Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2018 Mar 1.
Published in final edited form as: Epilepsia. 2017 Jan 18;58(3):494–504. doi: 10.1111/epi.13660

Neurosteroid-sensitive δ-GABA-A receptors: a role in epileptogenesis?

Suchitra Joshi 1, Karthik Rajasekaran 1, John Williamson 1, Jaideep Kapur 1,2
PMCID: PMC5412084  NIHMSID: NIHMS837879  PMID: 28452419

Abstract

Objective

We determined the role of the neurosteroid-sensitive δ subunit-containing γ aminobutyric acid type-A receptors (δ-GABAR) in epileptogenesis.

Methods

Status epilepticus (SE) was induced via lithium pilocarpine in adult rats, and seizures were assessed by continuous video-EEG monitoring. Finasteride was administered to inhibit neurosteroid synthesis. The total and surface protein expression of hippocampal δ, α4, and γ2 GABAR subunits was studied using biotinylation assays and Western blotting. Neurosteroid potentiation of the tonic currents of DGCs was measured by whole-cell patch-clamp technique. Lastly, the effects of inhibiting NMDARs during SE on the long-term plasticity of δ-GABARs, neurosteroid-induced modulation of tonic current, and epileptogenesis were studied.

Results

The inhibition of neurosteroid synthesis 4 days after SE triggered acute seizures and accelerated the onset of chronic recurrent spontaneous seizures (epilepsy). The down-regulation of neurosteroid-sensitive δ-GABARs occurred prior to the onset of epilepsy, whereas an increased expression of the γ2 GABAR subunits occurred after seizure onset. MK801 blockade of NMDARs during SE preserved the expression of neurosteroid-sensitive δ-GABARs. NMDAR blockade during SE also prevented the onset of spontaneous seizures.

Significance

Changes in neurosteroid-sensitive δ-GABAR expression correlated temporally with epileptogenesis. These findings raise the possibility that δ-GABAR plasticity may play a role in epileptogenesis.

Keywords: δ subunit-containing GABARs, tonic current, epileptogenesis, neurosteroids, MK-801

Introduction

Acquired epilepsy often results from brain insults such as febrile seizures, status epilepticus (SE), brain tumors, infection, or head trauma. The initial brain insult is followed by a latent period of variable length before the appearance of spontaneous seizures. Changes that occur during this period due to neuronal plasticity underlie epileptogenesis, the process that transforms a normal brain into one that can initiate and sustain seizures. A recent study found that impaired neurosteroidogenesis is associated with protocadherin 19 (PCDH19) female-limited epilepsy1, suggesting that endogenous neurosteroids may play a role in epileptogenesis. Another study in experimental animals found accelerated epileptogenesis when endogenous neurosteroid synthesis was blocked by daily treatment with finasteride2. These studies did not elucidate the mechanism of neurosteroid modulation involved in epileptogenesis.

Temporal lobe epilepsy (TLE) is a common form of acquired epilepsy that primarily affects the hippocampus. Reduced GABAR-mediated inhibition of hippocampal dentate granule cells (DGCs) is thought to play an important role in epileptogenesis. A prominent alteration in GABARs is the down-regulation of δ subunit-containing GABAR expression3–5. A prior study found reduced δ subunit expression before the onset of epilepsy3; however, the functional significance of the early down-regulation of δ-GABAR expression was not assessed. δ-GABARs are a preferred target of neurosteroids, which are the endogenous ligands of GABARs, at physiological concentrations6. Neurosteroids, synthesized from cholesterol or derived from circulating steroid hormones in the brain, exert anticonvulsant effects to regulate seizure frequency in epileptic animals and play a central role in catamenial seizure exacerbation6;7. δ-GABARs are localized to the peri- and extra-synaptic membrane of DGCs and mediate a steady background current called tonic inhibition, which regulates network excitability6. Multiple studies have shown a strong correlation between neurosteroid levels, δ-GABAR expression, and seizure susceptibility8–10.

We determined the time course of the changes in neurosteroid modulation of δ-GABAR during epileptogenesis. These receptors are down-regulated a few days after SE; the seizure activity began one or more weeks following SE. Blocking endogenous neurosteroid synthesis accelerated the onset of seizures, whereas NMDAR antagonist treatment during SE prevented δ-GABAR down-regulation and suppressed epileptogenesis.

Materials and methods

The animals were handled according to guidelines set by the University of Virginia, Animal Care and Use Committee, and efforts were made to minimize animal stress and discomfort. All the drugs were administered intraperitoneally.

Study design

The time course of diminished neurosteroid sensitivity of tonic inhibition of dentate granule cells and GABAR δ down-regulation was compared to that of α4 and γ2 subunits and to the onset of recurrent spontaneous seizures. Neurosteroid synthesis was inhibited during the early latent period, and the onset of epilepsy was determined. Finally, we studied the impact of NMDA receptor antagonists administered during the established phase of status epilepticus on δ-GABAR expression and epileptogenesis.

EEG recording

The implantation of bipolar hippocampal and cortical electrodes and video-EEG recordings were performed as described previously11.

Induction of SE and TLE

Adult female and male Sprague-Dawley rats (200 to 250 g) obtained from Taconic were used in these studies. SE was induced in using the lithium-pilocarpine method11. Only animals that experienced prolonged (6 to 7 hrs.) electrographic SE, characterized by rhythmic spike-wave discharges with a frequency greater than 2 Hz and an amplitude that was three times the background amplitude, were included in the study. The end of SE was characterized by arrhythmic spike-wave discharges < 3 Hz without the subsequent return of seizures. The animals were considered epileptic after the second spontaneous electrographic seizure.

Finasteride treatment

Animals used in these studies were treated with diazepam (10 mg/kg) 2 hrs. after the start of continuous electrographic seizures. Diazepam suppressed behavioral seizures, but, electrographic seizures continued in all the animals; the average duration of SE was 478 ± 36 min (n=16). The animals were continuously monitored (24/7) by recording video-EEG during SE and for the subsequent 20 days. Finasteride (100 mg/kg) or vehicle (30% cyclodextrin) were administered on the 4th day following SE.

NMDAR antagonist treatment

Continuous seizure activity evolved 21 ± 2 min (n=8) after pilocarpine administration; this also corresponded to the first tonic-clonic seizure as determined based on the Racine scale12. Animals were treated with MK-801 (2 mg/kg) or saline 10 min after the onset of continuous electrographic seizure activity.

The animals used in the biochemical and electrophysiological studies were visually monitored for behavioral seizures following pilocarpine administration. The drugs were administered 10 min after the first behavioral stage-5 seizure was observed.

Brain slicing and electrophysiology

To determine the neurosteroid modulation of tonic currents, brain slicing and whole-cell patch-clamp recordings were performed as described previously4. Tonic currents were analyzed as described previously4.

Biotinylation assays and Western blotting

Surface proteins were biotinylated as described previously4. Tissue from 10 slices containing both the hippocampi was pooled from each animal to form a single replicate. In each experiment, the experimental and control animals were analyzed in parallel. The surface and total protein fractions were separated by SDS-PAGE. Expression of the δ, α4, and γ2 subunits was detected by Western blotting. The antibodies used were an anti-δ subunit antibody (1:1000; Millipore, Billerica, MA), anti-α4 subunit (1:500, Millipore), anti-γ2 subunit antibody (1:500)13, and anti-β-actin antibody (1:5000, Sigma-Aldrich Corporation).

Real-time PCR

Total RNA was isolated using Trizol reagent (Invitrogen), and the quality of the mRNA was confirmed using an Agilent Bioanalyzer. RNA was treated with RNase-free DNase (New England Biolabs), and 1 µg of RNA was converted to cDNA using an iScript cDNA synthesis kit according to the manufacturer’s instructions (BioRad). The PCR mix consisted of SYBR green dye (Bioline), 1 µM of each primer, and 1 µl of cDNA template. The PCR was carried out using a QiaABI Prism® 7900 HT Detection system (Applied Biosystems). The following primers were used: δ subunit (NM_017289), GCCATGTCCTGGGTCTCCTT and TAACCATGAGTGTGGTCATTGTCA; γ2 subunit (NM_183327), TTTGTGAGCAACCGGAAACC and TCATTTGGATCGTTGCTGATCT; α4 subunit (NM_080587), ACACTGCAGCCAGCTCCTTT and CAGGCACCCCTGTCGTATTAAC; and GAPDH (NM_017008), CATGGCCTTCCGTGTTCCTA and CTTCACCACCTTCTTGATGTCATC, which was used for normalization. All primers spanned an intron and amplified a 99-bp fragment. The PCR cycle consisted of denaturation for 10 min at 95°C followed by 40 cycles of 15 sec at 95°C and 1 min at 60°C. Each sample was run in triplicate. The change in the cycle threshold value (CT) in experimental animals relative to that in controls was determined (ΔΔCT method) 14.

Statistical analysis

The results are presented as the means ± SEM. The data were compared using student’s t-test, Wilcoxon signed-rank test, or one-way ANOVA followed by Dunnett’s multiple comparison post-hoc test. Differences in the time course of onset of epilepsy were compared using Kaplan-Meyer Survival estimation followed by log-rank (Mantel-Cox) test.

Results

Blockade of endogenous neurosteroid synthesis accelerated epileptogenesis

In a previous study, using video monitoring only, it was suggested that chronic blockade of neurosteroid synthesis accelerates epileptogenesis2. We tested whether a single day of inhibition of neurosteroid synthesis with finasteride would be sufficient to accelerate the development of epilepsy, as monitored by EEG and video. Animals implanted with cortical and hippocampal electrodes underwent SE and were monitored continuously by video-EEG until at least the occurrence of a second spontaneous seizure (epilepsy onset).

On the 4th day following SE, seizure-free female animals were randomly divided in 2 groups: 8 animals received finasteride (100 mg/kg), which blocks endogenous neurosteroid synthesis by inhibiting enzyme 5α-reductase, while 8 animals served as the controls. Among the controls, 3 animals received the vehicle (30% cyclodextrin), and 5 animals were left untreated. The effect of finasteride was evident in the form of an increased frequency of spikes within 60 minutes; 6 out of 8 animals (62%) experienced seizures during the first 24 hrs. following finasteride treatment, and one animal had paroxysmal epileptiform discharges (Fig. 1A-C). In contrast, none of the control animals (vehicle-treated or untreated post-SE animals) experienced seizures over this time frame (n=8, p<0.05 Fisher’s exact test, Fig. 1A, C). Consistent with the findings of other reports, non-SE animals treated with finasteride (n=3) did not have seizures7;15.

Figure 1. Blockade of endogenous neurosteroid synthesis triggered seizures in 4 days post-SE animals and accelerated epileptogenesis in female rats.

Figure 1

Open in a new tab

(A) The total power of EEG in representative vehicle (30% cyclodextrin)-treated and finasteride (100 mg/kg)-treated animals. Time 0 indicates the drug administration on the 4th day following start of SE. Finasteride-triggered seizures are indicated by arrow heads. (B) A finasteride-triggered seizure recorded from cortical (Ctx) and hippocampal (HC) electrodes. The traces below are magnifications of boxed regions a, b, c and d. (C) Percentage of animals that experienced seizures during 24 hrs. following finasteride treatment (N=8 each). None of the control animals, cyclodextrin-treated (N=3) or untreated (N=5) 4 day post-SE animals, experienced seizures (* p<0.05, Fisher’s exact test). (D) The percentage of animals that became epileptic following SE (N=8 each, * p<0.001 log-rank test).

To test whether the blockade of endogenous neurosteroid synthesis accelerated epileptogenesis, we continued to monitor the animals. The time to the 2nd spontaneous seizure (onset of epilepsy) was determined using video-EEG monitoring of each animal, and the percentage of animals that became epileptic was plotted using a Kaplan-Mayer survival estimator. The acute effects of finasteride wear off by 18–20 hrs7; thus, only seizures that occurred 24 hrs. after finasteride administration were considered to be “spontaneous”. Finasteride-treated animals continued to experience seizures (Fig. 1D). Two out of the eight (25%) finasteride-treated animals experienced at least 2 seizures (onset of epilepsy), which typically lasted 40 to 50 sec, on the 5th day following SE. Half of the finasteride-treated animals were epileptic on the 6th day following SE, whereas in control animals this occurred on day 11 (Fig. 1D, p<0.01, log-rank test). The time for the onset of epilepsy in control animals ranged from 7 to 18 days (n=8, Fig. 1D). One finasteride-treated and one control animal did not develop epilepsy during the 20 days of continuous video-EEG monitoring. Thus finasteride-treated animals developed epilepsy sooner than controls.

δ-GABAR expression was reduced before the onset of epilepsy

We determined whether the expression of the δ subunit is diminished following SE and prior to the onset of recurrent spontaneous seizures because changes in GABARs occurring during this period may contribute to epileptogenesis.

The mRNA expression of the δ subunit in the hippocampi of female animals 7 days post-SE (7-SE) was determined real-time PCR, and it was lower than that in the age-matched controls (Fig. 2A). The protein expression of the δ subunit was also reduced in the hippocampi of 7-SE female animals (Fig. 2B, 68 ± 8% of that in naïve animals, n=6, p<0.05, Wilcoxon signed-rank test). Because surface-expressed receptors are physiologically active, we used a biotinylation assay to assess surface-expressed δ subunits. The surface expression of the δ subunit protein in the hippocampi of 7-SE female animals was also less than that in the naïve animals processed in parallel (Fig. 2B, C). The ratio of surface to total δ subunit expression was 0.12 ± 0.03 in 7-SE animals and 0.23 ± 0.04 in naïve animals (n=6, p<0.05, t-test). The surface to total expression of δ-GABARs was also reduced in male 7-SE animals (7-SE; 0.34 ± 0.06 vs naïve: 0.64 ± 0.06, n=6, p<0.005, t-test).

Figure 2. A rapid and specific reduction of δ-GABAR expression following SE in female animals.

Figure 2

Open in a new tab

(A) The fold-change in mRNA expression of the δ, α4, and γ2 GABAR subunits in the hippocampi of 7-SE (red) animals compared to that in naïve animals (black). The mRNA levels were determined using real-time PCR. The CT for GABAR subunits was normalized to the CT of GAPDH, which was used as an internal control. The relative mRNA expression in 7-SE animals was calculated using the ΔΔCT method (N=6 for each, **p<0.05). (B) Representative Western blots of the surface (panel surf) and total (panel input) expression of the δ subunit of GABARs in hippocampal proteins isolated from naïve (C) and 7-SE animals. The expression of the α4 and γ2 subunits was also determined in the same samples as the control. The expression of β-actin was used as a loading control for total protein content. Arrows indicate signals corresponding to each subunit. (C) The time-course of the reduction in the surface expression of δ-GABARs following SE relative to that in naïve animals. Values represent means ± SEMs in this and subsequent figures (N=6 animals each at 4, 7, and 14 days post-SE, 4 animals at 21 days post-SE and 5 at 30+ days post-SE, * p<0.05, ** p<0.001). The changes in the surface expression of γ2-GABARs during epileptogenesis were also determined (N= 5 animals at 4 days post-SE, 6 animals at 7 days post-SE, 7 animals at 14 days post-SE, 4 animals at 21 days post-SE, and 7 30+ days post-SE animals, * p<0.05, ** p<0.001). The pink area illustrates the onset of epilepsy determined in a separate cohort of animals (see Fig. 1D for details).

Neurosteroid-induced modulation of tonic current of DGCs was diminished in 7-SE animals

The reduced δ-GABAR expression in the hippocampi of 7-SE animals suggests that the neurosteroid sensitivity of the tonic current recorded from DGCs was diminished. δ-GABARs are a major target of neurosteroids at physiological concentrations, and their expression level correlates with the neurosteroid sensitivity of extrasynaptic GABAR-mediated inhibition4;9. We recorded tonic currents from DGCs using whole-cell patch-clamp electrophysiological techniques4. The application of allopregnanolone (10 nM) increased the Ihold, which is a typical measure of extrasynaptic GABAR current16 of DGCs from naïve male animals (Fig. 3A). In contrast, allopregnanolone did not increase the Ihold of DGCs from 7-SE animals (Fig. 3A). Furthermore, a higher concentration of allopregnanolone (30 nM) only marginally increased the Ihold of DGCs from 7-SE male animals (Fig. 3B). Allopregnanolone modulation of Ihold was also reduced in 7-SE female animals. Naïve female animals in estrus and metestrus stages were used to avoid the influence of the endogenous rise in progesterone that occurs during proestrus and diestrus phases of the estrus cycle17. Allopregnanolone (30 nM)-ΔIhold in DGCs of these animals was 7.6 ± 1 pA (n=6 cells/4 animals), larger than ΔIhold in DGCs of 7-SE animals (3 ± 0.7 pA, n=8 cells/5 animals, p<0.005, t-test).

Figure 3. The neurosteroid and DS2 modulation of tonic current were diminished in the DGCs from 7-SE male animals.

Figure 3

Open in a new tab

(A) Allopregnanolone potentiation of tonic current was recorded in DGCs from naïve (control, black trace) and 7-SE (red trace) animals. A bath application of allopregnanolone (10 nM) was started at the arrow. (B) The ΔIhold following the application of allopregnanolone in the DGCs from naïve and 7-SE animals (for 10 nM allopregnanolone N= 8 DGCs from 8 control and 7-SE animals each and for 30 nM allopregnanolone N= 8 DGCs from 5 control animals and 11 DGCs from 8 7-SE animals, *p<0.05). The capacitance of DGCs from control animals was 86 ± 12 pF and that of DGCs from 7-SE animals was 98 ± 8 pF (p>0.05). (C) The effect of DS2 (100 nM, arrow) on tonic current of a DGC from a naïve (black trace) and a 7-SE (red trace) animal. (D) The DS2-induced ΔIhold (for 100 nM DS2 N=7 DGCs from 5 control animals and 5 DGCs from 5 7-SE animals, and for 300 nM DS2 N=4 DGCs from 4 control animals and 6 DGCs from 6 7-SE animals, *p<0.05).

The reduced expression of functional δ-GABARs was further confirmed by determining the effect of DS2 (4-chloro-N-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide), which is a α4βxδ-GABAR-selective allosteric modulator18, on Ihold. A bath application of 100 nM and 300 nM DS2 enhanced the Ihold of DGCs from naïve male animals in a concentration dependent manner (Fig. 3C). In contrast, neither concentration of DS2 altered the Ihold of DGCs from 7-SE male animals (Fig. 3C, D).

Next, we determined the time-course of the reduction in surface δ-GABAR expression. The surface expression of δ-GABARs was diminished in 4-SE female animals, and it remained diminished 1, 3, and 6 weeks after SE, while spontaneous seizures continued (Fig. 2C). Thus, 7 days following SE δ-GABAR expression and neurosteroid modulation of tonic current in DGCs were reduced, and this reduction persisted during chronic epilepsy. Spontaneous seizures began after δ-GABAR down-regulation.

The plasticity of α4 and γ2 subunits was distinct than that of δ subunits

The expression of α4 and γ2 subunits of GABARs is increased in the DGCs of epileptic animals whereas the assembly of α4 and γ2 subunits is increased as early as 24 hr post-SE4;19;20. The δ subunits assemble with the α4 subunits to form receptors targeted to the extrasynaptic membrane6. We determined whether the reduction in the expression of the δ subunit was independent of the plasticity of the α4 and γ2 subunits in female animals. Unlike the pattern for the δ subunit, the mRNA expression of the α4 and γ2 subunits in 7-SE animals was similar to that in naïve animals (Fig. 2A). The protein expression of α4 and γ2 subunits was also not different between 7-SE and naïve animals (Fig. 2B, 83 ± 8%, n=5, p>0.05 and 79 ± 28%, n=7, p>0.05). The surface expression of these subunits was also unchanged; the surface to total expression ratio for α4 subunits in 7-SE animals was 0.27 ± 0.13, similar to that in naïve animals (0.22 ± 0.07, n=5, p>0.05, Fig. 2B). The surface to total ratio for γ2 subunit expression in 7-SE animals was also unchanged (0.43 ± 0.13 in 7-SE animals and 0.51 ± 0.2 in controls, n=6, p>0.05, t test).

Next, we determined the time-course of changes in the expression of γ2-GABAR expression following SE. The surface expression of γ2-GABAR was increased in 14-SE female animals, and it remained high at subsequent time points (Fig. 2C). Thus, δ-GABARs were down-regulated prior to the start of spontaneous seizures, whereas the upregulation of γ2-GABARs appeared to coincide with the onset of epilepsy (Fig. 2C).

Blocking NMDA receptors (NMDARs) during SE prevented the down-regulation of δ-GABAR expression and suppressed epileptogenesis

Neurosteroid signaling was altered and δ-GABAR expression was reduced before the onset of epilepsy, suggesting a temporal correlation. We then determined whether preventing δ-GABAR downregulation could suppress epileptogenesis. Studies in cultured hippocampal neurons have revealed that NMDAR activation reduces δ subunit expression21. NMDARs are activated during SE22; therefore, we determined whether blocking NMDARs could maintain δ subunit expression.

We treated animals with MK801 (2 mg/kg) 10 min after the start of continuous electrographic seizures; this dose was selected because it does not affect SE23. Because the duration of SE affects the length of the latent period, we first confirmed that treatment with the NMDAR antagonist did not shorten SE (Fig. 4A). The termination of SE was defined as the frequency of spike-wave discharges being reduced to below 3 Hz and becoming arrhythmic and no occurrence of seizures for 60 minutes. In the control animals, seizures lasted for 445 ± 121 min (Fig. 4A, n=12, male and female animals pooled together). SE also continued unabated in MK-801-treated male and female animals pooled together (599 ± 45, n=8,). Thus, the blockade of NMDARs during SE did not lead to an early termination of SE.

Figure 4. NMDAR blockade during SE did not terminate or shorten SE in female and male animals.

Figure 4

Open in a new tab

(A) EEGs from control and MK801-treated female animals at baseline (pre) and at 10, 60, 120, and 240 min following the start of continuous seizure activity of SE. (B) Power of EEGs in representative untreated and MK801-treated animals in SE. Arrowheads mark the time points for EEG trace in panel A. The duration of SE in control animals was (female Dzp-treated: 468 ± 96, n=7, male saline-treated: 682 ± 50 min, n=5) and MK-801 treated animals was (male: 626 ± 56 min, n=4, female: 546 ± 14 min, n=4) similar.

We also analyzed EEGs for other changes beyond visually apparent seizures by performing a power analysis. The power of the EEGs remained high for 3 hrs. following the start of continuous seizures in the untreated animals (Fig. 4B). However, the power of EEGs, particularly in the δ and θ frequencies, was reduced in MK801-treated animals (Fig. 4B). There was also a substantial reduction in the EEG power in MK801-treated animals after 1.5 hr.

Then, we determined the surface expression of δ-GABARs 7 days following SE. The surface expression of δ-GABARs in the hippocampi of MK801-treated 7-SE female animals was similar to that in naïve female animals (Fig. 5A, B). Furthermore, the δ subunit mRNA levels were also comparable between MK801-treated and naïve female animals (Fig. 5C).

Figure 5. NMDAR blockade during SE prevented the down-regulation of δ-GABAR expression, maintained the neurosteroid modulation of tonic current, and suppressed epileptogenesis in female and male animals.

Figure 5

Open in a new tab

(A) Representative Western blot of the surface and total (panel input) expression of the δ subunit in naïve and MK-801 (2 mg/kg, 10 min after the first stage-5 behavioral seizure)-treated 7-SE female animals. The surface and total δ subunit expression in a 7-SE animal treated with diazepam (10 mg/kg, injected at 2 hrs.) alone during SE (lane 7-SE) is shown for comparison. (B) The surface expression of the δ subunit in 7-SE animals relative to that in naïve animals (column control, N=5 each). Surface expression from 6 7-SE female animals treated with diazepam during SE is presented for comparison (*p<0.05, ANOVA). (C) The expression of δ subunit mRNA in MK801-treated 7-SE female animals compared to that in naïve animals (N=6 each), and the expression in 7-SE animal that received diazepam during SE is shown for comparison (N=6, *p<0.05). (D) Effect of 30 nM allopregnanolone on Ihold recorded from DGCs of naïve and MK801-treated 7-SE male animals (arrow). The white lines represent the Ihold before and after the effect of allopregnanolone has stabilized. (E) ΔIhold following the application of 30 nM allopregnanolone (N=8 DGCs from 5 naïve, 11 DGCs from 8 7-SE, 7 DGCs from 6 MK801-treated 7-SE animals, *p<0.05). (F) Percent of animals that became epileptic at the end of 30 days of continuous video-EEG monitoring, N=7 female animals that received diazepam at 2 hrs. after the start of continuous seizures and 5 male animals that received saline 10 min after the start of continuous seizures, pooled together as control and N=4 MK-801-treated female animals and 4 MK-801-treated male animals pooled together (* p<0.001, log-rank test).

We determined whether the neurosteroid-induced modulation of tonic current of DGCs was also maintained in NMDAR-antagonist-treated animals (Fig. 5D, E). In accordance with the preserved surface expression of δ-GABARs, the application of allopregnanolone (30 nM) potentiated the tonic current of DGCs in the MK801-treated 7-SE male animals, similar to the effects observed in the DGCs of naïve male animals (Fig. 5D, E). MK-801 treatment also preserved neurosteroid modulation of tonic current in the female 7-SE animals; allopregnanolone (30 nM)-ΔIhold in MK-801-treated 7-SE animals was 5.8 ± 0.5 pA (n= 6 cells from 4 animals), similar to that in the controls (7.6 ± 1 pA, n= 6 cells/4 animals, p>0.05).

NMDAR blockade during SE suppressed epileptogenesis

NMDAR blockade during SE maintained δ-GABAR expression and preserved the neurosteroid modulation of tonic current. This suggests that epileptogenesis may be suppressed in MK801-treated animals. To test this, male and female animals were monitored continuously by video-EEG for 30 days following SE. The time to 2nd spontaneous seizure was noted in each animal, and the percentages of animals that became epileptic were plotted. Epilepsy onset occurred between 7 and 14 days following SE in the untreated or diazepam-treated animals (Fig. 5F). In contrast, none of the MK801-treated animals developed epilepsy during the 30-day monitoring period (Fig. 5F, p<0.001, Kaplan-Meyer survival estimator followed by signed log-rank test). Thus, the blockade of NMDARs during SE also suppresses the development of epilepsy.

Discussion

This study demonstrates that the down-regulation of neurosteroid sensitive δ-GABARs occurs before the onset of epilepsy; however, the upregulation of γ2-GABARs, which may partially compensate for the reduction in δ-GABAR expression, follows onset of spontaneous seizures. This delay could contribute to the transient impairment of the dentate gating function observed following SE24. The impairment of gating function was also evident in the finasteride experiments, in which blocking endogenous neurosteroid synthesis accelerated the onset of recurrent spontaneous seizures. The finasteride acceleration of epileptogenesis was also reported in another study2, where the drug was administered daily between 3 to 18 days following SE. In contrast, the current study found that a single injection of finasteride administered at the time of the down-regulation of δ-GABAR expression hastened the onset of epilepsy.

This study describes precisely the temporal relationship between down-regulation of δ-GABARs and upregulation of γ2 subunits and onset of epilepsy. The SE-induced alterations in the δ, α4, and γ2 subunit-containing receptors followed distinct time courses in relation to the process of epileptogenesis. Similar alterations in GABAR subunit expression were also observed in a mouse model of epileptogenesis using immunohistochemistry3, but in that study, seizures were monitored by video alone, which may have missed non-convulsive seizures25. In contrast to the findings of this study, in a prior study using a single-cell RNA amplification α4 subunit mRNA expression in DGCs was reduced 1 day following SE, whereas in another study, α4 subunit protein was reduced in CA1 neurons of 4 and 8 days post-SE animals26;27. In addition, SE also induces alterations in the subunit assembly; in a prior study increased assembly of α4γ2 subunits was seen in the DGCs as early as 24 hr post-SE19. The reasons for the discrepant findings are unclear; differences in the methods of quantification and in the regions that were used could account for some of the distinctions. The current studies were performed using mRNA or protein isolated from whole hippocampi whereas prior studies used either microdissected DG or CA1 areas.

NMDAR activation during SE may play a role in the plasticity of δ-GABARs following SE. NMDAR activation triggers the down-regulation of δ subunit expression in cultured hippocampal neurons, and inhibition of ERK1/2 activation prevented the NMDA-induced reduction in δ subunit expression21. NMDAR blockade during SE preserved δ subunit expression. This action of NMDAR blocker may be specifically related to receptor blockade or may relate to non-specific actions on the neuronal dynamics during SE. NMDAR antagonists are known to affect EEG regardless of their ability to terminate SE28. Indeed, in the current study the power of EEG in certain frequencies was different between MK-801-treated and untreated animals.

Altered GABAergic transmission is proposed to play an important role in the disinhibition of DGCs during epileptogenesis29. The potential mechanisms contributing to the reduced GABAergic inhibition involve a loss of interneurons, the zinc-induced collapse of inhibition, and altered GABAR expression6;30;31. However, the synaptic events recorded from the DGCs of epileptic animals are larger than those observed in controls, and the sprouting of connections from remaining interneurons has been observed in association with epilepsy, which may compensate for the loss of a fraction of interneurons31. Whether the zinc-induced inhibition of GABARs expressed on DGCs can occur in vivo is also unclear. The observed reduction in the expression of neurosteroid-sensitive δ-GABAR during epileptogenesis provides a mechanism that may contribute to the disinhibition of DGCs in vivo. Prior studies have also observed a strong correlation between δ-GABAR expression, neurosteroid-induced modulation of tonic current, and seizure susceptibility8–10.

Prior studies have found anti-epileptogenic effect of NMDAR antagonists administered during SE32;33. In this study, NMDAR blockade during SE also suppressed epileptogenesis and prevented δ-GABAR down-regulation. However, it is not clear whether the two phenomena are causally related. MK-801 treatment did not affect the duration of SE, which appears to regulate the length of latent period34. NMDAR blockade prevents neuronal loss35;36 and may reduce the severity of glutamate toxicity that is associated with oxidative stress and inflammation37. NMDAR blockade is also likely to reduce calcium influx, which regulates cellular signaling38. Thus, the observed anti-epileptogenic action of MK-801 could be a combination of multiple factors, which could include δ-GABAR downregulation. Further studies, such as re-introduction of δ-GABAR in the hippocampus of epileptic animals combined with video-EEG monitoring, are needed to test the role of these receptors. Similar studies were conducted for the α1 subunit of GABAR39.

There are other molecular targets for preventing epileptogenesis: signaling proteins such as mTOR, TrkB, and JAK/STAT, and transcriptional and/or post-translational regulators such as NRSF, CREB, and miRNAs. The blockade of TrkB activation following SE is anti-epileptogenic and prevents neurodegeneration40. The infusions of antagomirs targeting miR134 or oligonucleotides preventing the binding of NRSF to its targets, such as HCN1, also suppressed spontaneous seizures41;42. In these studies, the treatments were initiated after SE and performed for a week or longer following SE, which is the entire latent period in rodents. In humans, epileptogenesis is a much slower process, and the seizure-free latent period can last from months to years. Thus, any anti-epileptogenic treatment targeting these pathways could require drug treatment for months or years. Few FDA-approved drugs exist to target these signaling systems, and the ones that are approved have toxic side effects, which would be difficult to tolerate if treatments were continued over a prolonged period of time. In contrast, ketamine has already been used for the treatment of refractory and super-refractory SE43;44. Ketamine has been in clinical use for decades, and recent studies have demonstrated its efficacy in the treatment of benzodiazepine-refractory SE, with few adverse effects43;44. A clinical trial testing therapeutic role of ketamine in the treatment of established SE is feasible, as demonstrated by the ongoing established status epilepticus treatment trial (ESETT)45.

Benzodiazepines are recommended as the initial treatment for convulsive SE in adults and children. This recommendation is based on multiple clinical trials, which also demonstrate that they can be safely administered in the field46–49. Patients who do not respond to benzodiazepines frequently arrive in emergency departments with continued seizure activity, and this benzodiazepine refractory SE is referred to as Established Status Epilepticus. In the Li/pilocarpine rodent model of SE, animals initially experience intermittent seizures that progress to continuous electrographic seizure activity. Benzodiazepines effectively terminate intermittent seizure activity in rodents but are ineffective if administered after continuous seizures have evolved in this model50;51. Other findings suggest a role for NMDAR antagonists in treatment of SE. High doses of NMDAR antagonist can terminate experimental SE, and the low doses of these agents can terminate SE in combination with benzodiazepines11;23

In conclusion this study demonstrates that the expression of δ-GABARs is reduced and endogenous neurosteroid signaling is altered during epileptogenesis prior to the onset of seizures.

Key points.

  • The expression of δ-GABARs was down-regulated, and the neurosteroid modulation of tonic current was diminished before the onset of epilepsy.

  • Inhibition of endogenous neurosteroid synthesis accelerated epileptogenesis.

  • Blocking NMDAR activation during SE prevented the reduction in δ-GABAR expression and suppressed epileptogenesis.

Acknowledgments

This work was supported by NIH R01 grants (NS044370 and NS040337) to JK and the Epilepsy Foundation Young Investigator Award to SJ. We thank David Breen, Rami Salah Maroof, and Louis Goity for their technical assistance.

We confirm that we have read the Journal’s position on issues involved in ethical publication and affirm that this report is consistent with those guidelines.

Footnotes

Disclosures:

None of the authors has any conflict of interest to disclose.

Reference List

  • 1.Tan C, Shard C, Ranieri E, et al. Mutations of protocadherin 19 in female epilepsy (PCDH19-FE) lead to allopregnanolone deficiency. Hum Mol Genet. 2015;24:5250–5259. doi: 10.1093/hmg/ddv245. [DOI] [PubMed] [Google Scholar]
  • 2.Biagini G, Baldelli E, Longo D, et al. Endogenous neurosteroids modulate epileptogenesis in a model of temporal lobe epilepsy. Experimental Neurology. 2006;201:519–524. doi: 10.1016/j.expneurol.2006.04.029. [DOI] [PubMed] [Google Scholar]
  • 3.Peng Z, Huang CS, Stell BM, et al. Altered expression of the δ subunit of the GABAA receptor in a mouse model of temporal lobe epilepsy. J Neurosci. 2004;24:8629–8339. doi: 10.1523/JNEUROSCI.2877-04.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Rajasekaran K, Joshi S, Sun C, et al. Receptors with low affinity for neurosteroids and GABA contribute to tonic inhibition of granule cells in epileptic animals. Neurobiol Dis. 2010;40:490–501. doi: 10.1016/j.nbd.2010.07.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.González MI, Grabenstatter HL, Cea-Del Rio CA, et al. Seizure-related regulation of GABAA receptors in spontaneously epileptic rats. Neurobiol Dis. 2015;77:246–256. doi: 10.1016/j.nbd.2015.03.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Joshi S, Rajasekaran K, Kapur J. GABAergic transmission in temporal lobe epilepsy: The role of neurosteroids. Exp Neurol. 2013;244:36–42. doi: 10.1016/j.expneurol.2011.10.028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Lawrence C, Martin BS, Sun C, et al. Endogenous neurosteroid synthesis modulates seizure frequency. Ann Neurol. 2010;67:689–693. doi: 10.1002/ana.21989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Maguire JL, Stell BM, Rafizadeh M, et al. Ovarian cycle-linked changes in GABAA receptors mediating tonic inhibition alter seizure susceptibility and anxiety. Nat Neurosci. 2005;8:797–804. doi: 10.1038/nn1469. [DOI] [PubMed] [Google Scholar]
  • 9.Stell BM, Brickley SG, Tang CY, et al. Neuroactive steroids reduce neuronal excitability by selectively enhancing tonic inhibition mediated by δ subunit-containing GABAA receptors. Proc Natl Acad Sci U S A. 2003;100:14439–14444. doi: 10.1073/pnas.2435457100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Spigelman I, Li Z, Banerjee PK, et al. Behavior and physiology of mice lacking the GABAA receptor δ subunit. Epilepsia. 2002;43(Suppl 5):3–8. doi: 10.1046/j.1528-1157.43.s.5.8.x. [DOI] [PubMed] [Google Scholar]
  • 11.Martin BS, Kapur J. A combination of ketamine and diazepam synergistically controls refractory status epilepticus induced by cholinergic stimulation. Epilepsia. 2008;49:248–255. doi: 10.1111/j.1528-1167.2007.01384.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Racine RJ. Modification of seizure activity by electrical stimulation. II. Motor seizure. Electroencephalogr Clin Neurophysiol. 1972;32:281–294. doi: 10.1016/0013-4694(72)90177-0. [DOI] [PubMed] [Google Scholar]
  • 13.Joshi S, Sun C, Kapur J. A Mouse monoclonal antibody against the γ2 subunit of GABAA receptors. Hybridoma (Larchmt) 2011;30:537–542. doi: 10.1089/hyb.2011.0035. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative CT method. Nat Protocols. 2008;3:1101–1108. doi: 10.1038/nprot.2008.73. [DOI] [PubMed] [Google Scholar]
  • 15.Reddy DS, Rogawski MA. Enhanced anticonvulsant activity of neuroactive steroids in a rat model of catamenial epilepsy. Epilepsia. 2001;42:337–344. doi: 10.1046/j.1528-1157.2001.10200.x. [DOI] [PubMed] [Google Scholar]
  • 16.Bright DP, Smart TG. Methods for recording and measuring tonic GABAA receptor-mediated inhibition. Front Neural Circuits. 2013;7:193. doi: 10.3389/fncir.2013.00193. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Smith MS, Freeman ME, Neill JD. The control of progesterone secretion during the estrous cycle and early pseudopregnancy in the rat: prolactin, gonadotropin and steroid levels associated with rescue of the corpus luteum of pseudopregnancy. Endocrinology. 1975;96:219–226. doi: 10.1210/endo-96-1-219. [DOI] [PubMed] [Google Scholar]
  • 18.Wafford KA, van Niel MB, Ma QP, et al. Novel compounds selectively enhance δ subunit containing GABAA receptors and increase tonic currents in thalamus. Neuropharmacology. 2009;56:182–189. doi: 10.1016/j.neuropharm.2008.08.004. [DOI] [PubMed] [Google Scholar]
  • 19.Lund IV, Hu Y, Raol YH, et al. BDNF selectively regulates GABAA receptor transcription by activation of the JAK/STAT pathway. Sci STKE. 2008;1:ra9. doi: 10.1126/scisignal.1162396. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Zhang N, Wei W, Mody I, et al. Altered localization of GABAA receptor subunits on dentate granule cell dendrites influences tonic and phasic inhibition in a mouse model of epilepsy. J Neurosci. 2007;27:7520–7531. doi: 10.1523/JNEUROSCI.1555-07.2007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Joshi S, Kapur J. NMDA receptor activation down-regulates expression of δ subunit-containing GABAA receptors in cultured hippocampal neurons. Mol Pharmacol. 2013;84:1–11. doi: 10.1124/mol.112.084715. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Naylor DE, Liu H, Niquet J, et al. Rapid surface accumulation of NMDA receptors increases glutamatergic excitation during status epilepticus. Neurobiol Dis. 2013;54:225–238. doi: 10.1016/j.nbd.2012.12.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Rice AC, DeLorenzo RJ. NMDA receptor activation regulates refractoriness of status epilepticus to diazepam. Neuroscience. 1999;93:117–123. doi: 10.1016/s0306-4522(99)00132-3. [DOI] [PubMed] [Google Scholar]
  • 24.Pathak HR, Weissinger F, Terunuma M, et al. Disrupted dentate granule cell chloride regulation enhances synaptic excitability during development of temporal lobe epilepsy. J Neurosci. 2007;27:14012–14022. doi: 10.1523/JNEUROSCI.4390-07.2007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Bertram EH, Cornett J. The ontogeny of seizures in a rat model of limbic epilepsy: evidence for a kindling process in the development of chronic spontaneous seizures. Brain Research. 1993;625:295–300. doi: 10.1016/0006-8993(93)91071-y. [DOI] [PubMed] [Google Scholar]
  • 26.Brooks-Kayal AR, Shumate MD, Jin H, et al. Selective changes in single cell GABA) receptor subunit expression and function in temporal lobe epilepsy. Nat Med. 1998;4:1166–1172. doi: 10.1038/2661. [DOI] [PubMed] [Google Scholar]
  • 27.Gonzalez MI, Cruz DA, Brooks-Kayal A. Down-regulation of gephyrin and GABAA receptor subunits during epileptogenesis in the CA1 region of hippocampus. Epilepsia. 2013;54:616–624. doi: 10.1111/epi.12063. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Keavy D, Bristow LJ, Sivarao DV, et al. The qEEG signature of selective NMDA NR2B negative allosteric modulators; a potential translational biomarker for drug development. PLoS ONE. 2016;11:e0152729. doi: 10.1371/journal.pone.0152729. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Coulter DA, Carlson GC. Functional regulation of the dentate gyrus by GABA-mediated inhibition. Prog Brain Res. 2007;163:235–243. doi: 10.1016/S0079-6123(07)63014-3. [DOI] [PubMed] [Google Scholar]
  • 30.Coulter DA. Epilepsy-associated plasticity in GABAA receptor expression, function, and inhibitory synaptic properties. In: Jerome Engel J, editor. International Review of Neurobiology Brain Plasticity and Epilepsy. Academic Press; 2001. pp. 237–252. [DOI] [PubMed] [Google Scholar]
  • 31.Sun C, Mtchedlishvili Z, Bertram EH, et al. Selective loss of dentate hilar interneurons contributes to reduced synaptic inhibition of granule cells in an electrical stimulation-based animal model of temporal lobe epilepsy. J Comp Neurol. 2007;500:876–893. doi: 10.1002/cne.21207. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Prasad A, Williamson JM, Bertram EH. Phenobarbital and MK-801, but not phenytoin, improve the long-term outcome of status epilepticus. Ann Neurol. 2002;51:175–181. doi: 10.1002/ana.10085. [DOI] [PubMed] [Google Scholar]
  • 33.Rice AC, DeLorenzo RJ. NMDA receptor activation during status epilepticus is required for the development of epilepsy. Brain Research. 1998;782:240–247. doi: 10.1016/s0006-8993(97)01285-7. [DOI] [PubMed] [Google Scholar]
  • 34.Biagini G, Longo D, Baldelli E, et al. Neurosteroids and epileptogenesis in the pilocarpine model: evidence for a relationship between P450scc induction and length of the latent period. Epilepsia. 2009;50(Suppl 1):53–58. doi: 10.1111/j.1528-1167.2008.01971.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Fujikawa DG. Neuroprotective effect of ketamine administered after status epilepticus onset. Epilepsia. 1995;36:186–195. doi: 10.1111/j.1528-1157.1995.tb00979.x. [DOI] [PubMed] [Google Scholar]
  • 36.Brandt C, Potschka H, Loscher W, et al. NMDA receptor blockade after status epilepticus protects against limbic brain damage but not against epilepsy in the kainate model of temporal lobe epilepsy. Neuroscience. 2003;118:727–740. doi: 10.1016/s0306-4522(03)00027-7. [DOI] [PubMed] [Google Scholar]
  • 37.Dorandeu F, Dhote F, Barbier L, et al. Treatment of status epilepticus with ketamine, are we there yet? CNS Neurosci Ther. 2013;19:411–427. doi: 10.1111/cns.12096. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Nagarkatti N, Deshpande LS, DeLorenzo RJ. Development of the calcium plateau following status epilepticus: role of calcium in epileptogenesis. Expert Rev Neurotherapeutics. 2009;9:813–824. doi: 10.1586/ern.09.21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Raol YH, Lund IV, Bandyopadhyay S, et al. Enhancing GABAA receptor α1 subunit levels in hippocampal dentate gyrus inhibits epilepsy development in an animal model of temporal lobe epilepsy. J Neurosci. 2006;26:11342–11346. doi: 10.1523/JNEUROSCI.3329-06.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Liu G, Gu B, He XP, et al. Transient inhibition of TrkB kinase after status epilepticus prevents development of temporal lobe epilepsy. Neuron. 2013;79:31–38. doi: 10.1016/j.neuron.2013.04.027. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Jimenez-Mateos EM, Engel T, Merino-Serrais P, et al. Silencing microRNA-134 produces neuroprotective and prolonged seizure-suppressive effects. Nat Med. 2012;18:1087–1094. doi: 10.1038/nm.2834. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.McClelland S, Brennan GP, Dube C, et al. The transcription factor NRSF contributes to epileptogenesis by selective repression of a subset of target genes. Elife. 2014;3:e01267. doi: 10.7554/eLife.01267. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Fang Y, Wang X. Ketamine for the treatment of refractory status epilepticus. Seizure. 2015;30:14–20. doi: 10.1016/j.seizure.2015.05.010. [DOI] [PubMed] [Google Scholar]
  • 44.Gaspard N, Foreman B, Judd LM, et al. Intravenous ketamine for the treatment of refractory status epilepticus: A retrospective multicenter study. Epilepsia. 2013;54:1498–1503. doi: 10.1111/epi.12247. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Bleck T, Cock H, Chamberlain J, et al. The established status epilepticus trial 2013. Epilepsia. 2013;54:89–92. doi: 10.1111/epi.12288. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Alldredge BK, Gelb AM, Isaacs SM, et al. A comparison of lorazepam, diazepam, and placebo for the treatment of out-of-hospital status epilepticus. N Engl J Med. 2001;345:631–637. doi: 10.1056/NEJMoa002141. [DOI] [PubMed] [Google Scholar]
  • 47.Silbergleit R, Durkalski V, Lowenstein D, et al. Intramuscular versus intravenous therapy for prehospital status epilepticus. N Engl J Med. 2012;366:591–600. doi: 10.1056/NEJMoa1107494. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Chamberlain JM, Okada P, Holsti M, et al. Lorazepam vs diazepam for pediatric status epilepticus: a randomized clinical trial. JAMA. 2014;311:1652–1660. doi: 10.1001/jama.2014.2625. [DOI] [PubMed] [Google Scholar]
  • 49.Glauser T, Shinnar S, Gloss D, et al. Evidence-Based Guideline: Treatment of convulsive status epilepticus in children and edults: Report of the Guideline Committee of the American Epilepsy Society. Epilepsy Curr. 2016;16:48–61. doi: 10.5698/1535-7597-16.1.48. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Jones DM, Esmaeil N, Maren S, et al. Characterization of pharmacoresistance to benzodiazepines in the rat Li-pilocarpine model of status epilepticus. Epilepsy Res. 2002;50:301–312. doi: 10.1016/s0920-1211(02)00085-2. [DOI] [PubMed] [Google Scholar]
  • 51.Kapur J, Macdonald RL. Rapid seizure-induced reduction of benzodiazepine and Zn2+ sensitivity of hippocampal dentate granule cell GABAA Receptors. J Neurosci. 1997;17:7532–7540. doi: 10.1523/JNEUROSCI.17-19-07532.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES