Biol Chem 279: 27719–27728, 2004. doi: 10.1074/jbc.M400876200. [DOI] [PubMed] [Google Scholar]
- 39.Subramanian VS, Marchant JS, Reidling JC, Said HM. N-glycosylation is required for Na+-dependent vitamin C transporter functionality. Biochem Biophys Res Commun 374: 123–127, 2008. doi: 10.1016/j.bbrc.2008.06.120. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Subramanian VS, Subramanya SB, Ghosal A, Marchant JS, Harada A, Said HM. Modulation of function of sodium-dependent vitamin C transporter 1 (SVCT1) by Rab8a in intestinal epithelial cells: studies utilizing Caco-2 cells and Rab8a knockout mice. Dig Dis Sci 58: 641–649, 2013. doi: 10.1007/s10620-012-2388-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Subramanian VS, Subramanya SB, Ghosal A, Said HM. Chronic alcohol feeding inhibits physiological and molecular parameters of intestinal and renal riboflavin transport. Am J Physiol Cell Physiol 305: C539–C546, 2013. doi: 10.1152/ajpcell.00089.2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Subramanian VS, Srinivasan P, Said HM. Uptake of ascorbic acid by pancreatic acinar cells is negatively impacted by chronic alcohol exposure. Am J Physiol Cell Physiol 311: C129–C135, 2016. doi: 10.1152/ajpcell.00042.2016. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Tümer E, Bröer A, Balkrishna S, Jülich T, Bröer S. Enterocyte-specific regulation of the apical nutrient transporter SLC6A19 (B0AT1) by transcriptional and epigenetic networks. J Biol Chem 288: 33813–33823, 2013. doi: 10.1074/jbc.M113.482760. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Wilson JX. Regulation of vitamin C transport. Annu Rev Nutr 25: 105–125, 2005. doi: 10.1146/annurev.nutr.25.050304.092647. [DOI] [PubMed] [Google Scholar]
- 45.Wang H, Dutta B, Huang W, Devoe LD, Leibach FH, Ganapathy V, Prasad PD. Human Na+-dependent vitamin C transporter 1 (hSVCT1): primary structure, functional characteristics and evidence for a non-functional splice variant. Biochim Biophys Acta 1461: 1–9, 1999. doi: 10.1016/S0005-2736(99)00182-0. [DOI] [PubMed] [Google Scholar]
- 46.Wang Y, Mackenzie B, Tsukaguchi H, Weremowicz S, Morton CC, Hediger MA. Human vitamin C (l-ascorbic acid) transporter SVCT1. Biochem Biophys Res Commun 267: 488–494, 2000. doi: 10.1006/bbrc.1999.1929. [DOI] [PubMed] [Google Scholar]
- 47.Young JI, Züchner S, Wang G. Regulation of the epigenome by vitamin C. Annu Rev Nutr 35: 545–564, 2015. doi: 10.1146/annurev-nutr-071714-034228. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48.Zhang Z, Zhang MQ. Histone modification profiles are predictive for tissue/cell-type specific expression of both protein-coding and microRNA genes. BMC Bioinformatics 12: 155, 2011. doi: 10.1186/1471-2105-12-155. [DOI] [PMC free article] [PubMed] [Google Scholar]