Skip to main content
Journal of Virology logoLink to Journal of Virology
. 2017 Apr 28;91(10):e02111-16. doi: 10.1128/JVI.02111-16

CpG in Combination with an Inhibitor of Notch Signaling Suppresses Formalin-Inactivated Respiratory Syncytial Virus-Enhanced Airway Hyperresponsiveness and Inflammation by Inhibiting Th17 Memory Responses and Promoting Tissue-Resident Memory Cells in Lungs

Lei Zhang a, Hongyong Li a,c, Yan Hai a, Wei Yin a, Wenjian Li a, Boyang Zheng d, Xiaomin Du a,c, Na Li a,c, Zhengzheng Zhang a, Yuqing Deng a, Ruihong Zeng a,, Lin Wei b,
Editor: Stanley Perlmane
PMCID: PMC5411608  PMID: 28275186

ABSTRACT

Respiratory syncytial virus (RSV) is the leading cause of childhood hospitalizations. The formalin-inactivated RSV (FI-RSV) vaccine-enhanced respiratory disease (ERD) has been an obstacle to the development of a safe and effective killed RSV vaccine. Agonists of Toll-like receptor (TLR) have been shown to regulate immune responses induced by FI-RSV. Notch signaling plays critical roles during the differentiation and effector function phases of innate and adaptive immune responses. Cross talk between TLR and Notch signaling pathways results in fine-tuning of TLR-triggered innate inflammatory responses. We evaluated the impact of TLR and Notch signaling on ERD in a murine model by administering CpG, an agonist of TLR9, in combination with L685,458, an inhibitor of Notch signaling during FI-RSV immunization. Activation with CpG or deficiency of MyD88-dependent TLR signaling did not alleviate airway inflammation in FI-RSV-immunized mice. Activation or inhibition of Notch signaling with Dll4, one of the Notch ligands, or L685,458 did not suppress FI-RSV-enhanced airway inflammation either. However, the CpG together with L685,458 markedly inhibited FI-RSV-enhanced airway hyperresponsiveness, weight loss, and lung inflammation. Interestingly, CpG plus L685,458 completely inhibited FI-RSV-associated Th17 and Th17-associated proinflammatory chemokine responses in lungs following RSV challenge but not Th1 or Th2, memory responses. In addition, FI-RSV plus CpG plus L685,458 promoted protective CD8+ lung tissue-resident memory (TRM) cells. These results indicate that activation of TLR signaling combined with inhibition of Notch signaling prevent FI-RSV ERD, and the mechanism appears to involve suppressing proinflammatory Th17 memory responses and promoting protective TRM in lungs.

IMPORTANCE RSV is the most important cause of lower respiratory tract infections in infants. The FI-RSV-enhanced respiratory disease (ERD) is a major impediment to the development of a safe and effective killed RSV vaccine. Using adjuvants to regulate innate and adaptive immune responses could be an effective method to prevent ERD. We evaluated the impact of TLR and Notch signaling on ERD by administering CpG, an agonist of TLR9, in combination with L685,458, an inhibitor of Notch signaling, during FI-RSV immunization. The data showed that treatment of TLR or Notch signaling alone did not suppress FI-RSV-enhanced airway inflammation, while CpG plus L685,458 markedly inhibited ERD. The mechanism appears to involve suppressing Th17 memory responses and promoting tissue-resident memory cells. Moreover, these results suggest that regulation of lung immune memory with adjuvant compounds containing more than one immune-stimulatory molecule may be a good strategy to prevent FI-RSV ERD.

KEYWORDS: CpG, FI-RSV-enhanced respiratory disease, inhibitor of Notch signaling, Th17, tissue-resident memory cells

INTRODUCTION

Respiratory syncytial virus (RSV) is the leading cause of severe lower respiratory tract infection of infants and young children worldwide, and 1.7% of RSV-infected children younger than 6 months are hospitalized (1). The average RSV-attributed death rate in this age group is 8.4 per 100,000 population (2). RSV vaccine development efforts such as killed RSV, live attenuated RSV, subunit vaccines, or DNA vaccines are under way (3). However, there remains no licensed vaccine to prevent RSV infection. One obstacle to vaccine development has been the enhanced respiratory disease (ERD) caused by the formalin-inactivated RSV (FI-RSV) vaccine tested in the 1960s. Children that were administered the FI-RSV vaccine exhibited a more severe respiratory illness following a subsequent natural RSV exposure, 80% were hospitalized, and tragically 2 children died (4). The main clinical manifestations in children with ERD were severe peribronchiolitis and alveolitis (5). Histological examination of the lungs from the deceased revealed extensive neutrophils, mononuclear cells, and lymphocytes and increased amounts of eosinophil infiltration (5, 6). Graham et al. (7) reported that ERD was associated with a Th2-type response. Formalin denaturation of F protein in FI-RSV diminished its ability to stimulate Toll-like receptor 4 (TLR4)-mediated signaling, resulting in a Th2-type bias (5). Moreover, RSV vaccines could be associated with a Th17 response (8, 9). As such, ERD could be an immunopathological disease caused by both innate and adaptive immune responses. To develop an effective killed vaccine that does not enhance RSV illness, it is important to understand ERD pathogenesis and explore how to regulate the balance of immune responses induced by killed RSV vaccines.

Adjuvants can guide the type of immune response, better tailoring the vaccine toward the desired clinical benefit. Alum is the most widely used adjuvant in nonliving vaccines due to its good track record of safety, low cost, and adjuvanticity with a variety of antigens. However, there are some limitations of aluminum adjuvant, including induction of eosinophilia, preferentially priming Th2-type immune responses, and inability to augment cytotoxic T cell responses (10). The RSV Lot 100 vaccine used in clinical trials in the 1960s used alum as its only adjuvant (11).

Toll-like receptors (TLRs) are expressed most prominently on or in antigen-presenting cells (APCs) such as macrophages and dendritic cells (DCs) (12). TLR-mediated recognition of specific structures of invading pathogens initiates innate immunity, which instructs APCs to activate and secrete cytokines in order to polarize T cells toward Th1, Th2, Th17, regulatory T cells (Treg), and others (13). TLRs are also expressed by various T cell subsets and can function as costimulatory receptors to induce and regulate T cell proliferation, survival, activation, and effector functions (1416). TLR agonists are attractive candidates for vaccine adjuvants due to their ability to activate the innate immune response and directly and indirectly regulate adaptive immune responses.

The role of TLR agonists as FI-RSV vaccine adjuvants has been investigated previously (17, 18). However, excessive activation of TLR responses can lead to inflammation disorders and tissue damage. Therefore, tight regulation of TLR responses is essential for maintaining the immune balance. Notch signaling plays critical roles during the differentiation and effector function phases of the innate and adaptive immune responses. Notch signaling promotes peripheral T cell activation, proliferation, and survival and regulates the differentiation of naive CD4 T cells into effector Th1, Th2, and Th17 cells (1921). Recent evidence suggests that there is cross talk between Notch and TLR signaling pathways (22, 23). In macrophages, stimulation by TLR agonists results in the activation of the Notch signaling pathway in an MyD88-dependent manner (22). Synergistic cooperation between the Notch pathway and TLR signaling results in the activation of canonical Notch target genes such as Hes1 and Hey1 and of canonical TLR-inducible genes encoding cytokines of the interleukin-6 (IL-6) and IL-12 family (24). Blocking Notch signaling decreased the expression of TLR-inducible genes, including the proinflammatory cytokines tumor necrosis factor alpha (TNF-α), IL-1β, IL-6, and IL-12 (22, 25). Targeted deletion of Notch2 in DC subsets decreases CD11b+ DCs in the spleen and intestines, which in turn decreases the number of Th17 cells in the intestine (26).

Based on the above evidence, we hypothesized that targeting both TLR and Notch signaling may be a novel, alternative way to attenuate ERD through regulating innate and adaptive immune responses elicited by FI-RSV, which is important for an understanding of ERD pathogenesis. In this study, the regulating effect of TLR and Notch signaling on FI-RSV ERD was investigated. We found that treatments affecting TLR or Notch signaling alone did not significantly inhibit ERD. Interestingly, CpG, a TLR9 agonist, combined with L685,458, a pharmacological inhibitor of Notch signaling, could markedly inhibit FI-RSV ERD, and the mechanism may involve suppressing Th17 memory responses and promoting tissue-resident memory (TRM) cells in lungs.

RESULTS

Unadjuvanted FI-RSV elicits significant but reduced airway inflammation compared with Al(OH)3-adjuvanted FI-RSV.

Since alum adjuvant preferentially primes Th2-type immune responses, characteristic of FI-RSV ERD, the limitations of alum adjuvant may contribute to FI-RSV ERD. Removing alum adjuvant from FI-RSV vaccine formulation may be the first step to preventing ERD. We investigated the airway inflammation of mice immunized with FI-RSV plus Al(OH)3 [FI-RSV+Al(OH)3] or FI-RSV alone (Fig. 1). Mice that were immunized with FI-RSV+Al(OH)3 or FI-RSV developed enhanced pulmonary pathological responses after RSV challenge compared to responses of mice immunized with an FI control (FI-C) (Fig. 1). Mice immunized with FI-RSV+Al(OH)3 showed more extensive, severe, multifocal cell infiltration in the peribronchial and perivascular spaces and more mucus production than those immunized with FI-RSV alone (P < 0.05) (Fig. 1A to D). Neutrophilic alveolitis was a marker of ERD in both cotton rats and infants (5). The percentage of neutrophils was significantly higher in bronchoalveolar lavage fluid (BALF) of the FI-RSV+Al(OH)3, FI-RSV, and FI-C groups than in that of the phosphate-buffered saline (PBS) control and was the highest in the FI-RSV+Al(OH)3 group (P < 0.05) (Fig. 1E). In addition, mRNA expression of both Th2 cell lineage-specific transcription factor GATA3 and the cytokine IL-5 in the FI-RSV+Al(OH)3 group was higher than that of the FI-RSV group (P < 0.05) (Fig. 1F and G). Since unadjuvanted FI-RSV elicited significantly reduced but still problematic airway inflammation compared with FI-RSV+Al(OH)3, we conducted all subsequent experiments using FI-RSV but not FI-RSV+Al(OH)3.

FIG 1.

FIG 1

FIG 1

FI-RSV elicits significant, but reduced, airway inflammation compared with FI-RSV+Al(OH)3 treatment. Mice were immunized i.m. with FI-RSV, FI-RSV+Al(OH)3, FI-C, or PBS two times, challenged i.n. by RSV 28 days after the last immunization, and sacrificed 5 days later for histopathology and inflammation studies. (A) H&E staining shows peribronchiolar, perivascular, and interstitial pneumonia. (B) Periodic acid-Schiff (PAS) staining shows bronchiolar mucus production. (C and D) Scores for pulmonary inflammation and mucus. Tissue sections obtained from each mouse were scored for inflammation and mucus as described in Materials and Methods. (E) The percentage of neutrophils of leukocytes in BALF. (F and G) The relative expression levels of a Th2 transcription factor (GATA3) and cytokine (IL-5). Data are presented as means ± standard deviations of five mice per group and are representative of two experiments. *, P < 0.05.

Activation or deficiency of MyD88-dependent signaling does not alleviate airway inflammation in FI-RSV-immunized mice.

One of the primary pathways for TLR activation is via MyD88 adapter protein signaling. We tested the regulating effect of MyD88-dependent signaling on FI-RSV-enhanced airway inflammation. Both wild-type (WT) mice immunized with FI-RSV plus CpG (FI-RSV+CpG) and MyD88−/− mice immunized with FI-RSV developed more severe peribronchiolar and interstitial pneumonitis than WT mice immunized with FI-RSV (P < 0.05) (Fig. 2A and C). MyD88−/− mice immunized with FI-RSV exhibited more mucus than WT mice immunized with FI-RSV (P < 0.05) (Fig. 2B and D), while WT mice immunized with FI-RSV+CpG showed no mucus in their lungs. The three groups of immunized mice had increased total numbers of inflammatory cells and neutrophils in BALF than the control group (P < 0.05) (Fig. 2E and F). The number of total inflammatory cells in the FI-RSV+CpG group was significantly higher than that in the FI-RSV group (P < 0.05) (Fig. 2E). The percentage of lymphocytes in MyD88−/− mice immunized with FI-RSV was reduced while the percentage of neutrophils in these mice was increased compared with levels in WT mice immunized with FI-RSV (P < 0.05) (Fig. 2F). The results suggest that neither activation nor deficiency of MyD88-dependent signaling attenuates FI-RSV-enhanced airway inflammation.

FIG 2.

FIG 2

Activation or deficiency of MyD88-dependent TLR signaling did not alleviate airway inflammation in FI-RSV-immunized mice. WT mice were immunized i.m. with FI-RSV, FI-RSV+CpG, or PBS, and MyD88−/− mice were immunized i.m. with FI-RSV two times. All mice were challenged i.n. by RSV 28 days after the last immunization and sacrificed 5 days later for histopathology and inflammation studies. (A) H&E staining shows peribronchiolar, perivascular, and interstitial pneumonia. (B) PAS staining shows bronchiolar mucus production. (C and D) Scores for pulmonary inflammation and mucus. Tissue sections obtained from each mouse were scored for inflammation and mucus as described in Materials and Methods. (E) Number of total leukocytes in BALF. (F) The percentages of macrophages, neutrophils, and lymphocytes in BALF. Data are presented as means ± standard deviations of five mice per group and are representative of two experiments. *, P < 0.05.

Activation or inhibition of Notch signaling does not suppress FI-RSV-enhanced airway inflammation.

Dll4, one of the Notch ligands, has been identified as a critical modulator of virus-induced airway disease (27). L685,458, a γ-secretase inhibitor, is a pharmacological inhibitor of Notch signaling that prevents the enzymatic cleavage of the cytoplasmic domain of Notch receptors (28). To test the functional role of Notch signaling in ERD, we compared the lung inflammation in mice immunized with FI-RSV+Dll4, FI-RSV+L685,458, and FI-RSV. FI-RSV+L685,458 immunization exacerbated peribronchiolar pneumonia but alleviated mucus production in lungs compared with FI-RSV immunization (P < 0.05), while FI-RSV+Dll4 immunization had no remarkable effect on inflammatory cell infiltration but increased mucus production (Fig. 3A to D). The three immunized groups showed significantly more total inflammatory cells and neutrophils in BALF than the PBS group (P < 0.05) (Fig. 3E and F. The percentage of neutrophils in the FI-RSV+Dll4 group was higher than that of the FI-RSV group (P < 0.05) (Fig. 3F). These results indicated that activation or inhibition of Notch signaling did not inhibit FI-RSV-enhanced airway inflammation.

FIG 3.

FIG 3

Activation or inhibition of Notch signaling did not suppress FI-RSV-enhanced airway inflammation. Mice were immunized i.m. with FI-RSV, FI-RSV+Dll4, or PBS two times, challenged i.n. by RSV 28 days after the last immunization, and sacrificed 5 days later for histopathology and inflammation studies. (A) H&E staining shows peribronchiolar, perivascular, and interstitial pneumonia. (B) PAS staining shows bronchiolar mucus production. (C and D) Scores for pulmonary inflammation and mucus. Tissue sections obtained from each mouse were scored for inflammation and mucus as described in Materials and Methods. (E) Numbers of total leukocytes in BALF. (F) The percentages of macrophages, neutrophils, and lymphocytes in BALF. Data are presented as means ± standard deviations of five mice per group and are representative of two experiments. *, P < 0.05.

Activation of TLR signaling combined with inhibition of Notch signaling prevents FI-RSV-enhanced airway hyperresponsiveness and inflammation.

Since regulation of MyD88-dependent TLR signaling or Notch signaling alone could not inhibit ERD, we tested the regulating effect of the cross talk between TLR and Notch signaling on ERD. Airway hyperresponsiveness (AHR) is an important marker of ERD in animal models (18). Figure 4A illustrates the changes in lung resistance (RL) and dynamic compliance (Cdyn) to methacholine (MCh) in groups treated with PBS, FI-RSV, and FI-RSV+CpG+L685,458 after RSV challenge. AHR was significantly increased in the FI-RSV group compared with that in the PBS group (P < 0.05). However, AHR in the FI-RSV+CpG+L685,458 group was significantly reduced compared with that in the FI-RSV group (P < 0.05). In parallel to the assessment of lung function, FI-RSV+CpG+L685,458 immunization inhibited peribronchiolar, perivascular, and interstitial pneumonitis and mucus production in lungs after RSV challenge compared with levels with FI-RSV immunization (P < 0.05) (Fig. 4B to E). The expression of mucus-associated gene gob5 was significantly reduced in the FI-RSV+CpG+L685,458 group compared with that in the FI-RSV group (P < 0.05) (Fig. 4F). The total number of inflammatory cells and the percentage of neutrophils in BALF of mice immunized with FI-RSV+CpG+L685,458 were less than those of mice immunized with FI-RSV alone (P < 0.05) (Fig. 4G and H). The results indicate that activation of TLR signaling by CpG combined with inhibition of Notch signaling by L685,458 inhibited FI-RSV-enhanced AHR and inflammation.

FIG 4.

FIG 4

FIG 4

CpG combined with an inhibitor of Notch signaling, L685,458, suppressed FI-RSV-enhanced airway hyperresponsiveness and lung inflammation. Mice were immunized i.m. with PBS, FI-RSV, or FI-RSV+CpG+L685,458 two times, challenged i.n. by RSV 28 days after the last immunization, and sacrificed 5 days later. (A) Kinetics of the development of dynamic compliance (Cdyn) and lung resistance (RL). (B) H&E staining shows peribronchiolar, perivascular, and interstitial pneumonia. (C) PAS staining shows bronchiolar mucus production. (D and E) Scores for pulmonary inflammation and mucus. Tissue sections obtained from each mouse were scored for inflammation and mucus as described in Materials and Methods. (F) Relative expression levels of the mucus-associated gene gob5. (G) Numbers of total leukocytes in BALF. (H) The percentages of macrophages, neutrophils, and lymphocytes in BALF. Data are presented as means ± standard deviations of five mice per group and are representative of two experiments. *, P < 0.05.

CpG+L685,458 inhibited FI-RSV-associated weight loss following RSV challenge.

Weight loss is used as a sign of clinical severity in mouse RSV disease. Mice immunized with FI-RSV showed significant weight loss compared with PBS-treated control mice (P < 0.05) (Fig. 5). Remarkable improvement of weight loss was observed when CpG was present during FI-RSV immunization (P < 0.05) (Fig. 5), while L685,458 used alone as an adjuvant of FI-RSV had little impact on weight loss compared with unadjuvanted FI-RSV. Interestingly, mice immunized with FI-RSV+CpG+L685,458 did not exhibit weight loss compared with control mice or FI-RSV immunized mice (P > 0.05) (Fig. 5). This result suggests that CpG+L685,458, but not CpG or L685,458 alone, attenuated FI-RSV disease severity.

FIG 5.

FIG 5

Body weight loss of immunized mice following RSV challenge. Mice were immunized i.m. with PBS, FI-RSV, FI-RSV+CpG, FI-RSV+L685,458, or FI-RSV+CpG+L685,458 two times, challenged i.n. by RSV 28 days after the last immunization, and weighed daily from day 0 (0d) to day 5 postchallenge. Data are presented as means ± standard deviations of weight loss based on a comparison with the initial weights from five mice per group and are representative of two experiments. *, P < 0.05.

CpG+L685,458 completely inhibited Th17 but not Th1 or Th2 memory responses.

Immune memory is the conceptual basis for efficacious vaccines and is a hallmark of the adaptive immune system (29). RSV infection of mice previously immunized with vaccines will activate memory responses. We tested the levels of the Th1-, Th2-, and Th17-type cytokines gamma interferon (IFN-γ), IL-4, and IL-17 in BALF of immunized mice after RSV challenge by enzyme-linked immunosorbent assay (ELISA). The concentration of IL-17 in the FI-RSV+CpG+L685,458 group was significantly less than that in the FI-RSV group (P < 0.05) (Fig. 6A), and no difference was observed between the FI-RSV+CpG+L685,458 and PBS groups, suggesting a complete inhibition of the Th17 memory response. In contrast, the level of IFN-γ or IL-4 in the FI-RSV+CpG+L685,458 group was also reduced compared with that in the FI-RSV group, but the difference was not significant (P > 0.05) (Fig. 6B and C). We further tested the expression of IL-17, Th17-specific transcription factor ROR-γt, and cytokines IL-23, transforming growth factor β (TGF-β), and IL-6, required for differentiation and maintenance of Th17, by real-time PCR or ELISA. The expression level of IL-17, ROR-γt, IL-23, TGF-β, or IL-6 was significantly inhibited in FI-RSV+CpG+L685,458-immunized mice compared to the level in FI-RSV-immunized mice following RSV challenge (P < 0.05) (Fig. 6E to I). These results indicated that CpG+L685,458 completely inhibited lung Th17 memory responses but not Th1 and Th2 memory responses.

FIG 6.

FIG 6

CpG+L685,458 completely inhibited FI-RSV-associated Th17, but not Th1 or Th2, memory responses. Mice were immunized i.m. with PBS, FI-RSV, or FI-RSV+CpG+L685,458 two times and challenged i.n. by RSV 28 days after the last immunization. (A to C) The concentrations of IL-17, IFN-γ, and IL-4 in BALF determined by ELISA. (D to H) The expression levels of IL-17, ROR-γt, IL-23, and TGF-β determined by real-time PCR and of IL-6 determined by ELISA. Data are presented as means ± standard deviations from duplicate wells of five mice per group and are representative of two experiments. *, P < 0.05.

CpG+L685,458 inhibited Th17-associated proinflammatory chemokine responses following RSV challenge.

Th17 cells secrete IL-17 and other proinflammatory cytokines to induce the expression of a variety of chemokines, which recruit lymphocytes, monocytes, neutrophils, eosinophils, and other inflammatory cells (30). Since CpG+L685,458 inhibited Th17 memory responses, the Th17-associated chemokines should be suppressed. As shown in Fig. 7, the levels of the chemokines RANTES, growth-regulated oncogene alpha (GRO-α), eotaxin, and monocyte chemoattractant protein 1 (MCP-1) in mice immunized with FI-RSV+CpG+L685,458 were all significantly reduced compared with those in mice immunized with FI-RSV alone (P < 0.05). These results suggest that Th17-associated inflammatory responses following RSV challenge were inhibited when mice were immunized with FI-RSV+CpG+L685,458.

FIG 7.

FIG 7

CpG+L685,458 inhibited Th17-associated chemokine expression in lungs following RSV challenge. Mice were immunized i.m. with PBS, FI-RSV, or FI-RSV+CpG+L685,458 two times and challenged i.n. by RSV 28 days after the last immunization. Data are presented the mean expression levels (± standard deviations) of the chemokines RANTES, GRO-α, eotaxin, and MCP-1 determined by real-time PCR and are representative of two experiments. *, P < 0.05.

CpG+L685,458 inhibited FI-RSV-specific Th17-producing memory cells.

Since CpG+L685,458 inhibited the Th17 memory response following RSV challenge, it is likely that CpG+L685,458 could inhibit the production of Th17-producing memory cells induced by the vaccine. Enzyme-linked immunosorbent spot (ELISPOT) assay data showed that both FI-RSV and FI-RSV+CpG+L685,458 induced markedly more FI-RSV-specific Th17-producing memory cells than PBS, and the number of Th17-producing memory cells in the FI-RSV+CpG+L685,458 group was significantly less than that in the FI-RSV group (P < 0.05) (Fig. 8). This result indicated that CpG+L685,458 inhibited Th17-producing memory cells induced by FI-RSV.

FIG 8.

FIG 8

CpG+L685,458 inhibited FI-RSV-specific Th17-producing memory cells. Mice were immunized i.m. with PBS, FI-RSV, or FI-RSV+CpG+L685,458 two times and sacrificed 28 days after the last immunization. Th17-producing memory cells in spleens were detected with a standard ELISPOT assay. Data are presented as means ± standard deviations of the memory cell number (per 106 cells) from five mice per group and are representative of two experiments. *, P < 0.05.

CpG+L685,458 promoted FI-RSV-induced CD8+ lung TRM cells.

Recently, a new subset of memory T cells, TRM cells, was defined; these cells permanently reside in peripheral tissues, independent of effector memory T (TEM) and central memory T (TCM) cells in lymphoid tissue or circulation. In this study, an in vivo antibody labeling approach (31) was used to differentiate cells in circulation and in lung tissues. T cells accessible to circulation become labeled with antibody administered intravenously (labeled subset), and those residing within lung tissues are protected from antibody labeling (protected subset). In the lungs of the PBS-treated group, only a small fraction (<20%) of T cells were protected from labeling, while >80% of T cells were labeled (Fig. 9A). In contrast, in the lungs of mice immunized with FI-RSV or FI-RSV+CpG+L685,458, more than 60% of T cells were protected from labeling (Fig. 9A). The data indicated that significantly increased levels of T cells in mice immunized with FI-RSV or FI-RSV+CpG+L685,458 resided within lung tissues. CD69 is one of the cardinal TRM cell markers. The proportion of CD69+ protected T cells was increased dramatically in the lungs of mice immunized with FI-RSV or FI-RSV+CpG+L685,458 compared with the level in control mice (P < 0.05) (Fig. 9B and C). Peripheral leukocytes in each group were only in vivo labeled, but no CD69+ cells were detected (Fig. 9D). These results indicated that FI-RSV or FI-RSV+CpG+L685,458 induced significant TRM cells in the lungs of immunized mice.

FIG 9.

FIG 9

FI-RSV induced TRM cells in lungs of mice. Mice were immunized i.m. with PBS, FI-RSV, or FI-RSV+CpG+L685,458 two times and sacrificed 28 days after the last immunization. Lung tissue-resident T cells were detected using an in vivo antibody labeling approach. (A) Mean numbers (± standard deviations) of lung-resident T cells (Protected) and circulatory T cells (Labeled). (B and C) CD69+ lung TRM cells. (D) Circulatory T cells in peripheral leukocytes. Results are representative of two experiments. *, P < 0.05.

We further tested the CD4+ and CD8+ TRM cells in lung tissues of immunized mice based on expression of CD69 and CD103. As shown in Fig. 10A to G, FI-RSV or FI-RSV+CpG+L685,458 immunization induced significant levels of CD4+ CD69+ CD103+ and CD8+ CD69+ CD103+ TRM cells compared to levels in PBS-treated mice (P < 0.05), and the number of CD8+ CD69+ CD103+ TRM cells in FI-RSV+CpG+L685,458-immunized mice was more than that in FI-RSV-immunized mice (P < 0.05). In addition, the number of CD4+ CD69+ CD103+ TRM cells in FI-RSV+CpG+L685,458-immunized mice was also more than that in FI-RSV-immunized mice, but the difference did not reach statistical significance (P > 0.05). Evidence suggests that TRM cells have the ability to respond immediately to reexposure to cognate antigen and provide an effective in situ first line of defense to tissue-specific infections (32). Since the target of cellular immunity is the virus-infected cells, we quantified the relative expression of RSV N protein (RSV-N) in lungs rather than the amount of virus released into BALF. The mice immunized with FI-RSV or FI-RSV+CpG+L685,458 exhibited reduced expression of RSV-N in the lungs compared with the level in PBS-treated mice following RSV challenge (P < 0.05) (Fig. 10H). The level of RSV-N in the FI-RSV+CpG+L685,458 group was significantly less than that in the FI-RSV group (P < 0.05) (Fig. 10H). We also tested neutralizing antibody, which neutralizes virus released into BALF and is important for protection against RSV infection. The data in Fig. 10I shows that both FI-RSV+CpG+L685,458 and FI-RSV induced significant neutralizing antibodies compared to the level with the PBS control (P < 0.05). However, no difference between the FI-RSV+CpG+L685,458 and the FI-RSV groups was observed (P > 0.05). These results suggest that FI-RSV+CpG+L685,458 immunization promoted the development of TRM cells, which may provide effective protection against RSV challenge.

FIG 10.

FIG 10

CpG+L685,458 promoted FI-RSV-induced CD8+ TRM cells. Mice were immunized i.m. with PBS, FI-RSV, or FI-RSV+CpG+L685,458 two times and sacrificed 28 days after the last immunization for immune memory study. Mice were challenged i.n. by RSV 28 days after the last immunization and sacrificed 5 days later for protection study. (A to F) CD69+ CD103+ TRM cells gated on CD4+ or CD8+ T cells, as indicated, in the PBS group (A and B), the FI-RSV group (C and D), and the FI-RSV+CpG+L685,458 group (E and F) were quantified by flow cytometry. (G) Mean numbers (± standard deviations) of CD69+ CD103+ TRM cells gated on CD4+ or CD8+ T cells. (H) RSV replication in lung tissues. (I) Serum neutralizing antibody titers against RSV obtained in a neutralization assay. Results are representative of two experiments. *, P < 0.05.

DISCUSSION

Sophisticated adjuvants may have the potential to prevent FI-RSV ERD, enabling the development of safe and efficacious killed-RSV vaccines. In this study, the ligand of TLR9, CpG, in combination with an inhibitor of Notch signaling, L685,458, suppressed FI-RSV ERD, while activation or inhibition of TLR or Notch signaling alone failed to alleviate airway and lung inflammation. Interestingly, FI-RSV+CpG+L685,458 completely inhibited Th17 memory responses and associated proinflammatory chemokines following RSV challenge and promoted production of CD8+ CD69+ CD103+ lung TRM cells, which could be the important mechanism by which FI-RSV+CpG+L685,458 prevented ERD.

It is known that alum primes Th2-type immune responses and that alum-adjuvanted FI-RSV induces a Th2-bias response (11), which may be one of the reasons for the ERD caused by RSV. In this study, the levels of the Th2 response and lung inflammation were less in mice immunized with FI-RSV than in mice immunized with FI-RSV+Al(OH)3 (Fig. 1). So, removing alum adjuvant from the formulation of RSV vaccine could be the first step to prevent ERD. CpG promotes strong proinflammatory and Th1-biased responses (33). However, we found that CpG administered during the immunization with unadjuvanted FI-RSV did not reduce ERD following RSV challenge (Fig. 2 and 5), which could result from excessive proinflammatory and Th1 responses (33). Similar to our result, another study found that mice immunized with a combination of CpG and F protein of RSV that induced a strong Th1 response developed pulmonary pathology consisting of alveolitis and interstitial pneumonitis after RSV challenge (34). Several adjuvant compounds incorporating CpG have been shown to improve balanced protective responses to RSV fusion protein vaccines (35, 36).

Notch activation is responsible for the differentiation of naive CD4+ Th cells into distinct lineages, including Th1, Th2, Th17, or Treg cells, but depends upon additional signals (19, 37, 38). Dll4-induced Notch signaling inhibits the Treg development and enhances the generation of IL-17-producing cells (39, 40), which may result in excessive inflammatory responses (30, 41). Consistent with these studies, we demonstrated that Dll4 promoted neutrophil recruitment and mucus production in the lungs of FI-RSV-immunized mice following RSV challenge (Fig. 3). Many studies have shown that blockade of Notch signaling results in reduced Th1, Th2, and/or Th17 responses and suppresses progression of some associated diseases (19, 42, 43). However, it was reported that C57BL/6 mice deficient for both Notch 1 and Notch 2 were susceptible to infection with Leishmania major despite their resistant genetic background. The susceptibility of these mice correlates with reduced IFN-γ secretion (44). In this study, blocking Notch signaling by L685,458 alone reduced the number of lymphocyte cells in BALF but aggravated lung inflammatory cell infiltration following RSV challenge (Fig. 3), which may be related to suppressed Th cell responses and increased susceptibility to RSV infection.

Recently, the Notch and TLR pathways were found to act cooperatively to activate Notch target genes and to increase the production of the TLR-induced cytokines TNF-α, IL-6, and IL-12 in macrophages (24). Blocking Notch signaling decreased the production of the TLR-induced proinflammatory cytokines (24, 25). We compared the effect of the inhibitor of Notch signaling, L685,458, in combination with the TLR9 ligand CpG, TLR4 ligand lipopolysaccharide (LPS), TLR3 ligand poly(I·C), or TLR2 ligand Pam3Cys as an adjuvant compound of FI-RSV in C57BL/6 mice (data not shown) and found that CpG+L685,458 markedly inhibited the proinflammatory cytokines and chemokines in immunized mice following RSV challenge (Fig. 6 and 7). Interestingly, CpG+L685,458 inhibited RSV-enhanced AHR, peribronchiolar, perivascular, and interstitial pneumonitis, mucus production, lymphocyte and neutrophil infiltration, and weight loss, which are characteristic of ERD following RSV challenge.

Since immune memory is the basis of a vaccine (29), the immune memory response activated by RSV challenge in lungs of mice immunized with FI-RSV should contribute to ERD. We found that Th17-producing memory cells in spleens and a Th17 memory response in lungs were markedly inhibited in mice immunized with FI-RSV+CpG+L685,458 compared with those in mice immunized with FI-RSV alone. IL-17 plays a critical role in driving neutrophil influx into the airways (45). IL-17 mediates neutrophil recruitment to the lungs by stimulating the secretion of granulocyte colony-stimulating factor (G-CSF) and GRO-α chemokines from respiratory epithelium and enhances eosinophilic airway inflammation by upregulating the expression of eotaxin-1/eotaxin-2 (30, 41). Manni et al. found that overexpression of IL-17F increased goblet cell hyperplasia and mucin expression in mice (46). Blockade of Notch signaling significantly downregulates the production of Th17-associated cytokines (19). Targeted deletion of Notch2 in DC subsets decreases CD11b+ DCs in the spleen and intestines, which in turn decreases the number of Th17 cells in the intestine (26). In vitro restimulation of splenocytes revealed that cells from mice receiving Notch1 knockout macrophages produced significantly less IL-17 than the control mice, whereas IFN-γ production levels were similar in both groups. In this study, CpG+L685,458 inhibited the Th17 memory response, as well as Th17-associated proinflammatory chemokines, following RSV challenge, which may be part of the mechanism by which CpG+L685,458 inhibited FI-RSV ERD.

TRM cells reside in peripheral tissues that stand as barriers against pathogenic challenges and are crucial for mediating protection and immune homeostasis at these sites. Several studies have highlighted their role in defense against localized infections in peripheral tissues such as the lung, intestine, and skin (4749). A recent study shows that TRM cells artificially established by a herpes simplex virus (HSV) vaccine can provide protection against genital herpes infection superior to that of circulating memory T cells (50). We found that FI-RSV induced lung TRM cells and that CpG+L685,458 promoted production of CD8+ TRM cells. It is known that activated CD8+ T cells choose between terminal effector cell (TEC) or memory precursor cell (MPC) fates. Notch activated a major portion of the TEC-specific gene expression program and suppressed the MPC-specific program (51). It is likely that CpG+L685,458 activates the MPC-specific program to promote production of CD8+ TRM cells by inhibiting Notch signaling. Respiratory CD8+ CD103+ DCs were found to be requisite for CD8+ T activation and their potential to enter inflamed lung tissues, which is requisite for lung TRM cell development (52). In this study, the number of CD8+ CD103+ CD69 cells, which included CD8+ CD103+ DCs, markedly increased in the FI-RSV+CpG+L685,458 group compared with that in the FI-RSV group. The increased numbers of CD8+ CD103+ CD69 cells could contribute to the number of CD8+ TRM cells in the lungs. Although no study demonstrated that γ-secretase inhibitor-treated TRM cells directly contribute to reduced AHR and inflammation, Okamoto et al. reported that adoptive transfer of untreated CD8+ effector memory T cells restores AHR and airway inflammation in CD8-deficient mice, while adoptive transfer of γ-secretase inhibitor-treated CD8+ effector memory cells failed to restore AHR and airway inflammation in sensitized and challenged recipient CD8-deficient mice (53), suggesting a role for CpG+L685,458-treated memory cells in preventing AHR and inflammation. The increased CD8+ TRM cells in mice immunized with FI-RSV+CpG+L685,458 may also contribute to reduced transcription of the RSV-N gene and inflammation in lungs after challenge with RSV.

In summary, CpG combined with L685,458 inhibited FI-RSV ERD. Suppression of a Th17 memory response and promotion of TRM cells in lungs may be the important mechanism by which FI-RSV+CpG+L685,458 inhibited ERD. Moreover, the results suggested that using a combination of adjuvants containing more than one immune-stimulatory molecule may be a good strategy to prevent FI-RSV ERD.

MATERIALS AND METHODS

Virus and vaccines.

RSV-A (Long strain; ATCC) was propagated in HEp-2 cells and purified by a discontinuous sucrose gradient as previously described (54). RSV was stored at −70°C until use. FI-RSV or a formalin-inactivated mock preparation of HEp-2 cell supernatants (FI control, FI-C) was prepared as previously described (6). Briefly, the virus or mock preparation was inactivated by formalin (1:4,000) during 72 h of incubation at 37°C and then concentrated 25 times by ultracentrifugation. A further 4-fold concentration was achieved by alum precipitation. For unadjuvanted FI-RSV or FI-C, virus or a mock preparation inactivated by formalin (1:4,000) was concentrated 100 times by ultracentrifugation. The vaccines were stored at 4°C until used in this study.

Mice and immunization.

Female C57BL/6 mice, aged 6 to 8 weeks, were purchased from Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China). MyD88−/− mice were purchased from the Model Animal Research center of Nanjing University. These mice were housed and manipulated according to the Care and Use of Laboratory Animals (China) and kept under specific-pathogen-free conditions. They were confirmed seronegative to RSV before inclusion in the studies. We performed immunizations intramuscularly (i.m.) with 100 μl containing 50 μl of FI-RSV, FI-RSV+Al(OH)3 or FI-C and 50 μl of PBS, CpG (CpG2216; 20 μg), Dll4 (5 μg), or/and L685,458 (0.01μmol). Mice were immunized two times with an interval of 28 days and sacrificed 28 days after the last immunization for immune memory studies. Mice were challenged by intranasal (i.n.) instillation of 50 μl of 7.2 ×107 PFU/ml RSV 28 days after the last immunization. Mice were weighed daily from day 0 to 5 postchallenge and sacrificed 5 days later for protection and immune pathology studies.

Histology.

The lungs were isolated and immediately fixed in 4% paraformaldehyde, subsequently processed, embedded in paraffin, thin sectioned, and placed on l-lysine-coated slides. Sections were stained with hematoxylin and eosin (H&E) or periodic acid-Schiff (PAS). Sections from each mouse were scored blindly for the degree of inflammation in the peribronchial and perivascular spaces and in the alveolar tissue as previously described (55). The degree of mucus in the airway was graded as follow: 0, normal, no mucus; 1, slight mucus; 2, moderate mucus; 3, abundant mucus. Mean scores were calculated for each mouse.

BALF leukocyte differential counts.

Bronchoalveolar lavage fluid (BALF) specimens were collected and centrifuged as previously described (56). Briefly, after dissection to expose the trachea and lungs, the lungs were inflated transbronchially with sterile PBS containing 0.25% bovine serum albumin (BSA). BALF was collected by performing two consecutive washes of the airspace of the lungs of individual experimental mice with 1 ml of PBS. The BALF collected was centrifuged. The cellular pellets were resuspended in PBS. Total leukocytes and differential-type leukocytes were determined using a standard light microscope. The percentages of inflammatory cells were obtained by counting 400 leukocytes.

Assessment of AHR to MCh.

Airway hyperresponsiveness (AHR) was assessed as previously described by measuring changes in lung resistance (RL) and dynamic compliance (Cdyn) in response to increasing doses of inhaled methacholine (MCh) (57). The data of RL and Cdyn were continuously collected. Data are expressed as percent change from baseline RL and Cdyn values.

In vivo antibody labeling and flow cytometric assay.

For in vivo antibody labeling, mice were injected intravenously with 2.5 μg of the fluorochrome-conjugated antibody anti-CD3-fluorescein isothiocyanate (FITC). After 10 min, mice were exsanguinated, and peripheral leukocytes were obtained by lysing erythrocytes; lungs were rinsed free of blood, and cells were isolated. Peripheral leukocytes were stained in vitro with anti-CD69-phycoerythrin (PE), and lung cells were stained in vitro with anti-CD69-PE and anti-CD3-peridinin chlorophyll protein (PerCP)-Vio700. Stained cells were analyzed using flow cytometry (BD), and fluorescence-activated cell sorting (FACS) data were analyzed using CellQuest software. For lung tissue-resident CD4+/CD8+ CD69+ CD103+ memory T cell analysis, mice were exsanguinated, lungs were rinsed free of blood, and cells were isolated. Isolated lymphocytes were then stained in vitro with anti-CD4-FITC or anti-CD8-FITC, anti-CD69-PECy5, and anti-CD103-PE. Stained cells were analyzed using flow cytometry (BD), and FACS data were analyzed using CellQuest software.

Real-time RT-PCR.

RNA was isolated from the lungs using TRIzol (Invitrogen, Carlsbad, CA). Moloney murine leukemia virus (M-MLV) and oligo(dT) (MBI Fermentas) were used for synthesis of the first strand of cDNA. The RSV N gene was analyzed by real-time quantitative reverse transcription-PCR (RT-PCR) with SYBR green using the following primers: sense primer, 5′-GCG ATG TCT AGG TTA GGA AGA A-3′; antisense primer, 5′-GCT ATG TCC TTG GGT AGT AAG CCT-3′. The levels of some cytokines, chemokines, and the mucus-associated gene gob5 in lung were assessed by real-time PCR using the primers listed in Table 1. The mouse housekeeping gene (β-actin) was used as a control gene.

TABLE 1.

Primer sequences for mRNA analysis by real-time PCR

Target gene Direction Sequence
GATA3 Forward AGAACCGGCCCCTTATCAA
Reverse AGTTCGCGCAGGATGTCC
IL-5 Forward CCCATGAGCACAGTGGTGAA
Reverse CTCATCGTCTCATTGCTTGTCAA
gob5 Forward GAGTGGGCTCACTTCCGATG
Reverse GCTGAACACCTCACTGCTTGG
IL-17 Forward AAGCTCAGCGTGTCCAAACA
Reverse TGCGCCAAGGGAGTTAAAGA
ROR-γt Forward CCCCCTGCCCAGAAACACT
Reverse GGATGCCCCCATTCACTTACTTCT
IL-23p19 Forward AATAATGTGCCCCGTATCCA
Reverse CTGGAGGAGTTGGCTGAGTC
TGF-β Forward TGACGTCACTGGAGTTGTACGG
Reverse GGTTCATGTCATGGATGGTGC
RANTES Forward GCACAGCAAACCCAAGAAAT
Reverse ACTTGTGGGCAAGAGGGTTT
GRO-α Forward CATGTAGAAAGCCCATCTGGA
Reverse CTGCAATCAGAAAAGAGTCATTG
Eotaxin Forward GACCTGTAACTCACTGTGTAGACCA
Reverse ATTCTGGCTTGGCATGGTAG
MCP-1 Reverse GCTGACCCCAAGAAGGAATG
Reverse GAAGACCTTAGGGCAGATGCA
β-Actin Forward GAAGTCCCTCACCCTCCCAA
Reverse GGCATGGACGCGACCA

ELISA.

Cytokines IL-4, IL-17, IFN-γ, and IL-6 in BALF were measured with enzyme-linked immunosorbent assay (ELISA) kits (RayBiotech).

ELISPOT assay.

IL-17-secreting cells were quantified using an enzyme-linked immunosorbent spot (ELISPOT) assay kit (eBioscience) according to the manufacturer's instructions. Briefly, 96-well filtration plates were coated with anti-IL-17 capture antibody. Splenocytes (1 × 106 cells/well) were cocultured with FI-RSV for 36 to 48 h at 37°C in triplicate wells. After cells were removed, plates were incubated with biotinylated anti-IL-17 detection antibodies for 2 h, streptavidin-horseradish peroxidase for 60 min, and then fresh substrate solution. Spots were then counted using an immunospot image analyzer.

Neutralization assays.

Serum neutralizing antibody was detected as previously described (58). Neutralization titers were expressed as the reciprocal of the highest dilution that reduced positive-control syncytium numbers by at least 60%.

Statistical analysis.

Experiments using more than two groups with normal Gaussian distribution of the data were analyzed using an analysis of variance (ANOVA). Data that did not have normal Gaussian distributions were analyzed using a Kruskal-Wallis test. Experiments using two groups were analyzed using an unpaired t test or a Mann-Whitney U test in which Gaussian distribution was not observed. A P value of <0.05 was defined as a statistically significant difference.

ACKNOWLEDGMENTS

This work was supported by grants from the National Natural Science Foundation of China (81671635 and 31240084) and the Natural Science Foundation of Hebei Province (H2016206473).

REFERENCES

  • 1.Centers for Disease Control and Prevention. 2010. Respiratory syncytial virus activity—United States, July 2008–December 2009. MMWR Morb Mortal Wkly Rep 59:230–233. [PubMed] [Google Scholar]
  • 2.Fleming DM, Pannell RS, Cross KW. 2005. Mortality in children from influenza and respiratory syncytial virus. J Epidemiol Community Health 59:586–590. doi: 10.1136/jech.2004.026450. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Higgins D, Trujillo C, Keech C. 2016. Advances in RSV vaccine research and development—a global agenda. Vaccine 34:2870–2875. doi: 10.1016/j.vaccine.2016.03.109. [DOI] [PubMed] [Google Scholar]
  • 4.Kim HW, Canchola JG, Brandt CD, Pyles G, Chanock RM, Jensen K, Parrott RH. 1969. Respiratory syncytial virus disease in infants despite prior administration of antigenic inactivated vaccine. Am J Epidemiol 89:422–434. doi: 10.1093/oxfordjournals.aje.a120955. [DOI] [PubMed] [Google Scholar]
  • 5.Blanco JC, Boukhvalova MS, Shirey KA, Prince GA, Vogel SN. 2010. New insights for development of a safe and protective RSV vaccine. Hum Vaccin 6:482–492. doi: 10.4161/hv.6.6.11562. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Prince GA, Curtis SJ, Yim KC, Porter DD. 2001. Vaccine-enhanced respiratory syncytial virus disease in cotton rats following immunization with Lot 100 or a newly prepared reference vaccine. J Gen Virol 82:2881–2888. doi: 10.1099/0022-1317-82-12-2881. [DOI] [PubMed] [Google Scholar]
  • 7.Graham BS, Henderson GS, Tang YW, Lu X, Neuzil KM, Colley DG. 1993. Priming immunization determines T helper cytokine mRNA expression patterns in lungs of mice challenged with respiratory syncytial virus. J Immunol 151:2032–2040. [PubMed] [Google Scholar]
  • 8.Schnoeller C, Roux X, Sawant D, Raze D, Olszewska W, Locht C, Openshaw PJ. 2014. Attenuated Bordetella pertussis vaccine protects against respiratory syncytial virus disease via an IL-17-dependent mechanism. Am J Respir Crit Care Med 189:194–202. doi: 10.1164/rccm.201307-1227OC. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Zeng R, Zhang H, Hai Y, Cui Y, Wei L, Li N, Liu J, Li C, Liu Y. 2012. Interleukin-27 inhibits vaccine-enhanced pulmonary disease following respiratory syncytial virus infection by regulating cellular memory responses. J Virol 86:4505–4517. doi: 10.1128/JVI.07091-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.HogenEsch H. 2002. Mechanisms of stimulation of the immune response by aluminum adjuvants. Vaccine 20(Suppl 3):S34–S39. doi: 10.1016/S0264-410X(02)00169-X. [DOI] [PubMed] [Google Scholar]
  • 11.Chin J, Magoffin RL, Shearer LA, Schieble JH, Lennette EH. 1969. Field evaluation of a respiratory syncytial virus vaccine and a trivalent parainfluenza virus vaccine in a pediatric population. Am J Epidemiol 89:449–463. doi: 10.1093/oxfordjournals.aje.a120957. [DOI] [PubMed] [Google Scholar]
  • 12.Kawai T, Akira S. 2009. The roles of TLRs, RLRs and NLRs in pathogen recognition. Int Immunol 21:317–337. doi: 10.1093/intimm/dxp017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Banchereau J, Briere F, Caux C, Davoust J, Lebecque S, Liu YJ, Pulendran B, Palucka K. 2000. Immunobiology of dendritic cells. Annu Rev Immunol 18:767–811. doi: 10.1146/annurev.immunol.18.1.767. [DOI] [PubMed] [Google Scholar]
  • 14.Liu G, Zhao Y. 2007. Toll-like receptors and immune regulation: their direct and indirect modulation on regulatory CD4+ CD25+ T cells. Immunology 122:149–156. doi: 10.1111/j.1365-2567.2007.02651.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Gelman AE, Zhang J, Choi Y, Turka LA. 2004. Toll-like receptor ligands directly promote activated CD4+ T cell survival. J Immunol 172:6065–6073. doi: 10.4049/jimmunol.172.10.6065. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Caron G, Duluc D, Fremaux I, Jeannin P, David C, Gascan H, Delneste Y. 2005. Direct stimulation of human T cells via TLR5 and TLR7/8: flagellin and R-848 up-regulate proliferation and IFN-gamma production by memory CD4+ T cells. J Immunol 175:1551–1557. doi: 10.4049/jimmunol.175.3.1551. [DOI] [PubMed] [Google Scholar]
  • 17.Boukhvalova MS, Prince GA, Soroush L, Harrigan DC, Vogel SN, Blanco JC. 2006. The TLR4 agonist, monophosphoryl lipid A, attenuates the cytokine storm associated with respiratory syncytial virus vaccine-enhanced disease. Vaccine 24:5027–5035. doi: 10.1016/j.vaccine.2006.03.064. [DOI] [PubMed] [Google Scholar]
  • 18.Delgado MF, Coviello S, Monsalvo AC, Melendi GA, Hernandez JZ, Batalle JP, Diaz L, Trento A, Chang HY, Mitzner W, Ravetch J, Melero JA, Irusta PM, Polack FP. 2009. Lack of antibody affinity maturation due to poor Toll-like receptor stimulation leads to enhanced respiratory syncytial virus disease. Nat Med 15:34–41. doi: 10.1038/nm.1894. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Keerthivasan S, Suleiman R, Lawlor R, Roderick J, Bates T, Minter L, Anguita J, Juncadella I, Nickoloff BJ, Le Poole IC, Miele L, Osborne BA. 2011. Notch signaling regulates mouse and human Th17 differentiation. J Immunol 187:692–701. doi: 10.4049/jimmunol.1003658. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Fang TC, Yashiro-Ohtani Y, Del Bianco C, Knoblock DM, Blacklow SC, Pear WS. 2007. Notch directly regulates Gata3 expression during T helper 2 cell differentiation. Immunity 27:100–110. doi: 10.1016/j.immuni.2007.04.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Amsen D, Antov A, Flavell RA. 2009. The different faces of Notch in T-helper-cell differentiation. Nat Rev Immunol 9:116–124. doi: 10.1038/nri2488. [DOI] [PubMed] [Google Scholar]
  • 22.Palaga T, Buranaruk C, Rengpipat S, Fauq AH, Golde TE, Kaufmann SH, Osborne BA. 2008. Notch signaling is activated by TLR stimulation and regulates macrophage functions. Eur J Immunol 38:174–183. doi: 10.1002/eji.200636999. [DOI] [PubMed] [Google Scholar]
  • 23.Foldi J, Chung AY, Xu H, Zhu J, Outtz HH, Kitajewski J, Li Y, Hu X, Ivashkiv LB. 2010. Autoamplification of Notch signaling in macrophages by TLR-induced and RBP-J-dependent induction of Jagged1. J Immunol 185:5023–5031. doi: 10.4049/jimmunol.1001544. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Hu X, Chung AY, Wu I, Foldi J, Chen J, Ji JD, Tateya T, Kang YJ, Han J, Gessler M, Kageyama R, Ivashkiv LB. 2008. Integrated regulation of Toll-like receptor responses by Notch and interferon-gamma pathways. Immunity 29:691–703. doi: 10.1016/j.immuni.2008.08.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Tsao PN, Wei SC, Huang MT, Lee MC, Chou HC, Chen CY, Hsieh WS. 2011. Lipopolysaccharide-induced Notch signaling activation through JNK-dependent pathway regulates inflammatory response. J Biomed Sci 18:56. doi: 10.1186/1423-0127-18-56. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Lewis KL, Caton ML, Bogunovic M, Greter M, Grajkowska LT, Ng D, Klinakis A, Charo IF, Jung S, Gommerman JL, Ivanov II, Liu K, Merad M, Reizis B. 2011. Notch2 receptor signaling controls functional differentiation of dendritic cells in the spleen and intestine. Immunity 35:780–791. doi: 10.1016/j.immuni.2011.08.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Rudd BD, Schaller MA, Smit JJ, Kunkel SL, Neupane R, Kelley L, Berlin AA, Lukacs NW. 2007. MyD88-mediated instructive signals in dendritic cells regulate pulmonary immune responses during respiratory virus infection. J Immunol 178:5820–5827. doi: 10.4049/jimmunol.178.9.5820. [DOI] [PubMed] [Google Scholar]
  • 28.Kopan R, Ilagan MX. 2004. Gamma-secretase: proteasome of the membrane? Nat Rev Mol Cell Biol 5:499–504. doi: 10.1038/nrm1406. [DOI] [PubMed] [Google Scholar]
  • 29.Welsh RM, Selin LK, Szomolanyi-Tsuda E. 2004. Immunological memory to viral infections. Annu Rev Immunol 22:711–743. doi: 10.1146/annurev.immunol.22.012703.104527. [DOI] [PubMed] [Google Scholar]
  • 30.Nakajima H, Hirose K. 2010. Role of IL-23 and Th17 cells in airway inflammation in asthma. Immune Netw 10:1–4. doi: 10.4110/in.2010.10.1.1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Turner DL, Bickham KL, Thome JJ, Kim CY, D'Ovidio F, Wherry EJ, Farber DL. 2014. Lung niches for the generation and maintenance of tissue-resident memory T cells. Mucosal Immunol 7:501–510. doi: 10.1038/mi.2013.67. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Shin H, Iwasaki A. 2013. Tissue-resident memory T cells. Immunol Rev 255:165–181. doi: 10.1111/imr.12087. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Steinhagen F, Kinjo T, Bode C, Klinman DM. 2011. TLR-based immune adjuvants. Vaccine 29:3341–3355. doi: 10.1016/j.vaccine.2010.08.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Prince GA, Mond JJ, Porter DD, Yim KC, Lan SJ, Klinman DM. 2003. Immunoprotective activity and safety of a respiratory syncytial virus vaccine: mucosal delivery of fusion glycoprotein with a CpG oligodeoxynucleotide adjuvant. J Virol 77:13156–13160. doi: 10.1128/JVI.77.24.13156-13160.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Garlapati S, Garg R, Brownlie R, Latimer L, Simko E, Hancock RE, Babiuk LA, Gerdts V, Potter A, van Drunen Littel-van den Hurk S. 2012. Enhanced immune responses and protection by vaccination with respiratory syncytial virus fusion protein formulated with CpG oligodeoxynucleotide and innate defense regulator peptide in polyphosphazene microparticles. Vaccine 30:5206–5214. doi: 10.1016/j.vaccine.2012.06.011. [DOI] [PubMed] [Google Scholar]
  • 36.Garg R, Latimer L, Gerdts V, Potter A, van Drunen Littel-van den Hurk S. 2014. Vaccination with the RSV fusion protein formulated with a combination adjuvant induces long-lasting protective immunity. J Gen Virol 95:1043–1054. doi: 10.1099/vir.0.062570-0. [DOI] [PubMed] [Google Scholar]
  • 37.Rutz S, Mordmuller B, Sakano S, Scheffold A. 2005. Notch ligands Delta-like1, Delta-like4 and Jagged1 differentially regulate activation of peripheral T helper cells. Eur J Immunol 35:2443–2451. doi: 10.1002/eji.200526294. [DOI] [PubMed] [Google Scholar]
  • 38.Ostroukhova M, Qi Z, Oriss TB, Dixon-McCarthy B, Ray P, Ray A. 2006. Treg-mediated immunosuppression involves activation of the Notch-HES1 axis by membrane-bound TGF-beta. J Clin Invest 116:996–1004. doi: 10.1172/JCI26490. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Mukherjee S, Schaller MA, Neupane R, Kunkel SL, Lukacs NW. 2009. Regulation of T cell activation by Notch ligand, DLL4, promotes IL-17 production and Rorc activation. J Immunol 182:7381–7388. doi: 10.4049/jimmunol.0804322. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Billiard F, Lobry C, Darrasse-Jeze G, Waite J, Liu X, Mouquet H, DaNave A, Tait M, Idoyaga J, Leboeuf M, Kyratsous CA, Burton J, Kalter J, Klinakis A, Zhang W, Thurston G, Merad M, Steinman RM, Murphy AJ, Yancopoulos GD, Aifantis I, Skokos D. 2012. Dll4-Notch signaling in Flt3-independent dendritic cell development and autoimmunity in mice. J Exp Med 209:1011–1028. doi: 10.1084/jem.20111615. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.McAleer JP, Kolls JK. 2014. Directing traffic: IL-17 and IL-22 coordinate pulmonary immune defense. Immunol Rev 260:129–144. doi: 10.1111/imr.12183. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Elyaman W, Bradshaw EM, Wang Y, Oukka M, Kivisakk P, Chiba S, Yagita H, Khoury SJ. 2007. JAGGED1 and delta1 differentially regulate the outcome of experimental autoimmune encephalomyelitis. J Immunol 179:5990–5998. doi: 10.4049/jimmunol.179.9.5990. [DOI] [PubMed] [Google Scholar]
  • 43.Amsen D, Antov A, Jankovic D, Sher A, Radtke F, Souabni A, Busslinger M, McCright B, Gridley T, Flavell RA. 2007. Direct regulation of Gata3 expression determines the T helper differentiation potential of Notch. Immunity 27:89–99. doi: 10.1016/j.immuni.2007.05.021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Auderset F, Schuster S, Coutaz M, Koch U, Desgranges F, Merck E, MacDonald HR, Radtke F, Tacchini-Cottier F. 2012. Redundant Notch1 and Notch2 signaling is necessary for IFNγ secretion by T helper 1 cells during infection with Leishmania major. PLoS Pathog 8:e1002560. doi: 10.1371/journal.ppat.1002560. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Bullens DM, Truyen E, Coteur L, Dilissen E, Hellings PW, Dupont LJ, Ceuppens JL. 2006. IL-17 mRNA in sputum of asthmatic patients: linking T cell driven inflammation and granulocytic influx? Respir Res 7:135. doi: 10.1186/1465-9921-7-135. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Manni ML, Robinson KM, Alcorn JF. 2014. A tale of two cytokines: IL-17 and IL-22 in asthma and infection. Expert Rev Respir Med 8:25–42. doi: 10.1586/17476348.2014.854167. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Sheridan BS, Pham QM, Lee YT, Cauley LS, Puddington L, Lefrancois L. 2014. Oral infection drives a distinct population of intestinal resident memory CD8+ T cells with enhanced protective function. Immunity 40:747–757. doi: 10.1016/j.immuni.2014.03.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Teijaro JR, Turner D, Pham Q, Wherry EJ, Lefrancois L, Farber DL. 2011. Cutting edge: tissue-retentive lung memory CD4 T cells mediate optimal protection to respiratory virus infection. J Immunol 187:5510–5514. doi: 10.4049/jimmunol.1102243. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Schluns KS, Klonowski KD. 2015. Protecting the borders: tissue-resident memory T cells on the front line. Front Immunol 6:90. doi: 10.3389/fimmu.2015.00090. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Shin H, Iwasaki A. 2012. A vaccine strategy that protects against genital herpes by establishing local memory T cells. Nature 491:463–467. doi: 10.1038/nature11522. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Backer RA, Helbig C, Gentek R, Kent A, Laidlaw BJ, Dominguez CX, de Souza YS, van Trierum SE, van Beek R, Rimmelzwaan GF, ten Brinke A, Willemsen AM, van Kampen AH, Kaech SM, Blander JM, van Gisbergen K, Amsen D. 2014. A central role for Notch in effector CD8+ T cell differentiation. Nat Immunol 15:1143–1151. doi: 10.1038/ni.3027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Shane HL, Klonowski KD. 2014. Every breath you take: the impact of environment on resident memory CD8 T cells in the lung. Front Immunol 5:320. doi: 10.3389/fimmu.2014.00320. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Okamoto M, Takeda K, Joetham A, Ohnishi H, Matsuda H, Swasey CH, Swanson BJ, Yasutomo K, Dakhama A, Gelfand EW. 2008. Essential role of Notch signaling in effector memory CD8+ T cell-mediated airway hyperresponsiveness and inflammation. J Exp Med 205:1087–1097. doi: 10.1084/jem.20072200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Aljabr W, Touzelet O, Pollakis G, Wu W, Munday DC, Hughes M, Hertz-Fowler C, Kenny J, Fearns R, Barr JN, Matthews DA, Hiscox JA. 2016. Investigating the influence of ribavirin on human respiratory syncytial virus RNA synthesis by using a high-resolution transcriptome sequencing approach. J Virol 90:4876–4888. doi: 10.1128/JVI.02349-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Mok H, Lee S, Utley TJ, Shepherd BE, Polosukhin VV, Collier ML, Davis NL, Johnston RE, Crowe JE Jr. 2007. Venezuelan equine encephalitis virus replicon particles encoding respiratory syncytial virus surface glycoproteins induce protective mucosal responses in mice and cotton rats. J Virol 81:13710–13722. doi: 10.1128/JVI.01351-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.McNamara PS, Ritson P, Selby A, Hart CA, Smyth RL. 2003. Bronchoalveolar lavage cellularity in infants with severe respiratory syncytial virus bronchiolitis. Arch Dis Child 88:922–926. doi: 10.1136/adc.88.10.922. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Takeda K, Hamelmann E, Joetham A, Shultz LD, Larsen GL, Irvin CG, Gelfand EW. 1997. Development of eosinophilic airway inflammation and airway hyperresponsiveness in mast cell-deficient mice. J Exp Med 186:449–454. doi: 10.1084/jem.186.3.449. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Zeng R, Zhang Z, Mei X, Gong W, Wei L. 2008. Protective effect of a RSV subunit vaccine candidate G1F/M2 was enhanced by a HSP70-Like protein in mice. Biochem Biophys Res Commun 377:495–499. doi: 10.1016/j.bbrc.2008.10.002. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES