Skip to main content
PLOS One logoLink to PLOS One
. 2017 May 2;12(5):e0176451. doi: 10.1371/journal.pone.0176451

The histological characteristics, age-related thickness change of skin, and expression of the HSPs in the skin during hair cycle in yak (Bos grunniens)

Xue Yang 1,¤, Yan Cui 1,¤,*, Jing Yue 1, Honghong He 1, Chuan Yu 1, Penggang Liu 1, Jun Liu 1, Xiandong Ren 1, Yun Meng 1
Editor: Shrikant Anant2
PMCID: PMC5413005  PMID: 28463974

Abstract

Objective

This experiment was conducted to study the histological characteristics, age-related thickness changes, and expression of HSPs in the skin of yak.

Methods

A total of 20 yaks (10 males and 10 females) were used. Different regions of the normal skin of three different ages (newborn, half-year-old and adult) of yaks were harvested for histological study and thickness measurement. Biopsy samples were taken from the scapula regions of the skin from the same five approximately 1-year-old yaks during the hair cycle (telogen, anagen and catagen). RT-PCR, western blot and immunohistochemistry methods using the mRNA and protein levels were used to detect the expression of HSP27, HSP70 and HSP90. RT-PCR method was used to detect the mRNA expression of CGI-58 and KDF1. The IPP6.0 software was used to analyze the immunohistochemistry and measure the thickness of the skin.

Results

The general histological structure of hairy yak skin was similar to other domestic mammals. The unique features included prominent cutaneous vascular plexuses, underdeveloped sweat glands, a large number of nasolabial glands in the nasolabial plate, and hair follicle groups composed of one primary follicle and several secondary follicles. The skin, epidermis and dermis thickness did vary significantly between different body regions and different ages. The thickness of the skin, epidermis and dermis increased from newborn to adult in yaks. Yak skin thickness decreased from dorsally to ventrally on the trunk. The skin on the lateral surface was thicker than the skin on the medial surface on the limbs. HSP27, HSP70 and HSP90 showed different expression patterns during the hair cycle using RT-PCR, western blot and immunohistochemistry methods. The expression of HSP27 mRNA and protein in the anagen stage was the highest, followed by the catagen stage, and the expression in the telogen stage was the lowest. The expression of HSP70 mRNA and protein in the telogen stage was the highest, followed by the anagen stage, and the expression in the catagen stage was the lowest. The expression of HSP90 mRNA and protein in the anagen stage was the highest, followed by the telogen stage, and the expression in the catagen stage was the lowest. HSPs were mainly expressed in the outer root sheath of hair follicle during the hair cycle, also expressed in epidermis, sebaceous gland and sweat gland in the skin of Yak. The expression of CGI-58 mRNA in the anagen stage was the highest, followed by the catagen stage, and the expression in the telogen stage was the lowest. The expression of KDF1 mRNA in the telogen stage was the highest, followed by the catagen stage, and the expression in the anagen stage was the lowest.

Meaning

In this study, we examined and fully described the histology of normal skin in Yak and measured the skin thickness of different ages and different regions in Yak. These data may be useful to better understand and appreciate the adaptability features of yak skin. Our investigation reports the expression patterns of HSPs in yak skin for the first time. The different expression pattern of HSPs during the hair cycle suggests they may play different roles in yak hair follicle biology.

Introduction

Yak (Bos grunniens) is a special plateau mammal that lives in the extreme environments of the Tibetan highlands, which has the basic features of extreme cold, high altitudes with reduced oxygen content in the air, and high ultraviolet radiation. The altitude where yaks live normally is over 3000–6000 meters high. The annual temperature of this area is -3 to 3°C, and the extreme lowest temperature is -40°C. Yaks play an important role in normal life for people living in the plateau, such as providing meat, milk and wool, packing goods and materials and riding.

As a special plateau mammal, there are many studies on their reproductive performance, including reproductive organ structures [1–4], hormone regulation [5–8] and adaptability. Studies on the adaptability of yak are mostly concentrated on the respiratory system [9–11], circulatory system [12–14] and immune system [15,16], including the histological structure, ultrastructure and distribution of some factors such as VEGF, HIF and CX43.

The skin is the largest organ of the body and serves many functions, such as protection against environmental aggressions (cold, intense radiation and sandstorms), sensation, metabolism and thermoregulation. There are some studies of the skin histology of some mammals such as llamas [17], sheep [18], ferrets [19] and camels (Camelus dromedaries) [20]. It is an accepted fact that skin varies considerably in thickness based on its site and age. In 2009, Volkering measured the skin thickness over the equine body [21]. Many of the related works that have been conducted on different body regions and ages have been done in humans [22–24]. Only a few studies have been published on the histological research and measurement of yak skin, but there are no detailed data for skin histologic characteristics, thickness changes or the relationship between structure and adaptability in yak.

Heat shock protein (HSP) is one type of molecular chaperone and includes five major groups: 20–30, 60, 70, 90 and 110 kDa based on molecular size [25]. HSPs are involved in protein folding, assembly, transport and regulation of cell growth and differentiation [26]. Heat shock protein-27 (HSP27) is a member of the small heat shock proteins (sHSP). The primary structure of HSP27 is highly homologous to other members of the sHSP family; it contains the conserved α-crystallin domain and differs in the C- and N-terminal regions. HSP27 is expressed in all human tissues, including astrocytes and primary neuronal cells, but is mainly found in skeletal, smooth and cardiac muscles [27]. HSP27 protein is expressed in a differentiation-related pattern [28–32]. For example, keratinocytes of the upper epidermis express higher levels of HSP27 than basal cell keratinocytes in normal human skin. In developing human skin, HSP27 protein expression correlates with increasing epidermal differentiation and trichilemmal keratinization [33].

HSP70 included two major proteins: constitutively expressed HSC70 and stress-inducible HSP72 [34]. HSC70 is expressed in practically all organs and tissues and functions as ATP-dependent molecular chaperone under normal conditions [35–37]. HSP70 plays an important role in cell apoptosis through its ability to inhibit apoptosis. HSP70 can regulate cell apoptosis at different levels such as affecting some transcription factors involved in the expression of Bcl-2 family [38].

HSP90 belongs to another important HSPs family. It is a kind of abundant protein expressed in all eukaryotic calls [39,40]. HSP90 is highly conserved and also is an ATP-dependent chaperone. HSP90 can maturate, stabilize and activate a range of client proteins through form complex [40,41]. Many of these client proteins are involved in cell growth, proliferation and survival.

Hair follicle (HF) cycling transitions include telagen, anagen and catagen. These phases are controlled by molecular switches such as HSPs. To date, nothing is known about HSPs protein expressions in the skin of yaks or their relation to the cycling changes in HF. In this investigation, we tested the expression patterns of HSP27, HSP70 and HSP90 in normal yak skin during their hair cycle.

Materials and methods

Experimental animals and treatments

A total of 20 yaks (10 males and 10 females) from the Gannan Tibetan Autonomous Prefecture in Gansu province and Xining City in Qinghai province that were humanely euthanized for reasons unrelated to the skin were used in this study. Yaks were purchased from Jianguo Ma and Ming Liu, the small holders in Gannan Tibetan Autonomous Prefecture of Gansu Province and Datong County of Qinghai Province (China). Yaks were permitted as experimental animals by the owners. In order to maintain the original habitat, the yaks were executed and samples were collected in the local instead of being housed at the university. All of the yaks were in good nutritional condition and were distributed evenly into four groups (newborn, half-year-old, 1-year-old and adult) (Table 1). In this study, the experimental animals were all handled according to the Animal Ethics Procedures and Guidelines of the People’s Republic of China, and the study was approved by the Animal Ethics Committee of Gansu Agricultural University.

Table 1. Specimens examined.

Number Age Origin Used for
5 Newborn Gannan, Gansu Measurement
5 half-year-old Xining, Qinghai Measurement
5 1-year-old Xining, Qinghai RT-PCR, WB, Immunohistochemistry
5 3–5 years Xining, Qinghai Histology, Measurement

Twenty-five different regions (Fig 1) of the normal skin of three different age (newborn, half-year-old and adult) yaks were harvested for histological study and thickness measurements. All of the animals were euthanized by intravenous injection of pentobarbital sodium (150 mg/kg body weight) for animal welfare and safety of experimenter.

Fig 1. Regions of yak body where skin specimens were obtained for this study.

Fig 1

1 forehead 2 cheek 3 dorsal neck 4 lateral neck 5 ventral neck 6 withers 7 scapula 8 brachia 9 thorax 10 lateral of forearm 11 medial of forearm 12 metacarpus 13 back 14 costal region 15 waist 16 buttock 17 thigh 18 abdomen 19 lateral of crus 20 inguinal region 21 medial of crus 22 metatarsus 23 nasolabial plate 24 hoof 25 axilla. Note: the axilla was not marked.

Five of the 1-year-old yaks that were used for the hair follicle study were kept under the same natural photoperiod and temperature conditions. Biopsy samples of the skin during the hair cycle (telogen, anagen and catagen) were taken from the scapula region. Skin specimens used for immunohistochemistry were stored in 4% paraformaldehyde solution, and skin specimens used for RT-PCR and WB were stored at -80°C.

Light microscopy

Skin samples from the yaks were fixed on the paperboard to prevent shrinkage, stored in 4% paraformaldehyde solution, softened, dehydrated, embedded in paraffin, sectioned at a thickness of 6 μm and deparaffinized. The sections were stained using hematoxylin and eosin (H.E), Masson’s trichrome, Weigert-van Gieson (WVG), Alcian blue periodic acid schiff (AB-PAS) and Sacpic [42] methods.

Relative real-time RT-PCR

Total skin tissue RNA was isolated using TRIzol reagent (Invitrogen, CA, USA). RNA was reverse transcribed to single-strand cDNA using a Revertaid First Strand cDNA Synthesis kit (MBI Fermentas, Canada) according to the manufacturer's protocol. Reverse transcription was carried out using a PCR kit (Roche, Basel, Switzerland) in a 20 μL reaction containing 2 μg RNA, 50 mM KCl, 50 mM Tris/HCl, 4 mM MgCl2 and 10 mM of dNTPs, oligo-(dT) primers, RNAse inhibitor and MuLV reverse transcriptase. The reaction mixture was incubated for 5 min at 37°C, 60 min at 42°C, and then heated to 70°C for 5 min in a thermocycler (MBI Fermentas, Canada). Quantitative real-time PCR was conducted with a PTC 200 real-time PCR reactor (MJ Research, Fremont, CA, USA) for SYBR green PCR master mix (Takara, Shiga, Japan) according to the manufacturer's protocol. The primers were designed according to the respective gene sequences using the Primer 3 software and were synthesized by Sangon Biotech (China). The PCR primers are shown in Table 2. The PCR conditions were 95°C for 30 s, 95°C for 4 s, 60°C for 1 min and 72°C for 30 s for a total of 42 cycles, with a final extension for 10 min at 72°C. The amplified PCR products were electrophoresed on a 1.5% agarose gel. Relative gene expression quantifications were quantified using Image-QuanT software (Molecular Dynamics, Sunnyvale, CA, USA) and calculated using the comparative Ct method with β-actin as an internal standard. In all cases, each PCR trail was performed with triplicate samples and repeated at least three times.

Table 2. Primers used in this study.

Genes Primer sequences (5’-3’) Length(bp) Annealing(°C)
HSP27 F:CAGTGCGATACGAGCAGGAA 182 60
R:CAGGACTTGGAAGCGGGAT
HSP70 F:GCTGAACCCGCAGAACACG 158 58
R:GCCTTGGTCTCCCCTTTGTAG
HSP90 F:CAAGCAAGATCGAACCCTCAC 174 62
R:GCTGAATAAAACCCGACACCA
CGI-58 F: CATCCAGGGTTAGTCATCTC 189 52
R: GCCTTAAACGCTGTACTAGAC
F: ACTCCACCCCCATAACACGC 165 62
KDF1 R: GGCACTGTCCACAGAGTTCCAGA
β-actin F:AGGCTGTGCTGTCCCTGTATG 207 62
R:GCTCGGCTGTGGTGGTAAA

Western blot detection of HSPs

Total protein was extracted from skin tissues using radioimmunoprecipitation assay lysis buffer and was quantified using the Enhanced BCA protein assay kit (Bio Tek, VT, USA). Briefly, proteins were denatured at 100°C for 5 min and electrophoretically separated on a 10% gel using sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Proteins were transferred onto polyvinylidene fluoride (PVF) membranes, and the membranes were blocked with 5% skim milk powder in Tris-buffered saline containing 0.1% Tween 20 (TBST) at RT for 30 min. The membranes were then incubated with monoclonal anti-HSP27 antibody (Abcam, Mouse ab79868, 1:1000 dilution), polyclonal anti-HSP70 antibody (Abcam, Rabbit ab79852, 1:1000 dilution) and monoclonal anti-HSP90 antibody (Abcam, Mouse ab13492, 1:1000 dilution) at 4°C overnight, respectively. On the following morning, the membranes were incubated with a horseradish peroxidase-conjugated goat anti-mouse IgM whole serum antibody (Bioss, Beijing, bs-0368Gs, anti-mouse, 1:2000 dilution) and goat anti-rabbit IgM antibody (Bioss, Beijing, bs-0295G-HRP, anti-rabbit, 1:2000 dilution). The internal loading control was β-actin. The expression of HSP27 protein was measured using chemiluminescence.

HSPs immunohistochemical staining

Sections were labeled for HSP27 (Abcam, Mouse ab79868, 1:200 dilution), HSP70 (Abcam, Rabbit ab79852, 1:200 dilution) and HSP90 (Abcam, Mouse ab13492, 1:200 dilution) using the streptavidin/peroxidase complex immunostaining technique, respectively. Primary antibodies were incubated for 2 hours at 37°C. The reaction products were formed with diaminobenzidine. Nuclear counterstaining was performed with hematoxylin. Negative controls were obtained by omitting the first-layer antibody.

Measurement and data analysis

Skin thickness was measured using a micrometer. The thickness of the epidermis and dermis was measured using a computerized light microscope (Olympus DP71) and morphometric software (Image-Pro plus 6.0). The epidermis was measured from the free margin of skin to the dermis papillae and epidermis ridge. The dermis was measured in the same way from the epidermis ridge and dermis papillae to the dermal-fat junction [24]. Data were expressed as the mean ± standard deviation (SD). Statistical analysis was performed using the Statistical Package for Social Science software, version 19.0 (SPSS Inc., Chicago, IL, USA). Statistical analysis was primarily conducted using a one-way analysis of variance (ANOVA). A P value of P<0.05 was considered statistically significant.

Results

Histologic characteristics of skin structure

Epidermis

There was no obvious epidermal interpapillary peg in yak skin, but the epidermis appeared undulating from the epidermis of the opening in the hair follicle down to the dermis (Fig 2). The epidermis of hairy skin in yak consisted of four layers: stratum corneum, stratum granulosum, stratum spinosum and stratum basale, whereas the glabrous skin also included stratum lucidum, such as the nasolabial plate and the hooves.

Fig 2. Histological characteristics of skin in yak.

Fig 2

E: epidermis, D: dermis, SEG: sebaceous gland, SW: sweat gland, AP: arrector pili, HF: hair follicle, HB: hair bulb.

The stratum corneum was made of flattened, anucleated, scale-like cells that were fibrous and could easily fall off. The stratum lucidum was a pink uniform band that was found in the planum nasolabiale and was hoof coronal and hoof sphere. The stratum granulosum consisted of one layer of flattened cells, which would be keratinized into the corneum. The depth of the cell layer in the stratum spinosum was varied by age changing. In newborn yak, there were only 1–2 layers, although it increased to 3–4 layers in the half-year-old and adult yak. The stratum basale was made of cubical cells with large nuclei lying perpendicular to the basical membrane (Fig 3A and 3B).

Fig 3. Histological structures of the epidermis in yak.

Fig 3

A. Structures of epidermis in hairy skin of yak, HE ×1000 B. Structures of epidermis in glabrous skin of yak, HE ×400. SC: stratum corneum, SG: stratum granulosum, SS: stratum spinosum, SB: stratum basale, SL: stratum lucidum.

Dermis

The dermis contained the papillary, which was in contact with the epidermis, and reticular layers, which were in contact with the underlying hypodermis. The dermis consisted of numerous fiber types and few cell types and contained numerous blood and lymphatic vessels, nerves, arrector pili, sweat glands, sebaceous glands, hair and hair follicles (Fig 2).

The dermis contained a variable amount of collagen and a few elastic and reticular fibers, which often were intertwined with each other (Fig 4A and 4B). The collagen fibers were arranged in bundles and appeared blue-green using Masson’s trichrome staining (Fig 4A). Compared with the papillary layer, collagen fiber bundles were thicker in the reticular layer. Elastic fibers were primarily located in the papillary dermis and surrounding vessels, which appeared black-green when using WVG staining (Fig 4B). In the hoof, the epidermal lamellae and the dermal lamellae fit together to form a tight junction (Fig 4C). A large number of capillary plexuses was distributed around the boundary between the papillary and reticular layers (Fig 4D). The arrector pili was a thin smooth muscle bundle that was located in the papillary layer and extended up to the epidermis (Fig 2). There was also some adipose tissue in the deep dermis in some body regions such as the hoof sphere (Fig 4E). In yak, few sweat glands were located in the deep dermis, and the secretion was blue-violet by AB-PAS staining (Fig 4F), which meant that the secretion was an acidic-neutral complex that contained many saccharides. Many nasolabial glands were distributed in the dermis of the nasolabial plate, which belonged to the branched tubuloacinar gland (Fig 4G). The sebaceous glands were well developed and distributed around the hair follicles (Fig 4H).

Fig 4. Histological structures of the dermis in yak.

Fig 4

A. Collagen fiber in dermis in yak, Masson’s trichrome ×100 B. Elastic fiber in dermis in yak, WVG ×200 C. Epidermal lamellae and dermal lamellae fit together in hoof in yak, Sacpic ×100 D. Capillary plexus in dermis in yak, Sacpic ×200 E. Adipose tissue in the deep dermis of hoof sphere, HE×40 F. Sweat gland and secretion in deep dermis in yak, AB-PAS ×200 G. Nasolabial glands distributed in the dermis of nasolabial plate, HE ×200 H. Sebaceous gland around the hair follicle in dermis, HE ×400 E: epidermis, D: dermis, CF: collagen fiber, EF: elastic fiber, HF: hair follicle, CP: capillary plexus, EL: epidermal lamellae, DL: dermal lamellae, HT: horn tubule, AC: adipose cell, SW: sweat gland, SD: striated duct, SA: serous alveoli, ID: intercalated duct, ILD: interlobular duct, SEG: sebaceous gland.

Hair follicle

The yak hair was longer and denser than other cattle breeds, and the thickness was different, with hair follicles that were variable in size, were evenly distributed in the papillary and upper reticular layers and often formed in groups. One hair follicle group consisted of one primary follicle (PF) and several secondary follicles (SF), which were accompanied by sebaceous glands. The hair follicle group was surrounded by a connective tissue sheath (CTS) (Fig 5A). The hair follicle was composed of the dermal root sheath (DRS), outer root sheath (ORS) and inner root sheath (IRS) (Fig 5B). The dermal root sheath was made of connective tissue. The outer root sheath possessed 3–4 layers, whereas the inner root sheath was composed of three layers: Henle's layer, Huxley's layer, and an internal cuticle. Specifically, Henle’s layer consisted of one single layer of cubical cells with flattened nuclei, and Huxley’s layer was composed of a cell layer with flattened nuclei. By contrast, the internal cuticle had one cell layer, which had been keratinized.

Fig 5. Histological structures of hair follicle in yak.

Fig 5

A. Hair follicle group consisting of one primary follicle and some secondary follicles and sebaceous gland, HE ×100 B. Structures of hair follicle in yak, Sacpic ×400 SEG: sebaceous gland, SW: sweat gland, HF: hair follicle, CF: collagen fiber, CT: connective tissue, PF: primary follicle, SF: secondary follicle, DRS: dermal root sheath, ORS: outer root sheath, IRS: inner root sheath, HC: hair cortex.

Measurement of skin thickness

In the newborn group, the skin thickness ranged from 624 to 1538 μm; the inguinal region was thinnest (624 μm), and the back and cheek were the thickest (1500–1538 μm) (Tables 3 and 4). The thickness of the epidermis varied from 16.073 to 29.307 μm. The thickness in the lateral crus, cheek and inguinal regions ranged from 16.073 to 17.104 μm. The back, dorsal neck and forehead were relatively thick (21.913–23.584 μm), and the metacarpus was thickest (29.307 μm) (Tables 3 and 4). The thickness of the dermis varied from 389.956 to 948.520 μm, and that in the metatarsus, waist, axilla, lateral crus and the inguinal region ranged from 389.956 to 457.078 μm. The abdomen, dorsal neck and buttock were relatively thick (545.228–683.58 μm), and the back was thickest (948.520 μm) (Tables 3 and 4).

Table 3. Thickness of skin of body regions.

Region Epidermis(μm) Dermis(μm) Skin(μm) E/ (E+D) (%)
newborn half-year-old adult newborn half-year-old adult newborn half-year-old adult newborn half-year-old adult
Forehead 23.584±3.770 28.259±5.909 46.248±9.211 890.758±70.745 1035.519±83.844 1805.675±120.657 1442±22.706 2188±34.254 2910±19.692 2.579 2.656 2.497
Cheek 16.714±3.389 29.050±4.969 39.114±5.116 715.009±71.733 721.014±70.315 1428.367±113.882 1538±33.267 2264±26.331 4640±13.032 2.284 3.873 2.665
Dorsal neck 22.564±5.543 34.372±6.243 44.296±8.768 651.727±109.538 1117.065±98.644 2003.075±223.575 1238±25.733 2364±22.706 4396±96.517 3.346 2.985 2.164
Lateral neck 21.718±4.034 30.406±5.498 57.781±13.830 668.446±67.268 687.223±80.938 1854.609±97.370 1226±32.728 2116±30.984 3946±109.158 3.147 4.237 3.021
Ventral neck 19.958±3.411 26.830±6.317 41.214±6.264 586.189±68.503 897.889±95.699 1969.327±150.976 1306±31.340 2276±30.984 4294±69.314 3.293 2.901 2.050
Withers 19.925±3.543 33.848±7.053 57.794±12.030 459.523±61.167 911.971±106.700 1522.922±104.650 830±31.623 1476±30.984 4360±110 4.156 3.579 3.656
Scapula 16.683±2.499 29.020±5.442 44.677±8.841 475.6021±56.773 624.464±80.910 1166.082±116.810 772±23.476 1286±29.889 2858±66.966 3.389 4.441 3.690
Brachia 19.601±3.536 25.206±6.268 52.813±7.507 680.306±96.137 696.079±117.984 1624.216±78.242 856±15.776 1364±20.656 2440±160 2.800 3.495 3.149
Thorax 19.020±3.900 25.225±5.291 55.437±8.037 470.929±61.390 714.606±59.546 1399.918±105.301 764±20.656 1698±23.944 4376±92.760 3.882 3.410 3.809
Lateral of forearm 19.727±3.361 37.723±9.588 52.334±10.616 681.032±74.897 769.628±133.908 1498.445±167.616 720±21.082 1208±21.499 4064±59.479 2.815 4.672 3.375
Medial of forearm 19.729±3.638 33.415±7.380 50.663±8.255 569.574±69.671 581.731±85.103 1272.893±99.051 678±14.757 1148±21.499 3602±79.134 3.348 5.432 3.828
Metacarpus 29.307±5.684 63.594±22.655 78.276±15.893 636.031±94.067 1125.042±91.652 2181.566±117.097 818±23.944 1490±31.358 5324±65.862 4.405 5.350 3.464
Back 21.913±6.331 38.761±8.852 75.463±17.011 948.520±73.735 1210.813±63.443 2137.316±193.404 1500±249.443 1710±28.674 5934±114.717 2.258 3.102 3.410
Costal region 21.299±4.725 22.458±4.482 59.738±13.051 671.627±79.807 825.890±58.782 1438.027±85.229 884±26.331 1364±26.331 3132±84.958 3.074 2.647 3.988
Waist 20.536±4.077 35.372±7.345 63.847±12.527 443.341±62.320 796.013±94.636 1070.887±52.479 856±26.331 1464±26.331 4214±88.969 4.427 4.255 5.627
Buttock 25.034±6.210 32.513±6.427 49.577±8.090 683.558±111.933 864.660±100.912 1551.509±88.742 1432±23.476 2102±27.406 5088±71.305 3.533 3.624 3.096
Thigh 17.263±2.928 35.843±8.074 36.919±9.242 657.721±62.790 903.122±98.930 1352.018±91.040 760±13.333 1070±23.570 4084±49.710 2.558 3.817 2.658
Abdomen 26.960±7.136 25.973±5.384 44.790±8.235 545.228±64.915 881.225±61.878 1192.921±85.710 1154±23.190 1564±36.271 3106±89.963 4.712 2.863 3.619
Lateral of crus 16.073±3.439 33.289±8.968 47.443±7.790 450.651±43.227 731.228±101.218 1731.467±127.219 804±26.331 1370±25.386 3616±99.688 3.444 4.354 2.667
Inguinal region 17.104±3.541 27.415±5.991 34.211±7.284 457.078±45.998 507.742±57.984 923.596±81.996 624±18.379 976±30.984 2190±54.365 3.607 5.123 3.572
Medial of crus 19.110±3.993 34.908±8.247 44.104±6.188 523.636±62.925 736.896±115.078 1538.386±122.311 720±18.856 1240±18.856 3194±98.905 3.521 4.523 2.787
Metatarsus 24.355±5.684 30.194±10.061 64.585±10.767 389.956±59.511 793.938±71.907 1411.436±548.371 938±22.010 1318±40.497 4802±17.999 5.879 3.664 4.376
Axilla 17.714±4.025 30.201±7.434 43.784±5.653 449.609±71.736 532.978±98.182 826.451±58.989 724±20.656 1170±23.570 2052±73.756 3.791 5.363 5.031

Table 4. Rank order of thickness of skin according to age.

NO. Epidermis(μm) Dermis(μm) Skin(μm)
newborn half-year-old adult newborn half-year-old adult newborn half-year-old adult
1 metacarpus29.307 metacarpus63.594 metacarpus78.276 back948.520 back1210.813 metacarpus2181.566 cheek1538 dorsal neck2364 back5934
2 abdomen26.960 back38.761 back75.463 forehead890.758 metacarpus1125.042 back2137.316 back1500 ventral neck2276 metacarpus5324
3 buttock25.034 lateral of forearm37.723 metatarsus64.585 cheek715.009 dorsal neck1117.065 dorsal neck2003.075 forehead1442 cheek2264 buttock5088
4 metatarsus24.355 thigh35.843 waist63.847 buttock683.558 forehead1035.519 ventral neck1969.327 buttock1432 forehead2188 metatarsus4802
5 forehead23.584 waist35.372 costal region59.738 lateral of forearm681.032 withers911.972 lateral neck1854.609 ventral neck1306 lateral neck2116 cheek4640
6 dorsal neck22.564 medial of crus34.908 withers57.794 brachia680.306 thigh903.122 forehead1805.675 dorsal neck1238 buttock2102 dorsal neck4396
7 back21.913 dorsal neck34.372 lateral neck57.781 costal region671.627 ventral neck897.889 lateral of crus1731.467 lateral neck1226 back1710 thorax4376
8 lateral neck21.718 withers33.848 thorax55.437 lateral neck668.446 abdomen881.225 brachia1624.216 abdomen1154 thorax1698 withers4360
9 costal region21.299 medial of forearm33.415 brachia52.813 thigh657.721 buttock864.660 buttock1551.509 metatarsus938 abdomen1564 ventral neck4294
10 waist20.536 lateral of crus33.289 lateral of forearm52.334 dorsal neck651.727 costal region825.890 medial of crus1538.386 costal region884 metacarpus1490 waist4214
11 ventral neck19.958 buttock32.513 medial of forearm50.663 metacarpus636.031 waist796.013 withers1522.922 brachia856 withers1476 thigh4084
12 withers19.925 lateral neck30.406 buttock49.577 ventral neck586.190 metatarsus793.938 lateral of forearm1498.445 waist856 waist1464 lateral of forearm4064
13 medial of forearm19.729 axilla30.201 lateral of crus47.443 medial of forearm569.574 lateral of forearm769.628 costal region1438.027 withers830 lateral of crus1370 lateral neck3946
14 lateral of forearm19.727 metatarsus30.194 forehead46.248 abdomen545.228 medial of crus736.896 cheek1428.367 metacarpus818 brachia1364 lateral of crus3616
15 brachia19.601 cheek29.050 abdomen44.790 medial of crus523.636 lateral of crus731.228 metatarsus1411.436 lateral of crus804 costal region1364 medial of forearm3602
16 medial of crus19.110 scapula29.020 scapula44.677 scapula475.602 cheek721.014 thorax1399.918 scapula772 metatarsus1318 medial of crus3194
17 Thorax19.020 forehead28.259 dorsal neck44.296 thorax470.929 thorax714.606 thigh1352.018 thorax764 scapula1286 costal region3132
18 axilla17.714 inguinal region27.415 medial of crus44.104 withers459.523 brachia696.079 medial of forearm1272.893 thigh760 medial of crus1240 abdomen3106
19 thigh17.263 ventral neck26.830 axilla43.784 inguinal region457.078 lateral neck687.223 abdomen1192.921 axilla724 lateral of forearm1208 forehead2910
20 inguinal region17.104 abdomen25.973 ventral neck41.214 lateral of crus450.651 scapula624.464 scapula1166.082 lateral of forearm720 axilla1170 scapula2858
21 cheek16.714 thorax25.225 cheek39.114 axilla449.609 medial of forearm581.731 waist1070.887 medial of crus720 medial of forearm1148 brachia2440
22 scapula16.683 brachia25.206 thigh36.919 waist443.341 axilla532.978 inguinal region923.596 medial of forearm678 thigh1070 inguinal region2190
23 lateral of crus16.073 costal region22.458 inguinal region34.211 metatarsus389.956 inguinal region507.742 axilla826.451 inguinal region624 inguinal region976 axilla2052

In the half-year-old group, the skin thickness ranged from 976 to 2364 μm; the inguinal region was thinnest (976 μm), and the cheek, ventral neck and dorsal neck were the thickest (2264–2364 μm) (Tables 3 and 4). The thickness of the epidermis varied from 22.458 to 63.594 μm. The thickness in the costal region, brachia, thorax and abdomen ranged from 22.458 to 25.973 μm. The metatarsus, buttock and dorsal neck were relatively thick (30.194–34.372 μm), and the metacarpus was thickest (63.594 μm) (Tables 3 and 4). The thickness of the dermis varied from 507.742 to 1210.813 μm. The thickness in the inguinal region, axilla and medial region of the forearm ranged from 507.742 to 581.731 μm. The lateral neck, cheek, costal region and thigh were relatively thick (687.223–903.122 μm), and the back was thickest (1210.813 μm) (Tables 3 and 4).

In the adult group, the skin thickness ranged from 2052 to 5934 μm; the axilla and inguinal regions were thinnest (2052 μm, 2190 μm), and the back and metacarpus were thickest (5934 μm, 5324 μm) (Tables 3 and 4). The thickness of the epidermis varied from 34.211 to 78.276 μm, and the thickness in the inguinal region, thigh, cheek and axilla ranged from 34.211 to 43.784 μm. The buttock, thorax, withers and costal region were relatively thick (49.577–59.738 μm); the metacarpus was thickest (78.276 μm) (Tables 3 and 4). The thickness of the dermis varied from 826.451 to 2181.566 μm, and the thickness in the axilla, inguinal region and waist ranged from 826.451 to 1070.887 μm. The abdomen, thorax, cheek and forehead were relatively thick (1192.921–1805.675 μm), and the back and metacarpus were the thickest (2137.316 μm, 2181.566 μm) (Tables 3 and 4).

The epidermis accounted for 2.258–5.879% of the entire skin in the newborn group, 2.647–5.432% in the half-year-old group, and 2.05–5.627% in the adult group (Table 3).

The thicknesses of the epidermis and dermis increased with age from newborn to adult. The age-related thickness changes differed significantly in the newborn, half-year-old and adult groups (Table 5). The differences in thicknesses of both the dermis and the skin were statistically significant among the three age groups (P<0.05), whereas the thicknesses of the epidermis varied among the three groups. In the thorax, back, costal region and abdomen, the thickness of the epidermis showed no significant difference between the newborn and half-year-old group (P>0.05) but was significantly different compared to the adult group (P<0.05).

Table 5. Age differences of thickness of epidermis, dermis and skin.

Region Epidermis(μm) Dermis(μm) Skin(μm)
newborn half-year-old adult newborn half-year-old Adult newborn half-year-old adult
Forehead 23.584c 28.259b 46.248a 890.758c 1035.520b 1805.675a 1442c 2188b 2910a
Cheek 16.714c 29.049b 39.114a 715.009c 721.014b 1428.367a 1538c 2264b 4640a
Dorsal neck 22.564c 34.372b 44.296a 651.727c 1117.065b 2003.075a 1238c 2364b 4396a
Lateral neck 21.718c 30.406b 57.781a 668.446c 687.223b 1854.609a 1226c 2116b 3946a
Ventral neck 19.958c 26.830b 41.214a 586.189c 897.889b 1969.327a 1306c 2276b 4294a
Withers 19.925c 33.848b 57.794a 459.523c 911.972b 1522.922a 830c 1476b 4360a
Scapula 16.683c 29.020b 44.677a 475.602c 624.464b 1166.082a 772c 1286b 2858a
Brachia 19.601c 25.206b 52.813a 680.306c 696.079b 1624.216a 856c 1364b 2440a
Thorax 19.020b 25.225b 55.437a 470.929c 714.606b 1399.918a 764c 1698b 4376a
Lateral of forearm 19.727c 37.723b 52.334a 681.032c 769.628b 1498.445a 720c 1208b 4064a
Medial of forearm 19.729c 33.415b 50.663a 569.574c 581.731b 1272.893a 678c 1148b 3602a
Metacarpus 29.307c 63.594b 78.276a 636.031c 1125.042b 2181.566a 818c 1490b 5324a
Back 21.913b 38.761b 75.463a 948.520c 1210.813b 2137.316a 1500c 1710b 5934a
Costal region 21.299b 22.458b 59.738a 671.627c 825.890b 1438.027a 884c 1364b 3132a
Waist 20.536c 35.372b 63.847a 443.341c 796.013b 1070.887a 856c 1464b 4214a
Buttock 25.034c 32.513b 49.577a 683.558c 864.660b 1551.509a 1432c 2102b 5088a
Thigh 17.263c 35.843b 36.919a 657.721c 903.122b 1352.018a 760c 1070b 4084a
Abdomen 26.960b 25.973b 44.790a 545.228c 881.225b 1192.921a 1154c 1564b 3106a
Lateral of crus 16.073c 33.289b 47.443a 450.651c 731.228b 1731.467a 804c 1370b 3616a
Inguinal region 17.104c 27.415b 34.211a 457.078c 507.742b 923.596a 624c 976b 2190a
Medial of crus 19.110c 34.908b 44.104a 523.636c 736.896b 1538.386a 720c 1240b 3194a
Metatarsus 24.355c 30.194b 64.585a 389.956c 793.938b 1411.436a 938c 1318b 4802a
Axilla 17.714c 30.201b 43.784a 449.609c 532.978b 826.451a 724c 1170b 2052a

Different letters represent that the difference was significant in the same region (p<0.05), the same letter represents that the difference was no significant in the same region (p>0.05

A schema graph was provided to show the changes in adult yak according to the data we obtained (Fig 6).

Fig 6. Schema graphs showing thickness change of skin in adult yak (unit: mm).

Fig 6

Different colors show different thickness over body regions.

Expression of HSP27 in skin during hair cycle

A fluctuation in the relative expression levels of HSP27 mRNA during the hair cycle was shown in Fig 7A. In the hair cycle, the highest level of HSP27 mRNA expression was found during the anagen stage, whereas the lowest expression level was found in the telogen stage. The expression level in the catagen stage was between the anagen and telogen stages. The expression level showed significant difference between anagen and telogen stages (P<0.05) as well as between anagen and catagen stages (P<0.05), but there was no difference between telogen and catagen stages (P>0.05). A similar expression pattern was observed for the HSP27 protein using western blot analysis (Fig 8A and 8B). The highest expression level was seen in the anagen stage, followed by the catagen stage, with the lowest level seen in the telogen stage. The result showed that the HSP27 protein expression levels were significantly different among hair cycle (P<0.05). HSP27 was mainly expressed in the outer root sheath of the secondary follicle during the hair cycle, also expressed in epidermis and sebaceous gland in the skin of yak (Fig 9).

Fig 7. The HSPs gene expressions in skin of yak during hair cycle.

Fig 7

A: HSP27 gene expression in skin. B: HSP70 gene expression in skin. C: HSP90 gene expression in skin. Different letters represent that the difference was significant (p<0.05), the same letter represents that the difference was no significant (p>0.05).

Fig 8. Detection of HSP27, HSP70 and HSP90 expression in skin of yak during hair cycle by Western-blot.

Fig 8

Different letters represent that the difference was significant (p<0.05), the same letter represents that the difference was no significant (p>0.05).

Fig 9. Immunohistochemical staining of HSP27 in skin of yak during hair cycle.

Fig 9

A, B: HSP27 expressed in the epidermis and the outer root sheath of secondary follicle. C. negative control. Arrows show the immunostained products as brown deposits. ×400.

Expression of HSP70 in skin during hair cycle

A fluctuation in the relative expression levels of HSP70 mRNA during the hair cycle was shown in Fig 7B. In the hair cycle, the highest level of HSP70 mRNA expression was found during the telogen stage, whereas the lowest expression level was found in the catagen stage. The expression level in the anagen stage was between the telogen and catagen stages. There was no significant difference among three stages (P>0.05). A similar expression pattern was observed for the HSP70 protein using western blot analysis (Fig 8A and 8C). The highest expression level was seen in the telogen stage, followed by the anagen stage, with the lowest level seen in the catagen stage. However, there was significant difference of HSP70 protein expression levels among three stages (P<0.05). HSP70 protein expression was observed in the epidermis, sebaceous gland, sweat gland and outer root sheath of hair follicle in the skin (Fig 10).

Fig 10. Immunohistochemical staining of HSP70 in skin of yak during hair cycle.

Fig 10

A, B: HSP70 expressed in the epidermis, sebaceous gland, sweat gland and the outer root sheath of hair follicle. C. negative control. Arrows show the immunostained products as brown deposits. ×400.

Expression of HSP90 in skin during hair cycle

A fluctuation in the relative expression levels of HSP90 mRNA during the hair cycle was shown in Fig 7C. In the hair cycle, the highest level of HSP90 mRNA expression was found during the anagen stage, whereas the lowest expression level was found in the catagen stage. The expression level in the telogen stage was between the anagen and catagen stages. There was no significant difference among three stages (P>0.05). A similar expression pattern was observed for the HSP90 protein using western blot analysis (Fig 8A and 8D). The highest expression level was seen in the anagen stage, followed by the telogen stage, with the lowest level seen in the catagen stage. The expression levels of HSP90 protein showed significant difference between anagen and telogen stages (P<0.05) as well as between anagen and catagen stages (P<0.05), but there was no difference between telogen and catagen stages (P>0.05). HSP90 protein expression was observed in the epidermis, sebaceous gland and hair root sheath in the skin (Fig 11).

Fig 11. Immunohistochemical staining of HSP90 in skin of yak during hair cycle.

Fig 11

A, B: HSP90 expressed in the epidermis, sebaceous gland and hair root sheath. C. negative control. Arrows show the immunostained products as brown deposits. ×400.

Expression of CGI-58 (ABHD5) in skin during hair cycle

A fluctuation in the relative expression levels of CGI-58 mRNA during the hair cycle was shown in Fig 12. In the hair cycle, the highest level of CGI-58 mRNA expression was found during the anagen stage, whereas the lowest expression level was found in the telogen stage. The expression level in the catagen stage was between the anagen and telogen stages. The expression level showed significant difference between anagen and telogen stages (P<0.05) as well as between anagen and catagen stages (P<0.05), but there was no difference between telogen and catagen stages (P>0.05).

Fig 12. The CGI-58 gene expressions in skin of yak during hair cycle.

Fig 12

Expression of KDF1 in skin during hair cycle

A fluctuation in the relative expression levels of KDF1 mRNA during the hair cycle was shown in Fig 13. In the hair cycle, the highest level of KDF1 mRNA expression was found during the telogen stage, whereas the lowest expression level was found in the anagen stage. The expression level in the catagen stage was between the telogen and anagen stages. The expression level showed significant difference between telogen and anagen stages (P<0.05) as well as between telogen and catagen stages (P<0.05), but there was no difference between catagen and anagen stages (P>0.05).

Fig 13. The KDF1 gene expressions in skin of yak during hair cycle.

Fig 13

Discussion

Modified method

To observe the histological structure of the hair follicle clearly, we used the Sacpic stain method, which was well suited for the visual assessment of follicle activity because it accentuates the inner root sheath. Tissue types were clearly defined. Results: nuclei, dark blue; keratin, yellow; collagen, blue; inner root sheath, bright red; outer root sheath, pale green; smooth muscle, green [42].

The shrinkage effect is the most important problem to prevent when measuring skin thickness. As soon as we harvested the skin, we fixed it to a paperboard by putting pins into the four corners and stored it in 4% paraformaldehyde solution. We believe that this procedure could prevent most of the shrinkage effect in the transverse plane.

Histologic characteristics of skin structure

We confirmed that yak skin is composed of two layers: the epidermis and dermis. The total epidermis of the hairy skin consisted of the stratum corneum and the viable epidermis (stratum basale, stratum spinosum, stratum granulosum). The pelt was composed of compound hair follicles, which produced a primary and some secondary hair follicles. Associated with each primary follicle, there was an arrector pili muscle, a multilobular sebaceous gland, and a coiled tubular sweat gland. The difference between the primary and secondary follicles was that the primary follicles had their own sweat glands but that the secondary follicles did not bear sweat glands [43]. We confirmed that the yak hair follicle group consisted of one primary follicle and several secondary follicles, which was similar to that found in ferrets [19] but different from Iranian sheep breeds [43], Camelus dromedaries [44], Australian cashmere goat [45], llama [17] and sheep [18]. The sweat glands in yaks are not well developed. Sweat secretion does not occur readily, thereby reducing the heat radiation surface. This appears to force the animal to retain heat in the body and helps increase its tolerance to cold [46].

Age-rated thickness change

In this study, we first measured the skin thickness of different ages and in different regions of yak. Skin thickness varied in different regions of the body surface in yak. The thickest-haired skin was present on the cheek, forehead, dorsal neck and ventral neck in the newborn and half-year-old groups. The thinnest part in the newborn and half-year-old groups was the inguinal region. The thickest haired skin was present on the back, followed by the metacarpus and buttocks in the adult group. The thinnest haired skin in the adult group was the inguinal region and the axilla. In a group of newborn and half-year-old yak, the area around the head, cheek and neck were thicker than other parts of the body surface, which was similar to llama [17]. The thickest location was the back in the adults, which corresponds to equine skin [21] and had previously reported in yak [46], perhaps because the back is the part of the body that is most exposed to wind, rain and snow. Yak skin thickness decreased dorsally to ventrally on the trunk. This pattern of skin thickness change was typical of most domestic large animals [47]. In yak, the skin on the lateral surface was thicker than the skin on the medial surface in the limbs.

The total thickness increased with age. Previous researchers noted that sunlight appears to have a considerable effect on the thickness and physical properties of skin [48,49]. Collagen was a major component of skin, and the age-related changes in thickness correlate well with skin collagen content [50]. The significant change in the epidermis in adults was obvious. The corneum layer increased with age, which was similar to the reports of Mugale [51].

Knowledge of skin thickness in yak may be useful in harvesting full- or split-thickness skin grafts to produce leather. Moreover, these results were useful for studying the relation between age-related thickness changes of skin and the living environment.

Expression of HSPs in skin during hair cycle

This study reported for the first time the expression patterns of HSP27, HSP70 and HSP90 in skin during the hair cycle in yak. The HSP27 protein expression in the epidermis suggested that this protein may be useful for keratinocyte cell growth and regeneration, which concurs with previous studies [28–32]. In human epidermal keratinocytes, the expression of HSP27 was closely related to differentiation both in vitro and in situ [52]. HSP27 and p38-MAPK serve essential functions in the maintenance of the epidermal structure, and HSP27 was associated with keratinocyte differentiation [53]. Moreover, the expression of HSP27 in the epidermis showed that HSP27 may be the target for immune response and could protect against pathogens [25,26,54–56].

The highest expression of HSP27 during anagen and its weak expression in catagen and telogen agreed with the results in the mouse model [57]. The expression pattern suggested HSP27 may be involved in the hair follicle cellular cycle [58]. HSP27 expression in the hair cycle could be related to both keratinocyte differentiation and apoptosis in the hair follicle. HSP27 may promote and prolong anagen by protecting hair follicle keratinocytes against apoptosis [59]. Numerous studies have shown that HSP27 inactivates the caspase cascade by binding with caspase-3 and cytochrome C released from mitochondria and that it thus prevents apoptosis [60–62]. The weak expression of HSP27 in catagen and telogen may be followed by the process of terminal differentiation and apoptosis of the keratinocyte. HSP27 could mediate this process by inducing some growth factors, such as FGF. In general, the expression pattern suggested that HSP27 expression may correlate with the level of differentiation of the keratinocytes and the level of keratinization of the outer root sheath.

The predominant expression in epidermis of HSP70 and HSP90 protein as well as HSP27 suggested that they may also involve in keratinocyte cell growth and differentiation. HSP70 played an important role in cell apoptosis. In testis, ablation of HSP70 isoform resulted in germ cell apoptosis [63]. HSP90 was known as a molecular chaperone and had other functions. HSP90 can control cell proliferation by stabilizing the client proteins N-RAS and B-RAF [64,65]. The HSP90 protein was weakly expressed in all hair cycle stages compared with HSP27 and HSP70. This result agreed with Wilson’s study [66]. Although HSP90 was abundantly expressed in other tissues, it was not largely present in skin [39]. The mRNA expression levels of HSP70 and HSP90 showed no difference among three stages, but both of the two protein expression levels showed significant difference in all three stages, we believed that it related to the process of transcription regulation and would study deeply on this part. Otherwise, it may also be related to the interaction between HSPs proteins.

This study had demonstrated the expression pattern of HSP27, HSP70 and HSP90 in yak skin during hair cycle. All of three HSP proteins were involved in the hair follicle cellular cycle and may related with cell apoptosis. However, the different expression patterns suggested that the function of each HSP protein was various. Our further research at this moment may give a definite mechanism next.

Expression of CGI-58 and KDF1 in skin during hair cycle

We also detected the mRNA expression levels of CGI-58 and KDF1 in skin during the hair cycle in yak. CGI-58 showed the same expression pattern with HSP27 in mRNA level. The expression of CGI-58 mRNA in the anagen stage was the highest, followed by the catagen stage, and the expression in the telogen stage was the lowest. CGI-58 mRNA expression was up-regulated concomitantly with both epidermal stratification and keratinocyte differentiation [67]. The same pattern in skin during the hair cycle in yak suggested both CGI-58 and HSP27 were involved in keratinocyte differentiation in hair follicles. The expression of KDF1 mRNA was contrary to CGI-58.

The highest level was in the telogen stage, followed by the catagen stage, and the expression in the anagen stage was the lowest. KDF1 was expressed in epidermal progenitor cells and the progeny where it curbed proliferation as well as blocked proliferation and promoted differentiation [68]. The cycle-dependent expression of KDF1 suggested it may be relate to the proliferation state of hair follicle keratinocytes.

Data Availability

All relevant data are within the paper.

Funding Statement

Support was provided by The National Natural Science Foundation of China (Grant number: 31360594) received by Yan Cui.

References

  • 1.Cui Y, Yu SJ (1999) An anatomical study of the internal genital organs of the yak at different ages. Vet J 157: 192–196. 10.1053/tvjl.1998.0283 [DOI] [PubMed] [Google Scholar]
  • 2.Cui Y, Yu SJ (1999) Ovarian morphology and follicular systems in yaks of different ages. Vet J 157: 197–205. 10.1053/tvjl.1998.0282 [DOI] [PubMed] [Google Scholar]
  • 3.Liu B, Cui Y, Yang B, Fan J, Zhao Z, Yu SJ. (2010) Morphometric analysis of yak placentomes during gestation. Anat Rec (Hoboken) 293: 1873–1879. [DOI] [PubMed] [Google Scholar]
  • 4.Yu SJ, Yong YH, Cui Y (2010) Oocyte morphology from primordial to early tertiary follicles of yak. Reprod Domest Anim 45: 779–785. 10.1111/j.1439-0531.2009.01347.x [DOI] [PubMed] [Google Scholar]
  • 5.Yu SJ, Huang YM, Chen BX (1993) Reproductive patterns of the yak. I. Reproductive phenomena of the female yak. Br Vet J 149: 579–583. 10.1016/S0007-1935(05)80042-9 [DOI] [PubMed] [Google Scholar]
  • 6.Yu SJ, Chen BX (2000) Peripheral plasma concentrations of luteinizing hormone, oestradiol-17beta and progesterone around oestrus in six yaks. Vet J 160: 157–161. 10.1053/tvjl.2000.0494 [DOI] [PubMed] [Google Scholar]
  • 7.Yu SJ, Li FD (2001) Profiles of plasma progesterone before and at the onset of puberty in yak heifers. Anim Reprod Sci 65: 67–73. [DOI] [PubMed] [Google Scholar]
  • 8.JiangFeng F, Jiu YS, Wen ZZ, Ben L (2011) The expression of Fas/FasL and apoptosis in yak placentomes. Anim Reprod Sci 128: 107–116. 10.1016/j.anireprosci.2011.09.008 [DOI] [PubMed] [Google Scholar]
  • 9.Yang B, Yu S, Cui Y, He J, Jin X, Wang R. (2010) Morphological analysis of the lung of neonatal yak. Anat Histol Embryol 39: 138–151. 10.1111/j.1439-0264.2009.00988.x [DOI] [PubMed] [Google Scholar]
  • 10.Yang B, Yu S, Cui Y, He J, Jin X, Wang R. (2010) Histochemical and ultrastructural observations of respiratory epithelium and gland in yak (Bos grunniens). Anat Rec (Hoboken) 293: 1259–1269. [DOI] [PubMed] [Google Scholar]
  • 11.Zhou J, Yu S, He J, Cui Y (2013) Segmentation features and structural organization of the intrapulmonary artery of the yak. Anat Rec (Hoboken) 296: 1775–1788. [DOI] [PubMed] [Google Scholar]
  • 12.He YY, Yu SJ, Cui Y, Du P (2010) Morphological study on microvasculature of left ventricular wall in infant and adult yaks. Anat Rec (Hoboken) 293: 1519–1526. [DOI] [PubMed] [Google Scholar]
  • 13.Duan D, Yu S, Cui Y (2012) Morphological study of the sinus node and its artery in yak. Anat Rec (Hoboken) 295: 2045–2056. [DOI] [PubMed] [Google Scholar]
  • 14.He Y, Yu S, Hu J, Cui Y, Liu P (2016) Changes in the Anatomic and Microscopic Structure and the Expression of HIF-1alpha and VEGF of the Yak Heart with Aging and Hypoxia. PLoS One 11: e0149947 10.1371/journal.pone.0149947 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Qian Z, Yu SJ, He J, Cui Y (2013) Morphologycal Observation of Age-Associated Changes in the Thymus of the Yak. Acta Veterinaria et Zootechnica Sinica 44: 6. [Google Scholar]
  • 16.Xin-Hua K, Cui Y, He J (2014) Characteristics of Spleen Structure in Plateau Yak. Acta Veterinaria et Zootechnica Sinica 45: 5. [Google Scholar]
  • 17.Atlee BA, Stannard AA, Fowler ME, Wiliemse T, Ihrke PJ, Olivry T. (1997) The histology of normal llama skin. Veterinary Dermatology: 12. [DOI] [PubMed] [Google Scholar]
  • 18.Lyne AG, Hollis DE (1968) The skin of the sheep: a comparison of body regions. Aust J Biol Sci 21: 499–527. [DOI] [PubMed] [Google Scholar]
  • 19.Martin AL, Irizarry-Rovira AR, Bevier DE, Glickman LG, Glickman NW, Hullinger RL. (2007) Histology of ferret skin: preweaning to adulthood. Vet Dermatol 18: 401–411. 10.1111/j.1365-3164.2007.00627.x [DOI] [PubMed] [Google Scholar]
  • 20.Donald GL, Schmidt-Nielsen k (1962) The skin, sweat glands and hair follicles of the camal (camelus dromedarius). Anat Rec 143: 7. [Google Scholar]
  • 21.Volkering ME (2009) Variation of skin thickness over the equine body and the correlation between skin fold measurement and actual skin thickness: University of Wageningen. [Google Scholar]
  • 22.Branchet MC, Boisnic S, Frances C, Robert AM (1990) Skin thickness changes in normal aging skin. Gerontology 36: 28–35. [DOI] [PubMed] [Google Scholar]
  • 23.Whitton JT, Everall JD (1973) The thickness of the epidermis. Br J Dermatol 89: 467–476. [DOI] [PubMed] [Google Scholar]
  • 24.Lee Y, Hwang K (2002) Skin thickness of Korean adults. Surg Radiol Anat 24: 183–189. 10.1007/s00276-002-0034-5 [DOI] [PubMed] [Google Scholar]
  • 25.Morris SD (2002) Heat shock proteins and the skin. Clin Exp Dermatol 27: 220–224. [DOI] [PubMed] [Google Scholar]
  • 26.Trautinger F (2001) Heat shock proteins in the photobiology of human skin. J Photochem Photobiol B 63: 70–77. [DOI] [PubMed] [Google Scholar]
  • 27.Sugiyama Y, Suzuki A, Kishikawa M, Akutsu R, Hirose T, Wayer MY, et al. (2000) Muscle develops a specific form of small heat shock protein complex composed of MKBP/HSPB2 and HSPB3 during myogenic differentiation. J Biol Chem 275: 1095–1104. [DOI] [PubMed] [Google Scholar]
  • 28.Kindas-Mügge I, Riedler C, Fröhlich I, Micksche M, Trautinger F (2002) CHARACTERIZATION OF PROTEINS ASSOCIATED WITH HEAT SHOCK PROTEIN HSP27 IN THE SQUAMOUS CELL CARCINOMA CELL LINE A431. Cell Biology International 26: 109–116. 10.1006/cbir.2001.0822 [DOI] [PubMed] [Google Scholar]
  • 29.Trautinger F, Trautinger I, Kindas-Mugge I, Metze D, Luger TA (1993) Human keratinocytes in vivo and in vitro constitutively express the 72-kD heat shock protein. J Invest Dermatol 101: 334–338. [DOI] [PubMed] [Google Scholar]
  • 30.Trautinger F, Kindas-Mugge I, Dekrout B, Knobler RM, Metze D (1995) Expression of the 27-kDa heat shock protein in human epidermis and in epidermal neoplasms: an immunohistological study. Br J Dermatol 133: 194–202. [DOI] [PubMed] [Google Scholar]
  • 31.Trautinger F, Kindås-Mügge I, Knobler RM, Hönigsmann H (1996) Stress proteins in the cellular response to ultraviolet radiation. Journal of Photochemistry and Photobiology B: Biology 35: 141–148. [DOI] [PubMed] [Google Scholar]
  • 32.Trautinger F, Knobler RM, Honigsmann H, Mayr W, Kindas-Mugge I (1996) Increased expression of the 72-kDa heat shock protein and reduced sunburn cell formation in human skin after local hyperthermia. J Invest Dermatol 107: 442–443. [DOI] [PubMed] [Google Scholar]
  • 33.Jantschitsch C, Kindas-Mugge I, Metze D, Amann G, Micksche M, Trautinger F. (1998) Expression of the small heat shock protein HSP 27 in developing human skin. Br J Dermatol 139: 247–253. [DOI] [PubMed] [Google Scholar]
  • 34.Jaattela M (1999) Heat shock proteins as cellular lifeguards. Ann Med 31: 261–271. [DOI] [PubMed] [Google Scholar]
  • 35.Beckmann RP, Mizzen LE, Welch WJ (1990) Interaction of Hsp 70 with newly synthesized proteins: implications for protein folding and assembly. Science 248: 850–854. [DOI] [PubMed] [Google Scholar]
  • 36.Murakami H, Pain D, Blobel G (1988) 70-kD heat shock-related protein is one of at least two distinct cytosolic factors stimulating protein import into mitochondria. J Cell Biol 107: 2051–2057. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Shi Y, Thomas JO (1992) The transport of proteins into the nucleus requires the 70-kilodalton heat shock protein or its cytosolic cognate. Mol Cell Biol 12: 2186–2192. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Zylicz M, King FW, Wawrzynow A (2001) Hsp70 interactions with the p53 tumour suppressor protein. Embo j 20: 4634–4638. 10.1093/emboj/20.17.4634 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Whitesell L, Lindquist SL (2005) HSP90 and the chaperoning of cancer. Nat Rev Cancer 5: 761–772. 10.1038/nrc1716 [DOI] [PubMed] [Google Scholar]
  • 40.Taipale M, Jarosz DF, Lindquist S (2010) HSP90 at the hub of protein homeostasis: emerging mechanistic insights. Nat Rev Mol Cell Biol 11: 515–528. 10.1038/nrm2918 [DOI] [PubMed] [Google Scholar]
  • 41.Normant E, Paez G, West KA, Lim AR, Slocum KL, Tuney C, et al. (2011) The Hsp90 inhibitor IPI-504 rapidly lowers EML4-ALK levels and induces tumor regression in ALK-driven NSCLC models. Oncogene 30: 2581–2586. 10.1038/onc.2010.625 [DOI] [PubMed] [Google Scholar]
  • 42.Nixon AJ (1993) A method for determining the activity state of hair follicles. Biotech Histochem 68: 316–325. [DOI] [PubMed] [Google Scholar]
  • 43.Ansari-Renani HR, Moradi S, Baghershah HR, Ebadi Z, Salehi M. (2011) Determination of Wool Follicle Characteristics of Iranian Sheep Breeds. Asian-Aust J Anim Sci 24: 5. [Google Scholar]
  • 44.Ansari-Renani HR (2008) Seasonal hair follicle cycle of Camelus dromedarius. Pak J Biol Sci 11: 410–415. [DOI] [PubMed] [Google Scholar]
  • 45.Parry AL, Norton BW, Restall BJ (1992) Skin Follicle Development in the Australian Cashmere Goat. Aust J Agric Res 43: 14. [Google Scholar]
  • 46.Zhang RC, Zhao XC (2000) Ecology and Biology of Yak Living in Qinghai-Tibetan Plateau In: Recent Advances in Yak Reproduction. Ithaca. [Google Scholar]
  • 47.DW S (1988) Large Animal Dermatology. Philadelphia: W. B. Saunders. [Google Scholar]
  • 48.Leveque JL, Porte G, Rigal J (1988) Influence of chronic sun exposure on some biophysical parameters of the human skin: an in vivo study. Cutan Ageing Cosmet Dermatol 1: 13. [Google Scholar]
  • 49.Takema Y, Yorimoto Y, Kawai M, Imokawa G (1994) Age-related changes in the elastic properties and thickness of human facial skin. Br J Dermatol 131: 641–648. [DOI] [PubMed] [Google Scholar]
  • 50.Shuster S, Black MM, McVitie E (1975) The influence of age and sex on skin thickness, skin collagen and density. Br J Dermatol 93: 639–643. [DOI] [PubMed] [Google Scholar]
  • 51.Mugale RR, Bholse NS (2002) Thickness of epidermis in Denoi Cattle. Indian Vet J 79: 3. [Google Scholar]
  • 52.Kindas-Mugge I, Trautinger F (1994) Increased expression of the M(r) 27,000 heat shock protein (hsp27) in in vitro differentiated normal human keratinocytes. Cell Growth Differ 5: 777–781. [PubMed] [Google Scholar]
  • 53.Jonak C, Mildner M, Klosner G, Paulitschke V, Kunstfeld R, Pehamberger H, et al. (2011) The hsp27kD heat shock protein and p38-MAPK signaling are required for regular epidermal differentiation. J Dermatol Sci 61: 32–37. 10.1016/j.jdermsci.2010.10.009 [DOI] [PubMed] [Google Scholar]
  • 54.Maytin EV (1995) Heat shock proteins and molecular chaperones: implications for adaptive responses in the skin. J Invest Dermatol 104: 448–455. [DOI] [PubMed] [Google Scholar]
  • 55.Srivastava P (2004) Heat shock proteins and immune response: methods to madness. Methods 32: 1–2. [DOI] [PubMed] [Google Scholar]
  • 56.Yusuf N, Nasti TH, Huang CM, Huber BS, Jaleel T, Lin HY, et al. (2009) Heat shock proteins HSP27 and HSP70 are present in the skin and are important mediators of allergic contact hypersensitivity. J Immunol 182: 675–683. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Hashizume H, Tokura Y, Takigawa M, Paus R (1997) Hair cycle-dependent expression of heat shock proteins in hair follicle epithelium. Int J Dermatol 36: 587–592. [DOI] [PubMed] [Google Scholar]
  • 58.Commo S, Gaillard O, Bernard BA (2000) The human hair follicle contains two distinct K19 positive compartments in the outer root sheath: a unifying hypothesis for stem cell reservoir? Differentiation 66: 157–164. 10.1046/j.1432-0436.2000.660401.x [DOI] [PubMed] [Google Scholar]
  • 59.Hightower LE (1991) Heat shock, stress proteins, chaperones, and proteotoxicity. Cell 66: 191–197. [DOI] [PubMed] [Google Scholar]
  • 60.Acunzo J, Katsogiannou M, Rocchi P (2012) Small heat shock proteins HSP27 (HspB1), αB-crystallin (HspB5) and HSP22 (HspB8) as regulators of cell death. The International Journal of Biochemistry & Cell Biology 44: 1622–1631. [DOI] [PubMed] [Google Scholar]
  • 61.Schmitt E, Gehrmann M, Brunet M, Multhoff G, Garrido C (2007) Intracellular and extracellular functions of heat shock proteins: repercussions in cancer therapy. J Leukoc Biol 81: 15–27. 10.1189/jlb.0306167 [DOI] [PubMed] [Google Scholar]
  • 62.Voss OH, Batra S, Kolattukudy SJ, Gonzalez-Mejia ME, Smith JB, Doseff AL. (2007) Binding of caspase-3 prodomain to heat shock protein 27 regulates monocyte apoptosis by inhibiting caspase-3 proteolytic activation. J Biol Chem 282: 25088–25099. 10.1074/jbc.M701740200 [DOI] [PubMed] [Google Scholar]
  • 63.Dix DJ, Allen JW, Collins BW, Mori C, Nakamura N, Poorman-Allen P, et al. (1996) Targeted gene disruption of Hsp70-2 results in failed meiosis, germ cell apoptosis, and male infertility. Proc Natl Acad Sci U S A 93: 3264–3268. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.Maloney A, Workman P (2002) HSP90 as a new therapeutic target for cancer therapy: the story unfolds. Expert Opin Biol Ther 2: 3–24. 10.1517/14712598.2.1.3 [DOI] [PubMed] [Google Scholar]
  • 65.Calapre L, Gray ES, Ziman M (2013) Heat stress: a risk factor for skin carcinogenesis. Cancer Lett 337: 35–40. 10.1016/j.canlet.2013.05.039 [DOI] [PubMed] [Google Scholar]
  • 66.Wilson N, McArdle A, Guerin D, Tasker H, Wareing P, Foster CS, et al. (2000) Hyperthermia to normal human skin in vivo upregulates heat shock proteins 27, 60, 72i and 90. J Cutan Pathol 27: 176–182. [DOI] [PubMed] [Google Scholar]
  • 67.Akiyama M, Sakai K, Takayama C, Yanagi T, Yamanaka Y, McMillan JR, et al. (2008) CGI-58 is an alpha/beta-hydrolase within lipid transporting lamellar granules of differentiated keratinocytes. Am J Pathol 173: 1349–1360. 10.2353/ajpath.2008.080005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Lee S, Kong Y, Weatherbee SD (2013) Forward genetics identifies Kdf1/1810019J16Rik as an essential regulator of the proliferation-differentiation decision in epidermal progenitor cells. Dev Biol 383: 201–213. 10.1016/j.ydbio.2013.09.022 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All relevant data are within the paper.


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES