Induction of Gα_s Contributes to the Paradoxical Stimulation of Cytosolic Phospholipase A_2α Expression by Cortisol in Human Amnion Fibroblasts

Abstract

Cytosolic phospholipase A (cPLA_2α) catalyzes the formation of arachidonic acid in prostaglandin synthesis. In contrast to the well-described down-regulation of cPLA_2α, up-regulation of cPLA_2α by glucocorticoids has been reported in human amnion fibroblasts, which may play a key role in parturition. The mechanisms underlying this paradoxical induction of cPLA_2α by glucocorticoids remain largely unknown. Using cultured human amnion fibroblasts, we found that the induction of cPLA_2α by cortisol required ongoing transcription and synthesis of at least one other protein. The induction of cPLA_2α by cortisol was abolished by mutagenesis of a glucocorticoid response element (GRE) in the promoter. The same GRE was found mediating the classical inhibition of cPLA_2α expression by cortisol in human fetal lung fibroblasts (HFL-1). Cortisol increased Gα_s expression in amnion fibroblasts but not in HFL-1 cells. Inhibition of Gα_s with NF449 attenuated the phosphorylation of cAMP response element-binding protein-1 (CREB-1) and the induction of cPLA_2α by cortisol in amnion fibroblasts. Both glucocorticoid receptor (GR) and CREB-1 were found bound to the GRE upon cortisol stimulation of amnion fibroblasts. The induction of cPLA_2α by cortisol was blocked by GR antagonist RU486 or protein kinase A inhibitor H89 or dominant-negative CREB-1. In conclusion, cortisol activates the cAMP/protein kinase A/CREB-1 pathway via Gα_s induction, and the phosphorylated CREB-1 interacts with GR at the GRE to promote cPLA_2α expression in amnion fibroblasts.

Glucocorticoids activate cAMP/PKA/CREB pathway via induction of Gαs, and the phosphorylated CREB interacts with GR at target glucocorticoid response elements to increase cPLA₂α expression in human amnion.

Preterm delivery (<37 completed weeks of gestation) occurs in approximately 10% of all pregnancies but accounts for more than 75% of the perinatal mortality and morbidity rate (1, 2). Despite progress in this field, the lack of identification of the mechanisms of human parturition has limited the specific and effective diagnosis and treatment of preterm labor and subsequent birth. Activation of prostaglandin (PG) synthesis, especially of PGE₂ and PGF_2α, in the intrauterine tissues toward term, has been identified as one of the final events leading to parturition (3, 4). PGs induce cervical ripening, fetal membrane rupture, and myometrial contraction at term (3, 4). Among the intrauterine tissues, the amnion, amnion fibroblasts in particular, produces most of the PGs toward term and during labor (5, 6, 7). In most mammalian species including humans, there is an increase in glucocorticoid concentration in the maternal and fetal circulations as well as in the amniotic fluid toward the end of gestation and at the onset of labor (8, 9). This surge of glucocorticoid is believed to be crucial to the maturation of fetal organs as well as to be integral to the cascade of events in the initiation and maintenance of labor (8). This concurrent increase in glucocorticoids and PGs toward the end of gestation displays a paradoxical phenomenon contradicting the classical relationship between these two classes of hormones involved in inflammation. The cascade of reactions for the synthesis of PGs involves a number of enzymes. The initial reaction catalyzed by cytosolic phospholipase A_2α (cPLA_2α) provides the rate-limiting substrate, arachidonic acid (10), for conversion to PG endoperoxide by the inducible cyclooxygenase-2 (COX-2). As a well-described antiinflammatory hormone, glucocorticoid exerts potent inhibition on PG synthesis by inhibiting the expression of cPLA_2α and COX-2 at most sites in the body (11, 12, 13). However, we and others have shown that glucocorticoids can potently stimulate PG output by inducing the expression of cPLA_2α and COX-2 in amnion fibroblasts (6, 7, 14, 15). The mechanisms underlying the paradoxical induction of cPLA_2α and COX-2 by glucocorticoids remain, however, largely unknown. Recently, we found that glucocorticoids stimulated COX-2 expression via activation of the cAMP/ protein kinase A (PKA)/cAMP response element (CRE)-binding protein-1 (CREB-1) pathway by inducing an unknown protein in human amnion fibroblasts (16).

Consistent with the capability of PG synthesis, cPLA_2α is expressed in greater abundance in the fetal membranes among the intrauterine tissues (17). In the amnion, cPLA_2α activity has been shown to increase with gestation age, being highest at term before labor but then depleted during labor (18). Moreover, cPLA_2α knockout female mice fail to labor at term (19). All these findings point to the crucial role of cPLA_2α in parturition. Thus, understanding the molecular mechanisms underlying the paradoxical induction of cPLA_2α by cortisol may help us better understand the events leading to parturition. In this study, we investigated the cis element, trans-acting factor mediating the induction of cPLA_2α expression by cortisol and identified the protein induced by cortisol that is involved in the induction of both cPLA_2α and COX-2 expression.

Results

Glucocorticoid receptor (GR)-mediated induction of cPLA_2α expression by cortisol via induction of mRNA transcription and de novo protein synthesis in human amnion fibroblasts

Analysis with quantitative real-time PCR (qRT-PCR) and Western blotting showed that treatment of cultured human amnion fibroblasts with cortisol (0.01–1 μm, 24 h) caused a concentration-dependent increase in cPLA_2α mRNA and protein levels, which was blocked by GR antagonist RU486 (1 μm) (Fig. 1, A and B). Treatment of the cells with mRNA transcription inhibitor 5,6- dichlorobenzimidazole riboside (DRB, 75 μm) or with protein synthesis inhibitor cycloheximide (CHX, 10 μm) attenuated significantly the induction of cPLA_2α mRNA expression by cortisol (1 μm, 24 h) (Fig. 1, C and D). These results suggest that the induction of cPLA_2α mRNA transcription is a GR-mediated process via the induction of the synthesis of at least one other protein. To verify the paradoxical induction of cPLA_2α expression by cortisol specific to human amnion fibroblasts, we also carried out a control study in human fetal lung fibroblasts (HFL-1), an immortalized cell line. In contrast to the amnion fibroblasts, cortisol (1 μm) treatment of the HFL-1 cells caused a significant reduction in cPLA_2α mRNA and protein levels (Fig. 2, A and B).

Fig. 1.

A and B, Concentration-dependent stimulation of cPLA_2α mRNA and protein expression by cortisol, which could be blocked by GR antagonist RU486 in human amnion fibroblasts. The top panel of B is a representative immunoblot; bottom panel shows the mean data. C and D, The stimulation of cPLA_2α mRNA expression by cortisol (1 μm) was blocked by mRNA transcription inhibitor DRB (75 μm) and protein synthesis inhibitor CHX (10 μm) in human amnion fibroblasts. n = 3–7. *, P < 0.05; **, P < 0.01 vs. vehicle control; #, P < 0.05 vs. cortisol without RU486.

Fig. 2.

A and B, Inhibition of cPLA_2α mRNA and protein expression by cortisol (F, 1 μm) in HFL-1 cells. The top panel of B is the representative immunoblot; bottom panel shows the mean data. C, Inhibition of cPLA_2α promoter (−505 bp) activity by cortisol (F, 1 μm) could be diminished either by introduction of triple-nucleotide mutations (−505mut) into the putative GRE at −485 to −490 bp or by complete removal of the GRE as −458 bp in HFL-1 cells. D, Cortisol (F, 1 μm) treatment did not affect the expression of Gα_s protein in HFL-1 cells. The top panel of D is the representative immunoblot; bottom panel shows the mean data. n = 3–4. *, P < 0.05 vs. control (Ctr). E, ChIP demonstrated that cortisol (1 μm) caused no obvious binding of CREB to the GRE in the cPLA_2α promoter as revealed by gel electrophoresis of the PCR products amplified from the DNA fragments precipitated by CREB antibody in HFL-1 cells. The top panel is a representative gel of three individual experiments; bottom panel illustrates the positions and sequences of the primers used for PCR.

Induction of cPLA_2α expression by cortisol via a glucocorticoid response element (GRE) in the promoter in human amnion fibroblasts

Bioinformatic analysis of the nucleotide sequences of the cPLA_2α promoter (−595 bp upstream to the transcription start site) with Transcription Element Search System (TESS) revealed several putative GREs (TGTTCT or AGAAGA), but no CRE or nuclear factor-κB binding site within this region (Fig. 3). In addition, there exist tandem repeats of CA nucleotides from −221 to −257 bp. Treatment of the amnion cells transfected with pGL3-enhancer plasmid carrying −595 bp cPLA_2α promoter and luciferase reporter gene with cortisol (1 μm, 24 h) significantly increased the promoter activity, which was blocked by RU486 (1 μm) (Fig. 4A). Deletion of the first 90 bases from the 5′ end did not affect cortisol-induced cPLA_2α promoter activity. However, cortisol-induced cPLA_2α promoter activity was abolished when the deletion progressed to −458 bp (Fig. 4B), suggesting a crucial element responsible for the induction by cortisol existing between −505 and −458 bp. Within this region, there is a typical GR binding sequence (TGTTCT) (20) from −485 to −490 bp (Fig. 3). Introduction of triple-nucleotide mutations (from TGTTCT to TGCCTT; mutation underlined) into this putative GRE abolished the stimulation of cPLA_2α promoter activity by cortisol (1 μm) (Fig. 4C). Chromatin immunoprecipitation assay (ChIP) demonstrated that cortisol treatment (1 μm, 24 h) enhanced the binding of GR to the DNA fragment containing this putative GRE in human amnion fibroblasts (Fig. 5). In contrast to the findings in human amnion fibroblasts, the same GRE was found to mediate the inhibition of the cPLA_2α promoter activity by cortisol (1 μm) in HFL-1 cells. This inhibition of the cPLA_2α promoter activity (−505 bp) by cortisol was abolished by the same triple-nucleotide mutations in the GRE as described above or by complete removable of this GRE (−458 bp) in HFL-1 cells (Fig. 2C). These findings suggest a cofactor interacting with GR might be involved in the paradoxical induction of cPLA_2α expression by cortisol via this GRE in human amnion fibroblasts.

Fig. 3.

Bioinformatic analysis of the putative GRE in cPLA_2α promoter (−595 bp). Boxed nucleotides indicate the positions of the putative GREs, and the arrows indicate the sites of antisense (pointing to the right) and sense (pointing to the left) primers used for PCR subcloning of 5′-end truncated cPLA_2α promoters.

Fig. 4.

A, Stimulation of cPLA_2α promoter (−595 bp) activity by cortisol could be blocked by GR antagonist RU486 in human amnion fibroblasts. B, Deletion of the first 90 nucleotides (as −505 bp) from the 5′ end of −595-bp cPLA_2α promoter did not affect the stimulation of cPLA_2α promoter activity by cortisol (F, 1 μm). Further deletion of the putative GRE at −485 to −490 bp (as −458 bp) diminished the stimulation of cPLA_2α promoter activity by cortisol (F, 1 μm). C, The stimulation of of cPLA_2α promoter activity by cortisol (F, 1 μm) could be abolished by introducing triple-nucleotide mutations (underlined bold letters) into the putative GRE at −485 to −490 bp (boxed letters). n = 3. **, P < 0.01 vs. control (Ctr); #, P < 0.05 vs. cortisol (F) without RU486.

Fig. 5.

ChIP demonstrated that cortisol (1 μm) stimulated the binding of GR to the GRE in the cPLA_2α promoter as revealed by gel electrophoresis of the PCR products amplified from the DNA fragments precipitated by GR antibody in human amnion fibroblasts. The top panel is a representative gel of three individual experiments; bottom panel illustrates the positions and sequences of the primers used for PCR.

Interaction of GR and CREB-1 in the induction of cPLA_2α expression in human amnion fibroblasts

In our recent study, we found that cortisol induced COX-2 expression in human amnion fibroblasts by stimulation of the cAMP/PKA pathway resulting in the phosphorylation of CREB-1 and its subsequent binding to the CRE in the COX-2 promoter (16). In the present study, we found that stimulation of adenylyl cyclase with forskolin (100 μm, 24 h) increased not only COX-2 mRNA expression but also cPLA_2α mRNA expression in human amnion fibroblasts (Fig. 6A). Furthermore, inhibition of PKA by H89 (20 μm) (Fig. 6, B and C) or inhibition of CREB-1 by transfecting the plasmid expressing the dominant-negative (dn)-CREB-1 (Fig. 7, A and B) into the cells significantly attenuated the induction of cPLA_2α mRNA and protein expression by cortisol (1 μm, 24 h), suggesting that activation of the cAMP/PKA/CREB-1 pathway also plays a significant role in the induction of cPLA_2α by cortisol in human amnion fibroblasts. Coimmunoprecipitation assay revealed that GR was detectable in the protein complex precipitated by either GR antibody or CREB-1 antibody but not in the control sample precipitated with normal serum (Fig. 8A). ChIP assay demonstrated that cortisol treatment (1 μm, 24 h) enhanced the binding of CREB-1 to the same DNA fragment that binds GR in the amnion cells (Fig. 8B) but not in the HFL-1 cells (Fig. 2E). These results suggest that interaction of GR and CREB-1 occurs upon cortisol stimulation of the cells.

Fig. 6.

A, Forskolin (100 μm), an adenylyl cyclase stimulator, increased the level of cPLA_2α and COX-2 mRNA in human amnion fibroblasts. B and C, Inhibition of PKA with H89 (20 μm) attenuated the stimulation of cPLA_2α mRNA and protein expression by cortisol (F, 1 μm) in human amnion fibroblasts. The top panel of C is the representative immunoblot; bottom panel shows the mean data (n = 3). **, P < 0.01 vs. control (Ctr); #, P < 0.05; ##, P < 0.01 vs. cortisol (F) without H89.

Fig. 7.

Stimulation of cPLA_2α mRNA (A, n = 3) and protein (B) expression by cortisol (1 μm) was attenuated by transfection of a vector expressing dn-CREB-1 protein in human amnion fibroblasts. The top panel of B is the representative immunoblot; bottom panel shows the mean data of three individual experiments. *, P < 0.05 vs. the fold induction in cells transfected with negative control vector (NC).

Fig. 8.

A, Representative immunoblot showing GR in the protein complex immunoprecipitated (IP) by GR antibody (Ab) or CREB-1 antibody in human amnion fibroblasts stimulated by cortisol (1 μm). IgG(H), IgG heavy chain; IgG(L), IgG light chain. B, ChIP demonstrated that cortisol (1 μm) stimulated the binding of CREB-1 to the GRE in the cPLA_2α promoter as revealed by gel electrophoresis of the PCR products amplified from the DNA fragments precipitated by CREB-1 antibody in human amnion fibroblasts. The top panel is the representative gel image of three individual experiments; bottom panel illustrates the positions and sequences of the primers used for PCR.

Induction of Gα_s expression plays a role in the stimulation of cPLA_2α and COX-2 expression by cortisol in human amnion fibroblasts

As illustrated in Fig. 1D, CHX treatment of human amnion fibroblasts significantly attenuated the induction of cPLA_2α mRNA expression by cortisol as in the case of COX-2 mRNA expression (16), suggesting that de novo protein synthesis participates in the paradoxical stimulation of cPLA_2α and COX-2 mRNA expression by cortisol. Analysis with Western blotting revealed that cortisol treatment (1 μm, 12 h) significantly increased the levels of Gα_s protein in human amnion fibroblasts (Fig. 9A) but not in HFL-1 cells (Fig. 2D). Consistent with GR-mediated induction of cPLA_2α and COX-2 expression (16) by cortisol, the induction of Gα_s expression by cortisol could also be blocked by the GR antagonist RU486 (1 μm) (Fig 9A). Cotreatment of the cells with cortisol (1 μm, 24 h) and NF449 (20 μm), a selective inhibitor of GTP binding with Gα_s (21), significantly attenuated cortisol-stimulated CREB-1 phosphorylation (Fig. 9B) as well as cPLA_2α and COX-2 expression (Fig. 9C).

Fig. 9.

A, Induction of Gα_s protein expression by cortisol (1 μm) was blocked by GR antagonist RU486 (RU, 1 μm) in human amnion fibroblasts. B, Stimulation of CREB-1 phosphorylation by cortisol (1 μm) was attenuated by Gα_s protein inhibitor NF449 (20 μm) in human amnion fibroblasts. C, Stimulation of cPLA_2α and COX-2 protein expression by cortisol (1 μm) was attenuated by Gα_s protein inhibitor NF449 (20 μm). The top panels of A–C are the representative immunoblots; bottom panel shows the mean data. n = 3–4. *, P < 0.05 vs. control (Ctr); #, P < 0.05 vs. cortisol without RU486 or NF449.

Discussion

Because the availability of free arachidonic acid is particularly important for the synthesis of PGs (10, 22), cPLA_2α, the enzyme catalyzing its release from phospholipids, is crucial in the initiation of parturition. This is exemplified by the findings that the expression of cPLA_2α is increased in the amnion, the major PG source in pregnancy, toward the end of normal pregnancy as well as in preterm labor (18, 23), and cPLA_2α-null mice failed to labor at term (19). Glucocorticoids are well-known antiinflammatory drugs. One aspect of their effects is either inhibition of basal cPLA_2α gene expression by itself or inhibition of proinflammatory cytokine-induced cPLA_2α gene expression (12, 13, 24, 25, 26). Because multiple putative GREs exist in the cPLA_2α promoter, the inhibition of cPLA_2α expression by glucocorticoids has been suggested to be mediated by these GREs (27, 28). In this study, we proved the GRE at −485 to −490 bp was particularly important in mediating the classical inhibitory effect of cortisol on cPLA_2α expression in HFL-1 cells. By contrast, we confirmed our previous findings that cortisol, like the synthetic dexamethasone, is a potent stimulator of cPLA_2α expression in human amnion fibroblasts (7). Of interest, this kind of paradoxical stimulation of PG synthesis by glucocorticoids has also been recently observed in other cell types such as cardiomyocytes (29, 30), which is believed to provide a survival pathway against ischemia/reperfusion injury. In this study, we found that the stimulation of cPLA_2α expression by glucocorticoids in human amnion fibroblasts required ongoing transcription and was achieved through stimulation of the cPLA_2α promoter activity via the same cis-acting GRE that mediates the classical inhibitory effect of cortisol in HFL-1 cells. Although there exist multiple putative GREs in the cPLA_2α promoter (31, 32), this distal GRE appears to be more crucial in mediating the stimulatory effect of glucocorticoids. The function of the proximal GREs might be interfered with by the neighboring tandem CA repeats, which have been shown to exert a strong negative regulation of cPLA_2α promoter activity (32). However, the GREs found in the cPLA_2α promoter appear to be half-sites, which may not allow the discrimination of repression and stimulation by the sequence alone (27, 33). Thus, it is very likely that the stimulation of cPLA_2α expression by cortisol is determined by the interaction of GR with other transcription factors induced by glucocorticoids in human amnion fibroblasts. We found that recruitment of CREB-1 to the GRE is crucial for the stimulation of cPLA_2α expression to occur. The CREB-1 protein was found not only in the protein complex containing GR but also bound to the distal GRE with GR by ChIP assay. Additionally, inhibiting PKA-induced CREB-1 phosphorylation with H89 or blocking the function of CREB-1 with dn-CREB-1 greatly attenuated the induction of cPLA_2α by cortisol. All these findings resemble the mechanism of cortisol-induced COX-2 expression in human amnion fibroblasts (16). These results suggest that the stimulation of cPLA_2α and COX-2 by cortisol shares one common pathway, namely cAMP/PKA/CREB-1, which is further supported by the findings that stimulation of adenylyl cyclase with forskolin increased both cPLA_2α and COX-2 expression in human amnion fibroblasts. Of interest, different cis elements, respectively GRE and CRE, were used by this pathway in mediating the paradoxical induction of cPLA_2α and COX-2 expression by cortisol in human amnion fibroblasts. This interaction of GR and CREB-1 has also been reported to be a unique mechanism for the up-regulation of the expression of a number of other genes such as phosphoenolpyruvate carboxykinase and somatostatin by glucocorticoids (34, 35), which might be one of the key rules to the cell- and stimulus-specific effects of glucocorticoids.

Our present and previous studies (16) showed that the stimulation of both cPLA_2α and COX-2 mRNA expression by cortisol was blocked when the de novo protein synthesis was inhibited by CHX in human amnion fibroblasts, suggesting that cortisol-induced protein synthesis is required for the stimulation of cPLA_2α and COX-2 transcription to occur. It is generally accepted that the activation of cAMP/PKA/CREB pathway is initiated by the activation of G protein-coupled receptors (36). The heterotrimeric G protein consists of an α-subunit that binds and hydrolyzes GTP as well as β- and γ-subunits that form an undissociable complex. Coupling of the activated receptor to the heterotrimeric G protein promotes the exchange of GDP for GTP on the α-subunit resulting in the dissociation of the α-subunit from the βγ-complex. It is the α-subunit that defines the basic properties of the G protein. There are at least four families of the α-subunit: Gα_s, Gα_i/Gα₀, Gα_q/Gα₁₁, and Gα₁₂/Gα₁₃ (36). The Gα_s couples many receptors to adenylyl cyclase and mediates receptor-dependent adenylyl cyclase activation resulting in increases in the intracellular cAMP level. The Gα_s is encoded by GNAS, a complex imprinted gene. Although it is generally believed that Gα_s is ubiquitously expressed, its expression has been reported to be inducible by glucocorticoid treatment, thus enhancing the efficacy of receptors coupled to Gα_s (37, 38). In the present study, we found that the expression of Gα_s was greatly increased by cortisol treatment of the human amnion fibroblasts. We believe that this induction of Gα_s is crucial to the induction of cPLA_2α and COX-2 expression by cortisol in human amnion fibroblasts because inhibiting Gα_s function with NF449 greatly attenuated the induction of both cPLA_2α and COX-2 expression as well as the phosphorylation of CREB-1 by cortisol. These findings lead us to speculate that the induction of Gα_s may facilitate the actions of the paracrine or intracrine hormones secreted by the amnion fibroblasts, whose receptors coupled to Gα_s, or simply activate the adenylyl cyclase directly to promote PG synthesis. As we know, human amnion fibroblasts synthesize and secrete a large amount of PGs as well as express virtually all the subtypes of PG receptors including EP2, EP4, and IP, which are coupled to Gα_s protein (39, 40). Thus, we speculate that this paradoxical stimulation of PG synthesis by cortisol may form a feed-forward mechanism of PG synthesis via induction of Gα_s protein toward the end of pregnancy and during parturition.

In conclusion, we demonstrated that cortisol, by inducing the expression of Gα_s protein, activated the cAMP/PKA/CREB-1 pathway, resulting in the increased level of phosphorylated CREB-1, which, in turn, interacts with GR on the cis-acting GRE in cPLA_2α promoter to promote its expressions in human amnion fibroblasts (Fig. 10).

Fig. 10.

The hypothesized mechanism underlying the induction of cPLA_2α and COX-2 expression by cortisol in human amnion fibroblasts.

Materials and Methods

Human amnion fibroblast and fetal lung fibroblast cell culture

Human amnion fibroblasts were prepared from the fetal membranes collected at term from women undergoing elective cesarean section under a protocol approved by the ethics committee of the School of Life Sciences, Fudan University. Patients treated with steroids or other antiinflammatory agents or with a clinical indication of inflammation were excluded from this study. Amnion was digested with 0.125% trypsin (Sigma, St. Louis, MO) and washed to get rid of epithelial cells. The remaining amnion tissue was digested with 0.1% collagenase (Roche, Indianapolis, IN), and the cells were collected for purification with Percoll (GE Healthcare, Uppsala, Sweden) gradients (5, 20, 40, and 60%). The cells were cultured in DMEM (GIBCO, Grand Island, NY) containing 10% newborn calf serum (NCS) (GIBCO) and antibiotic-antimycotic (GIBCO). The identity of cells has been previously verified (7). To identify the role of the same putative GRE in the classical inhibitory effect of glucocorticoids on cPLA_2α expression, HFL-1 cells (American Type Culture Collection, Rockville, MD) were cultured in MEMα (Invitrogen, Grand Island, NY) supplemented with 10% NCS and antibiotic-antimycotic.

Treatment of human amnion fibroblasts and HFL-1 cells

On the third day of amnion fibroblast culture, the cells were washed with PBS, and the culture medium was changed to NCS-free medium. The cells were then treated with different concentrations of cortisol (0.01–1 μm; Sigma). To examine whether the effect of cortisol on cPLA_2α mRNA expression is dependent on ongoing transcription and requires de novo protein synthesis, the cells were pretreated with the mRNA transcription inhibitor DRB (75 μm; Sigma) or the protein synthesis inhibitor CHX (10 μm; Sigma) for 0.5 h before cortisol treatment and the DRB or CHX treatment was continued together with cortisol treatment for 24 h. To explore whether the effect of cortisol on cPLA_2α expression is dependent on GR, the cells were treated with cortisol (1 μm, 24 h) in the presence or absence of GR antagonist RU486 (1 μm; Sigma). To study the role of cAMP, PKA, and CREB-1 in the regulation of cPLA_2α expression by cortisol, the cells were treated with forskolin (100 μm, a stimulator of adenylyl cyclase; Sigma) or cortisol (1 μm, 24 h) in the presence and absence of H89 (20 μm, an inhibitor of PKA; Sigma) or Gα_s inhibitor NF449 (20 μm) (Calbiochem, La Jolla, CA) or transfected with a RSV-SG plasmid carrying a dominant-negative mutant of CREB-1 (dn-CREB-1, 1 μg/well) in which Ser133 is replaced with Ala (kindly provided by Dr. M. R. Montminy, The Salk Institute, La Jolla, CA). The transfection method is described below. Upon 70–90% confluence, cortisol (1 μm) treatment of the HFL-1 cells was carried out for the measurement of cPLA_2α mRNA and protein, Gα_s protein, or cPLA_2α promoter-driven reporter gene activity as described below.

Determination of cPLA_2α mRNA levels with qRT-PCR

After removal of culture medium, cells were scraped into cell lysis buffer for subsequent extraction of total RNA for analysis with PCR using UNIQ-10 RNA extraction kit (Sangon Biotech, Shanghai, China). One microgram of RNA was reverse-transcribed to cDNA with oligo(deoxythymidine)_12-18 primers using Moloney murine leukemia virus reverse transcriptase (Promega, Madison, WI), and the cDNA was used for subsequent measurement of cPLA_2α mRNA level with qRT-PCR. The reaction solution of qRT-PCR consisted of 2.0 μl diluted cDNA, 0.2 μm of each paired primer, and power SYBR green PCR master mix (Toyobo, Osaka, Japan). The annealing temperature was set at 61 C. The absolute mRNA levels in each sample were calculated according to a standard curve set up using serial dilutions of known amounts of specific templates against corresponding cycle threshold values. To control for sampling errors, qRT-PCR for the housekeeping gene β-actin was routinely performed on each sample. The ratio of the target genes over β-actin in each sample was obtained to normalize the expression of the target gene. The specificity of the primers was verified by examining the melting curve as well as the sequences of the PCR products. The primer sequences for amplifying human cPLA_2α and β-actin genes are illustrated in Table 1.

Table 1.

Primer sequences used for qRT-PCR

Genes	Primer sequences (5′–3′)	GenBank accession no.	Size of PCR products (bp)
cPLA2α
Forward	ATGGCCTTGGTGAGTGATTC	NM_024420	179
Reverse	TCAGGATCTGCTACAGCTGC
COX-2
Forward	TGTGCAACACTTGAGTGGCT	NM_000963	297
Reverse	ACTTTCTGTACTGCGGGTGG
β-Actin
Forward	GGGAAATCGTGCGTGACATTAAG	NM_001101	275
Reverse	TGTGTTGGCGTACAGGTCTTTG

Determination of cPLA_2α, COX-2, Gα_s, and phosphorylated CREB-1 protein levels with Western blotting

After removal of the culture medium, the cells were washed and collected in PBS containing phosphatase inhibitor. After spinning down, total cellular protein was extracted using a kit from Active Motif (Carlsbad, CA). The expression levels of cPLA_2α, COX-2, Gα_s, and phosphorylated CREB-1 proteins were examined using a standard Western blotting protocol. Briefly, 50 μg protein of each sample was electrophoresed in 7.5% SDS-polyacrylamide gel and transferred to the nitrocellulose blot. The blot was blocked with nonfat milk solution and incubated with 1:500 dilutions of antibodies (Santa Cruz Biotechnology, Santa Cruz, CA) against cPLA_2α (sc-454), COX-2 (sc-19999), Gα_s (sc-823), and phosphorylated CREB-1 (ser133) (sc-101663) overnight. After washing, the blot was incubated with the corresponding secondary antibodies conjugated with horseradish peroxidase (Santa Cruz) for 1 h. The enhanced chemiluminescence detection system (Millipore, Billerica, CA) was used to detect the bands with peroxidase activity. The same blot was reprobed with β-actin antibody (sc-47778; Santa Cruz) as a loading control.

5′ Progressive deletion and site-directed mutagenesis of the cPLA_2α gene promoter and construction into the pGL3-enhancer plasmid

The pGL2 basic plasmid containing the −595-bp cPLA_2α promoter was kindly provided by Dr. Shelhamer (National Institutes of Health, Bethesda, MD). Progressive deletion of the cloned cPLA_2α gene promoter was carried out with PCR using the combination of a common antisense primer and a series of 5′ sense primers (progressing toward the transcription start site) as paired primer sets. The annealing positions of these primers are shown in Fig. 3. Restriction sites for KpnI and BglII were designed into the sense and antisense primers, respectively. In addition to −595 bp, a series of 5′-deleted cPLA_2α gene promoters was produced (−505 and −458 bp). Based upon the 5′ deletion study, site-directed triple-nucleotide mutations were introduced into the predicted GREs at −485 to −490 bp by designing the mutation sites into the sense primer for cloning the −505-bp promoter fragment (Fig. 5A). The PCR products were cut with KpnI and BglII, and ligated into the polycloning sites of pGL3-enhancer plasmid. All of the above cloned promoter fragments were verified by sequencing.

Transient transfection of human amnion fibroblasts and HFL-1 cells with pGL3-enhancer plasmid carrying cPLA_2α promoter-driven luciferase reporter gene

Both human amnion fibroblasts and HFL-1 cells were grown to approximately 70% confluence in complete medium containing 10% NCS and antibiotic-antimycotic before the start of transfection. On the day of transfection, the cells were washed with PBS, and the media were changed to antibiotic-free media containing 10% NCS. The cells were cotransfected with 0.5 μg/well pGL3-enhancer plasmid carrying cPLA_2α promoter and 0.05 μg/well pSV-β-galactosidase plasmid using Lipofectamine LTX in Opti-MEM (Invitrogen, Carlsbad, CA). The above plasmids were extracted from the transformed bacteria using endotoxin-free Nucleobond PC500 EF kit (Macherey-Nagel, Duren, Germany). The pSV-β-galactosidase plasmid was used for transfection efficiency control. Transfection was allowed for 12 h. The media were changed to complete media, and the cells were left to recover for 24 h. The cells were then treated with cortisol in the presence and absence of RU486 (1 μm) in serum-free medium for another 24 h. The cells were then lysed for subsequent measurement of luciferase and β-galactosidase activity using luciferase assay and β-galactosidase enzyme assay systems (Promega), respectively. The ratio of cPLA_2α promoter-driven luciferase activity against β-galactosidase activity was obtained to correct differential transfection efficiency in each well and to express the promoter activity. The transfection method for RSV-SG plasmid was the same as the reporter gene plasmid.

Coimmunoprecipitation assay

Coimmunoprecipitation assays were carried out to study the interaction of GR and CREB-1 in human amnion fibroblasts. Briefly, upon cortisol (1 μm) stimulation for 24 h, total cellular protein was extracted and immunoprecipitated by GR (sc-1003X; Santa Cruz) or CREB-1 antibodies (sc-186X; Santa Cruz) and protein A (Upstate Biotechnology, Temecula, CA). The protein complex was washed adequately and collected for Western blotting with GR antibodies to detect GR in the complex.

ChIP assay demonstrating the binding of GR or CREB-1 to cPLA_2α promoter in human amnion fibroblasts and HFL-1 cells

Primary human amnion fibroblasts and HFL-1 cells were prepared as described above. The cells were treated with cortisol (1 μm) for 24 h. Upon termination of treatment, ChIP assay was conducted using a kit from Upstate Biotechnology and a method modified from the manufacturer’s protocol. Briefly, the cells were fixed with 1% formaldehyde to cross-link the transcription factors to chromatin DNA. After washing with PBS, the cells were incubated with glycine and then scraped off the dish in PBS containing protease inhibitor cocktail. After spinning down, the cells were resuspended with lysis buffer supplemented with protease inhibitor cocktail and broken up using a Dounce homogenizer to aid nuclei release. After spinning down, the nuclei were resuspended in digestion buffer supplemented with protease inhibitor cocktail. The shearing of chromatin DNA was carried out by sonication to produce an optimized size of input DNA around 500 bp. The sheared DNA was collected for subsequent immunoprecipitation with GR antibody (Santa Cruz) or CREB-1 antibody (Santa Cruz) or normal serum as negative control. The immunoprecipitate was then incubated with protein A agarose/salmon sperm DNA and the antibody/protein/DNA/agarose complex was washed and collected for subsequent reverse cross-linking. The sheared DNA recovered from reverse cross-linking was extracted with a DNA extraction kit for further PCR analysis. The positions and sequences of the primers spanning the predicted GRE promoter region used for PCR are illustrated in Figs. 5 and 8B). Real-time PCR was performed on the sheared DNA fragments and was stopped before saturation according to the amplification curve. PCR products were analyzed with 2% agarose gel electrophoresis.

Statistical analysis

All data are reported as mean ± sem. Paired Student’s t test or one-way ANOVA test followed by the Student-Newman-Keuls test was used to assess significant differences where appropriate. Significance was set at P < 0.05.

NURSA Molecule Pages:

• Ligands: Hydrocortisone.