Regulation of Hyphal Growth and N-Acetylglucosamine Catabolism by Two Transcription Factors in Candida albicans

Abstract

The amino sugar N-acetylglucosamine (GlcNAc) is increasingly recognized as an important signaling molecule in addition to its well-known structural roles at the cell surface. In the human fungal pathogen Candida albicans, GlcNAc stimulates several responses including the induction of the genes needed for its catabolism and a switch from budding to filamentous hyphal growth. We identified two genes needed for growth on GlcNAc (RON1 and NGS1) and found that mutants lacking these genes fail to induce the genes needed for GlcNAc catabolism. NGS1 was also important for growth on other sugars, such as maltose, but RON1 appeared to be specific for GlcNAc. Both mutants could grow on nonfermentable carbon sources indicating that they do not affect mitochondrial function, which we show is important for growth on GlcNAc but not for GlcNAc induction of hyphal morphogenesis. Interestingly, both the ron1Δ and ngs1Δ mutants were defective in forming hyphae in response to GlcNAc, even though GlcNAc catabolism is not required for induction of hyphal morphogenesis. The ron1Δ mutant showed a partial defect in forming hyphae, which was surprising since it displayed an elevated level of filamentous cells under noninducing conditions. The ron1Δ mutant also displayed an elevated basal level of expression of genes that are normally upregulated during hyphal growth. Consistent with this, Ron1 contains an Ndt80-like DNA-binding domain, indicating that it regulates gene expression. Thus, Ron1 is a key new component of the GlcNAc response pathway that acts as both an activator and a repressor of hyphal morphogenesis.

THE fungal pathogen Candida albicans grows as a commensal organism on humans, and causes lethal systemic infections when the normal barriers to infection are disrupted, such as a compromised immune system . New therapies are needed to treat systemic C. albicans infections, as there is ∼40% attributable mortality despite recent advances in antifungal therapy (Pfaller and Diekema 2010; Brown et al. 2012). One underlying virulence property is the ability of C. albicans to grow in different morphologies ranging from budding cells to long chains of hyphal or pseudohyphal cells (Sudbery 2011). Hyphal growth can be induced by a wide range of environmental stimuli that are encountered by C. albicans in vivo, including serum, alkaline pH, CO₂, bacterial peptidoglycan breakdown products, and N-acetylglucosamine (GlcNAc) (Biswas et al. 2007; Whiteway and Bachewich 2007; Davis 2009; Sudbery 2011). Hyphal morphogenesis is significant as it promotes invasive growth of C. albicans into tissues and biofilm formation (Finkel and Mitchell 2011; Sudbery 2011). Cells induced to form hyphae also show increased expression of virulence factors (Whiteway and Oberholzer 2004; Kumamoto and Vinces 2005; da Silva Dantas et al. 2016).

GlcNAc induction of hyphal morphogenesis and virulence gene expression in C. albicans is part of the growing evidence that this amino sugar is an important signaling molecule. For example, GlcNAc induces hyphal growth in a diverse set of fungi (Kim et al. 2000; Gilmore et al. 2013), it regulates stress and virulence responses in bacteria, and it can stimulate NLRP3 inflammasome activation in mammalian cells (Konopka 2012; Naseem and Konopka 2015; Wolf et al. 2016). GlcNAc is commonly found at the extracellular surface of a wide range of cells as a component of bacterial peptidoglycan, fungal cell wall chitin, and mammalian cell glycosaminoglycans (Moussian 2008). Thus, GlcNAc released during cell-surface remodeling due to growth or damage can act as a signaling molecule for both intercellular and interspecies communication.

In C. albicans, GlcNAc is thought to act intracellularly, in part because the Ngt1 transporter that facilitates GlcNAc uptake into cells promotes the ability of this sugar to stimulate hyphal growth (Alvarez and Konopka 2007). GlcNAc does not have to be catabolized to induce hyphal growth, because a strain lacking the genes needed for GlcNAc metabolism (hxk1Δ nag1Δ dac1Δ) can be induced to form hyphae (Naseem et al. 2011, 2015). This led to the proposal that cells sensitively distinguish exogenous GlcNAc taken up from the environment vs. GlcNAc synthesized inside the cell, because exogenous GlcNAc is not phosphorylated whereas cells only synthesize phosphorylated forms of this sugar (e.g., GlcNAc-6-PO4) (Naseem et al. 2012). Previous studies suggested that the cAMP pathway might be involved in GlcNAc signaling, since a cyr1Δ mutant that lacks adenylyl cyclase is not induced by GlcNAc to form hyphae. However, a faster-growing pseudorevertant version of the cyr1Δ strain can be induced to form hyphae, indicating that GlcNAc can induce hyphal morphogenesis by cAMP-independent pathways (Parrino et al. 2017).

GlcNAc also induces the expression of the genes that promote its catabolism in C. albicans (Kumar et al. 2000). The GlcNAc catabolic genes are present in a cluster in the C. albicans genome that consists of a GlcNAc kinase that generates GlcNAc-6-PO₄ (HXK1), a deacetylase (DAC1), and a deaminase (NAG1) (Kumar et al. 2000; Yamada-Okabe et al. 2001). The combined action of the catabolic genes results in the conversion of GlcNAc to fructose-6-PO₄, which can be used for glycolysis. In addition, GlcNAc stimulates the expression of the GlcNAc transporter (NGT1) and GIG1, which appears to play a role in metabolic regulation (Gunasekera et al. 2010). These GlcNAc-responsive genes are controlled independently of hyphal signaling, since they can be induced under conditions that do not promote hyphal growth (e.g., at low temperature or in a cyr1Δ adenylyl cyclase mutant).

To better understand how C. albicans responds to GlcNAc, we identified two genes needed for growth on GlcNAc: NGS1 (CR_00190W) and RON1 (CR_04250W). These genes were identified in part because their orthologs are adjacent to the cluster of GlcNAc catabolic genes in some species (Gilmore et al. 2013; Kappel et al. 2016), although this is not the case in C. albicans. Furthermore, during our studies on these genes, orthologs of NGS1 and RON1 were shown to be required for GlcNAc catabolism in the filamentous fungus Trichoderma reesei, and NGS1 was reported to be needed for growth on GlcNAc by C. albicans (Kappel et al. 2016; Su et al. 2016). NGS1 encodes a protein with one domain of homology to family 3 glycohydrolases and another domain similar to the GNAT family of GCN5-related N-acetyltransferases (Qin et al. 2015). Ngs1 has been suggested to act in conjunction with the Rep1 transcription factor in C. albicans (Su et al. 2016). We found that NGS1 is also important for growth on other sugars, including maltose; whereas RON1 appears to be specific for GlcNAc. RON1 encodes a protein with an Ndt80-like DNA-binding domain, indicating it acts as a transcription factor. Mutants lacking C. albicans NGS1 or RON1 were defective in responding to GlcNAc to induce the catabolic genes. Interestingly, the ngs1Δ mutant was strongly defective in forming hyphae in response to GlcNAc, whereas the ron1Δ strain was partially defective. The results identify Ron1 and Ngs1 as critical regulators of both GlcNAc catabolism and hyphal growth in C. albicans.

Materials and Methods

Strains and media

The genotypes of the C. albicans strains that were used are described in Table 1. The cells were grown in rich YPD medium (yeast extract, peptone, dextrose) or in synthetic medium made with yeast nitrogen base (YNB) (Styles 2002). Most of the homozygous gene deletion mutant strains were constructed by the sequential deletion of both copies of the targeted gene from the diploid C. albicans genome. The ron1Δ strain was constructed by deleting the entire open reading frame from C. albicans strain BWP17 (arg4Δ his1Δ ura3Δ) using methods described previously (Wilson et al. 1999). In brief, PCR primers containing ∼70 bp of sequence homologous to the sequences flanking the open reading frame of RON1 were used to amplify the ARG4 and the HIS1 selectable marker genes. Integration of these deletion cassettes at the appropriate site to delete RON1 was verified by PCR using combinations of primers that flanked the integration and primers that annealed within the introduced cassettes. Complementation of the ron1Δ deletion mutation was carried out by introducing a plasmid carrying a wild-type copy of RON1 into the genome. The plasmid was constructed by PCR amplification of genomic DNA from 1000 bp upstream of the initiator ATG to 400 bp downstream of the terminator codon of RON1. This RON1 DNA fragment was then inserted between the SacI and SacII restriction sites of the URA3 plasmid pDDB57 (Wilson et al. 2000). The resulting RON1 plasmid was linearized in the promoter region by digestion with SnaBI and then integrated into the ron1Δ/ron1Δ strain SN1423 using URA3 selection to create complemented strain SN1425. The plasmid pBSK-URA3 was digested with the restriction enzymes PstI and NotI to liberate the URA3-IRO1 sequence, which was then transformed into ron1Δ strain SN1423 and integrated by homologous recombination into the genome to restore URA3 at its native locus to create strain SN1424.

Table 1. C.albicans strains used in this study.

Strain	Short genotype	Full genotype
BWP17	Parental strain	his1::hisG/his1::hisG arg4::hisG/arg4::hisG ura3Δ::λimm434/ura3Δ::λimm434
DIC185	Prototrophic wild-type control	ura3Δ::λimm434/URA3 his1::hisG/HIS1 arg4::hisG/ARG4
SN1423	ron1Δ	ron1Δ::HIS1/ron1Δ::ARG4 his1::hisG/his1::hisG arg4::hisG/arg4::hisG ura3Δ::λimm434/ura3Δ::λimm434
SN1421	NGT1-GFP	HIS1/his1::hisG ARG4/arg4::hisG NGT1-GFP::URA3/NGT1 ura3Δ::λimm434/ura3Δ::λimm434
SN1422	HXK1-GFP	HIS1/his1::hisG ARG4/arg4::hisG HXK1-GFP::URA3/HXK1 ura3Δ::λimm434/ura3Δ::λimm434
SN1424	ron1Δ	ron1Δ::HIS1/ron1Δ::ARG4 his1::hisG/his1::hisG arg4::hisG/arg4::hisG URA3/ura3Δ::λimm434
SN1425	ron1Δ+RON1	ron1Δ::HIS1/ron1Δ::ARG4 his1::hisG/his1::hisG arg4::hisG/arg4::hisG RON1::URA3/ura3Δ::λimm434
SN1426	ron1Δ	ron1Δ::HIS1/ron1Δ::ARG4 his1::hisG/his1::hisG arg4::hisG/arg4::hisG NGT1-GFP::URA3/NGT1 ura3Δ::λimm434/ura3Δ::λimm434
	NGT1-GFP
SN1427	ron1Δ	ron1Δ::HIS1/ron1Δ::ARG4 his1::hisG/his1::hisG arg4::hisG/arg4::hisG HXK1-GFP::URA3/HXK1 ura3Δ::λimm434/ura3Δ::λimm434
	HXK1-GFP
SN1428	ngs1Δ	ngs1Δ::LEU2/ngs1Δ::HIS1 leu2Δ/leu2Δ his1Δ/his1Δ arg4Δ/arg4Δ URA3/ura3Δ::imm IRO1/iro1Δ::imm
SN1429	ngs1Δ	ngs1Δ::LEU2/ngs1Δ::HIS1 leu2Δ/leu2Δ his1Δ/his1Δ ARG4/arg4Δ URA3/ura3Δ::imm IRO1/iro1Δ::imm
SN1430	ngs1Δ+NGS1	ngs1Δ::LEU2/ngs1Δ::HIS1 NGS1::NAT1 leu2Δ/leu2Δ his1Δ/his1Δ ARG4/arg4Δ URA3/ura3Δ::imm IRO1/iro1Δ::imm
SN1431	ngs1Δ	ngs1Δ::LEU2/ngs1Δ::HIS1 NGT1-GFP::ARG4/NGT1 leu2Δ/leu2Δ his1Δ/his1Δ arg4Δ/arg4Δ URA3/ura3Δ::imm IRO1/iro1Δ::imm
	NGT1-GFP
SN1432	ngs1Δ	ngs1Δ::LEU2/ ngs1Δ::HIS1 HXK1-GFP::ARG4/HXK1 leu2Δ/leu2Δ his1Δ/his1Δ arg4Δ/arg4Δ URA3/ura3Δ::imm IRO1/iro1Δ::imm
	HXK1-GFP
KM1433	ngs1Δ	ngs1Δ::LEU2/ngs1Δ::HIS1 leu2Δ/leu2Δ his1Δ/his1Δ ARG4/arg4Δ URA3/ura3Δ::imm IRO1/iro1Δ::imm hxk1Δ::NAT1/hxk1Δ::NAT1
	hxk1Δ
AG734	nag1Δ	nag1::HIS1/nag1::ARG4 URA3/ura3Δ::λimm434 his1::hisG/his1::hisG arg4::hisG/arg4::hisG
AG732	dac1Δ	dac1::HIS1/dac1::ARG4 URA3/ura3Δ:: λimm434 his1::hisG/his1::hisG arg4::hisG/arg4::hisG
AG736	hxk1Δ	hxk1::URA3/hxk1::ARG4 ura3Δ::λimm434/ura3Δ::λimm434 HIS1/his1::hisG arg4::hisG/arg4::hisG
AG738	h-d (hxk1Δ nag1Δ dac1Δ)	[hxk1 nag1 dac1]::ARG4/[hxk1 nag1Δ dac1Δ]::URA3 HIS1/his1::hisG ura3Δ::λimm434/ura3Δ::λimm434 arg4::hisG/arg4::hisG
SN152	Parental strain	arg4Δ/arg4Δ leu2Δ/leu2Δ his1Δ/his1Δ URA3/ura3Δ::imm IRO1/iro1Δ::imm
LLF100	Prototrophic WT control	ARG4/arg4Δ LEU2/leu2Δ HIS1/his1Δ URA3/ura3Δ::imm IRO1/iro1Δ::imm
SN1434	mci4Δ	mci4::HIS1/mci4::LEU2 arg4Δ/arg4Δ leu2Δ/leu2Δ HIS1/his1Δ URA3/ura3Δ::imm IRO1/iro1Δ::imm
SN1435	nuo1Δ	nuo1::HIS1/nuo1::LEU2 arg4Δ/arg4Δ leu2Δ/leu2Δ HIS1/his1Δ URA3/ura3Δ::imm IRO1/iro1Δ::imm
KM1436	hxk1Δ nag1Δ dac1Δ	[hxk1Δ nag1Δ dac1Δ]::ARG4/[hxk1 nag1Δ dac1Δ]::URA3 HIS1/his1::hisG ura3Δ::imm434/ ura3Δ::imm434 arg4::hisG/arg4::hisG gig1Δ::SAT-Flipper/gig1Δ::SAT-Flipper
	gig1Δ-1
KM1437	hxk1Δ nag1Δ dac1Δ	[hxk1Δ nag1Δ dac1Δ]::ARG4/[hxk1 nag1Δ dac1Δ]::URA3 HIS1/his1::hisG ura3Δ::imm434/ ura3Δ::imm434 arg4::hisG/arg4::hisG gig1Δ::SAT-Flipper/gig1Δ::SAT-Flipper
	gig1Δ-2

The ngs1Δ strain was constructed as previously described (Noble et al. 2010). A complemented strain was constructed by integrating a copy of the wild-type NGS1 sequence into the genome. The NGS1 plasmid was constructed by PCR amplification of genomic DNA from 980 bp upstream of the initiator ATG to 584 bp downstream of the terminator codon of NGS1. This NGS1 DNA fragment was then inserted between the SacI and SacII restriction sites of a version of plasmid pDDB57 that carries an NAT1 selectable marker. A prototrophic control strain (SN1430) was constructed in which the ARG4 sequence was amplified by PCR from genomic DNA and then transformed into the ngs1Δ strain SN1428.

The double mutant strain ngs1Δ hxk1Δ was created using transient expression of CRISPR/Cas9 to facilitate the homozygous deletion of HXK1 from the ngs1Δ strain KM1433. The methods were essentially as described previously (Min et al. 2016). Briefly, the ngs1Δ strain was cotransformed with a HXK1-SAT-Flipper deletion construct (3 µg), the CaCas9 cassette (1 µg), and the single-guide RNAs cassette (1 µg) by using the lithium acetate transformation method (Walther and Wendland 2003). We then used the following 20-bp target sequence of the sgRNA, as reported byVyas et al. (2015), to delete the HXK1 gene (AATCCCTGTCCCCAACACCA).

GFP-tagged reporter strains were constructed by transforming a PCR-amplified cassette carrying NGT1-GFP and HXK1-GFP carrying the URA3 or ARG4 selectable marker (Zhang and Konopka 2010). These cassettes carry the GFPγ variant that is more photostable (Zhang and Konopka 2010). PCR primers were used that carry ∼70 bp of homology to the sequences adjacent to the termination codon of NGT1 or HXK1, as described previously (Zhang and Konopka 2010; Naseem et al. 2011). The resulting PCR products were then used to transform the corresponding strains to create GFP fusion genes. Similar results were observed for at least four independent transformants for each strain.

Growth assays

Wild-type and mutant strains of C. albicans were tested for growth on different sugars by spotting dilutions of cells on synthetic agar medium containing Yeast Nitrogen Base (YNB) and the indicated source of carbon and energy. Strains were grown overnight, adjusted to 10⁷ cells/ml, and then serial dilutions of cells were prepared. Three microliters of each dilution was then spotted onto the indicated type of plate. The plates were incubated for 2 or 3 days as indicated, and then photographed. Each assay was done at least three independent times.

Hyphal morphogenesis

The ability to form hyphae in liquid media was analyzed with cells that were grown overnight at 37° to early log phase in synthetic medium with galactose. The cells were then adjusted to ∼1 × 10⁶ cells/ml, and then growth was continued in medium with galactose alone, or with galactose plus the indicated concentration of GlcNAc. Similar experiments were carried out with the media adjusted to pH 6.8 with 10 mM PIPES. In addition, the cells were also induced by addition of serum to 10% final concentration (v/v). Samples were then incubated at 37° for the indicated time. Cells were concentrated by centrifugation and then images were captured using differential interference contrast (DIC) optics.

Invasive hyphal morphogenesis was analyzed by spotting 3 µl of cells on an agar plate with the indicated type of medium and then incubating at 37°. At different times, the morphology of the cells at the edge of the zone of growth was photographed to record the extent of invasive hyphal growth into the agar.

Induction of NGT1-GFP and HXK1-GFP reporter genes

Cells were grown overnight to early log phase in synthetic medium YNB with galactose. The cells were then resuspended in the same medium containing 50 mM galactose ±50 mM final concentration of GlcNAc and grown for different lengths of time at 30°. Cells were then photographed using DIC optics to detect cell morphology and by fluorescence microscopy to detect the production of GFP. Photographic images were captured using an Olympus BH2 microscope equipped with a Zeiss AxioCam digital camera.

Sequencing of complementary DNAs (cDNAs) (RNA-seq)

C. albicans cells were grown in YNB-based media at 37° under the specified conditions, cells were harvested, and then RNA was extracted using an Ambion Yeast Ribopure RNA Purification Kit (Fisher Scientific, Pittsburgh, PA). The RNA was then reverse transcribed, and then the resulting cDNA was prepared for DNA sequencing using an Ovation Universal RNA-Seq System (NuGEN Technologies). The library of cDNAs was then sequenced on an Illumina MiSeq machine using a 150 cycle MiSeq Reagent Kit to obtain paired-end reads (Illumina). In preparation for bioinformatic analysis, the RNA-seq reads were processed as follows: reads were trimmed at the 3′ end to a length of 65 nt, poly(A) regions were removed, and the read quality was then filtered using the FASTX-Toolkit. The remaining paired-end reads were identified using a custom Python script, and then mapped to the C. albicans SC5314 genome (Assembly 22) using HISAT2 (Kim et al. 2015; Pertea et al. 2016). The number of reads in genes was counted using the program HTSeq-count (Anders et al. 2015). The relative expression was then calculated as transcripts per million (TPM) (Wagner et al. 2012). For comparison, differential expression analyses were conducted using DESeq2 package from Bioconductor (Gentleman et al. 2004; Love et al. 2014).

Data availability

The authors state that all data necessary for confirming the conclusions presented in the article are represented fully within the article. RNA-seq data are presented in Supplemental Material, Tables S1 and S2 in File S2. All yeast strains and plasmids will be made available upon request.

Results

Ndt80-like transcription factor Ron1 is needed for C. albicans growth on GlcNAc

Genes encoding a transcription factor with a DNA-binding domain similar to Saccharomyces cerevisiae Ndt80 are commonly found near the cluster of GlcNAc catabolic genes in filamentous fungi, suggesting they could be involved in regulating transcription of the genes needed for catabolism of GlcNAc (Kappel et al. 2016). There are no Ndt80-like transcription factor genes near the GlcNAc catabolic genes in the C. albicans genome, so we analyzed the two C. albicans genes that are most closely related to T. reesei RON1 (Figure 1A). Cells lacking the C. albicans NDT80 (C2_00140W or orf19.2119) grew well on GlcNAc. However, cells lacking the uncharacterized gene CR_04250W (orf19.513) showed a strong defect (Figure 1B). This mutant was also defective in growing on glucosamine, indicating a general defect in metabolizing hexosamines. Therefore, we will refer to this gene as RON1, since this is the name given to an NDT80-like gene that is needed for growth on GlcNAc in T. reesei (Kappel et al. 2016).

Figure 1.

Ron1 has a DNA-binding domain similar to Ndt80 family transcription factors and is needed for growth on GlcNAc. (A) Diagram illustrating the relative position of the DNA-binding domain in S. cerevisiae Ndt80, C. albicans Ndt80, and C. albicans Ron1 (CR_04250W). The homology between the different Ndt80-family proteins is restricted to the DNA-binding domains. (B) Growth of ndt80Δ and ron1Δ cells on GlcNAc and other sugars. Dilutions of cells were spotted onto synthetic medium plates containing the indicated sugar. The genotype of the strain in each row is indicated on the left. (C) Comparison of ron1Δ cells with known GlcNAc mutants for ability to grow on different sugars. The sugars were present at 50 mM, except for the plates containing only GlcNAc, which was present at 2.5 mM to limit growth of the ngt1Δ mutant. Plates were incubated at 30° for 2 days and then photographed. The ron1Δ mutant was specifically defective in growing on the hexosamine sugars glucosamine and GlcNAc. The wild-type control strain was DIC185, ron1Δ was SN1424, and the ron1Δ + RON1 complemented strain was SN1425. Other strains used are indicated in Table 1. (D) Diagram illustrating the steps in catabolism of GlcNAc. The proteins that catalyze each step are indicated above the arrows.

The C. albicans ron1Δ mutant grew well on other sugars, including glucose, fructose, maltose, and galactose (Figure 1, B and C). These results indicate that Ron1 plays a specific role in regulating the ability of cells to grow on the hexosamine sugars, such as GlcNAc and glucosamine. Comparison with known GlcNAc mutants demonstrated that the ron1Δ mutant was distinct from cells lacking the GlcNAc transporter (ngt1Δ), which grew well on glucosamine (Figure 1C). (See Figure 1D for a diagram of the GlcNAc catabolic pathway.) The ron1Δ mutant differed from the dac1Δ and nag1Δ mutants in that it grew well on medium containing both galactose and GlcNAc, indicating that GlcNAc does not have a deleterious effect on the growth of the ron1Δ mutant as it does for the mutants lacking the enzymes needed to deacetylate (dac1Δ) or deaminate (nag1Δ) GlcNAc. Thus, the ron1Δ mutant was most similar to the strains that lack the GlcNAc kinase (hxk1Δ) or the entire GlcNAc catabolic gene cluster (hxk1Δ nag1Δ dac1Δ).

NGS1 is important for growth on GlcNAc and other sugars

Another type of gene commonly found near the GlcNAc catabolic gene cluster has been referred to as NGS1 in C. albicans, and is distinguished by containing two domains: an N-terminal region similar to family 3 glycohydrolases that cleave GlcNAc-containing sugar polymers and a C-terminal domain similar to GNAT family N-acyltransferases (Su et al. 2016). Interestingly, the glycohydrolase domain is lacking a conserved His residue at position 197 that is required for catalytic activity in other family members (Figure 2A) (Litzinger et al. 2010). In addition, the conserved Tyr-736 is substituted with Phe, suggesting that this protein would lack N-acyltransferase activity (Qin et al. 2015). In spite of this, Ngs1 was reported to act as an acetyltransferase in conjunction with the Rep1 transcription factor (Su et al. 2016).

Figure 2.

NGS1 gene is needed for growth on GlcNAc and other sugars. (A) Diagram illustrating the relative position of two domains present in Ngs1; an N-terminal region similar to family 3 glycohydrolases and a C-terminal domain similar to GNAT family acetyltransferases. Residues 195 and 197 are key for glycohydrolase activity in other species, but residue 197 is not conserved in C. albicans Ngs1 (Litzinger et al. 2010). Similarly, residue 736 is highlighted because there is a Phe at this position rather than a Tyr that is expected for catalytically active GNAT transferases (Qin et al. 2015). (B) Dilutions of the cells indicated on the left were tested for ability to grow on synthetic medium containing the sugars indicated at the top. Note that the ngs1Δ mutant showed poor growth on maltose in addition to GlcNAc and glucosamine. (C) Comparison of ngs1Δ cells with known GlcNAc mutants for ability to grow on different sugars. The sugars were present at 50 mM, except for the plates containing only GlcNAc, which was present at 2.5 mM to limit growth of the ngt1Δ mutant. Plates were incubated at 30° for 2 days and then photographed. (D) The cells indicated on the left were spotted on plates containing the indicated medium and then incubated at a higher temperature of 37°, which exacerbated the growth defects of the ngs1Δ mutant on other sugars, including galactose and maltose. The wild-type control strain was LLF100, the ngs1Δ strain was SN1429, and the ngs1Δ + NGS1 complemented strain was SN1430. Other strains used are indicated in Table 1.

An ngs1Δ mutant showed poor growth on GlcNAc and glucosamine, similar to results published recently while our study was in preparation (Su et al. 2016). However, we found that the ngs1Δ mutant has additional phenotypes, including poor growth on maltose (Figure 2B). These phenotypes were exacerbated at 37°, where there was essentially no growth of the ngs1Δ mutant on maltose (Figure 2D). The growth of the ngs1Δ mutant was slightly slower on galactose plus GlcNAc, similar to the inhibitory effect of GlcNAc on the growth of the nag1Δ and dac1Δ mutants (Figure 2C). This toxic effect of GlcNAc is thought to be due to depletion of UTP as a result of too much GlcNAc-6-PO4 going into the anabolic pathway that forms UDP-GlcNAc when the catabolic pathway is blocked (Naseem et al. 2011). Consistent with this, the inhibition of growth was abrogated in a ngs1Δ hxk1Δ double mutant that lacked the Hxk1 GlcNAc kinase (Figure 2D), thereby blocking the ability of GlcNAc to be metabolized. However, deletion of hxk1Δ did not rescue the poor growth of the ngs1Δ mutant on galactose or maltose media (Figure 2D).

Control studies revealed another growth defect of the ngs1Δ mutant in that it was slow in adapting to a change from rich YPD medium to minimal synthetic medium (Figure S1 in File S1). The lag in growth was seen for cells switched from YPD to minimal media containing either dextrose or maltose. Deletion of HXK1 from the ngs1Δ strain showed that, as expected, the ngs1Δ hxk1Δ double mutant was not susceptible to the toxic effects of GlcNAc (Figure S2 in File S1). However, the ngs1Δ hxk1Δ mutant still grew poorly on maltose. These results indicate that Ngs1 plays a broader role, and does not specifically regulate GlcNAc metabolism.

RON1 and NGS1 are not required for growth on nonfermentable carbon sources

While screening collections of deletion mutants, we discovered that mutants with mitochondrial defects grew poorly on GlcNAc. For example, mci4Δ and nuo1Δ were defective in growing on GlcNAc and the nonfermentable carbon sources glycerol and acetate (Figure 3). These mutants lack components of the mitochondrial respiratory chain complex I (She et al. 2015). In contrast, both ron1Δ and ngs1Δ grew well on glycerol and acetate (Figure 3). This indicates that RON1 and NGS1 directly regulate GlcNAc metabolism, as they are not needed for mitochondrial respiration.

Figure 3.

Defective ability of ron1Δ and ngs1Δ mutants to grow on GlcNAc is not due to defects in mitochondrial function. Ability of (A) ron1Δ and (B) ngs1Δ mutants to grow on the nonfermentable carbon sources acetate and glycerol. Dilutions of cells indicated on the left were spotted onto synthetic medium containing the carbon source indicated at the top. The mitochondrial mutants with defects in complex I of the respiratory chain (nci4Δ and muo1Δ) showed growth defects on GlcNAc and on the nonfermentable carbon sources. (C) Hyphal induction of the mitochondrial mutants nci4Δ and muo1Δ. The indicated strains were grown in galactose medium and then GlcNAc was added to 50 mM to half the culture. Cells were incubated at 37° for 4 hr and then photographed. Bar, 10 µM. The strains included nci4Δ strain (SN1434) and muo1Δ strain (SN1425). The other strains in (A) are described in the legend to Figure 1 and the strains in (B) are described in the legend to Figure 2.

Although the mitochondrial mutants did not grow well on GlcNAc medium, it was interesting that they could grow well on galactose + GlcNAc medium and could be induced to form hyphae (Figure 3C). Thus, mitochondrial function is important for GlcNAc metabolism, but not for hyphal induction.

RON1 regulates expression of GlcNAc catabolic genes

To determine whether RON1 is needed for expression of the GlcNAc catabolic genes we carried out high-throughput sequencing of RNAs (RNA-seq) from cells grown in dextrose vs. cells shifted to GlcNAc medium for 30 min (Figure 4A and Table S1 in File S2). Although the ron1Δ cells do not grow on GlcNAc, they can be sustained for this 30-min incubation by nutrient stores and by metabolizing amino acids added to the medium. To simplify some of the metabolic transitions caused by this shift in media, we also compared cells grown in galactose to cells grown in galactose plus GlcNAc for 30 min. Galactose does not repress the GlcNAc genes as does dextrose (Gunasekera et al. 2010), so GlcNAc can be added as an inducer into the galactose medium. This has the advantages that it does not require washing the cells and does not lead to activation of glucose-repressed genes. As expected for the wild-type control cells, the previously identified GlcNAc-regulated genes were all highly induced >30-fold by GlcNAc (Figure 4A). This set of genes (NGT1, HXK1, DAC1, NAG1, and GIG1) is specifically regulated by GlcNAc, as these genes do not require induction of the hyphal pathway to be induced (Kumar et al. 2000; Gunasekera et al. 2010). There were no significant changes in the levels of actin (ACT1) or other control genes caused by GlcNAc under either condition (Figure 4A and Table S2 in File S2).

Figure 4.

The ron1Δ mutant is defective in inducing the GlcNAc catabolic genes. (A) Regulation of the GlcNAc catabolic genes in wild-type (DIC185) and ron1Δ (SN1424) strains, as indicated at the top. Color-coded map of RNA-seq results shows log₂ ratios of TPMs (transcripts per million reads) for cells grown in GlcNAc vs. dextrose, or galactose + GlcNAc vs. galactose. (Note that gray indicates a log2 ratio could not be calculated due to a zero value.) Cells were grown at 37° in 50 mM dextrose and then switched to 50 mM GlcNAc for 30 min, or grown in 50 mM galactose and then GlcNAc was added to one sample for 30 min. Samples were analyzed as described in the Materials and Methods. (B) NGT1-GFP and HXK1-GFP reporter genes were constructed in wild-type control cells (SN1421 and SN1422) and in ron1Δ cells (SN1426 and SN1427) by tagging the 3′ end of the open reading frame with GFP. Cells were grown at 30° in 50 mM galactose medium, GlcNAc was added to part of the sample for 2 hr, and then the cells were photographed by fluorescence microscopy to detect GFP fluorescence (lower panels). Upper panels show light microscope images as a reference for cell morphology. Bar, 10 µm.

In contrast to wild-type cells, the ron1Δ mutant was strongly defective as it did not detectably induce the GlcNAc-regulated genes after a shift from dextrose to GlcNAc or a shift from galactose to galactose plus GlcNAc. In particular, the expression levels of the core catabolic genes HXK1, DAC1, and NAG1 were all very low when grown in the absence or presence of GlcNAc (i.e., <13 TPM as compared to 369–9960 TPM for the different genes in wild-type control cells). This indicates that the ron1Δ mutant is defective in growing on GlcNAc because of a failure to induce the GlcNAc catabolic genes.

To confirm the RNA-seq results, we examined the ability of ron1Δ cells to induce two different reporter genes: NGT1-GFP and HXK1-GFP. As expected, both genes were induced in the wild-type control cells (Figure 4B). Ngt1-GFP was present at the plasma membrane, consistent with its role as the GlcNAc transporter. Hxk1-GFP was detected in the cytoplasm. In contrast, the ron1Δ cells did not induce Ngt1-GFP or Hxk1-GFP after a 2-hr incubation (Figure 4B). Similar results were obtained in independent assays and after longer times of incubation with GlcNAc (data not shown). These results extend the RNA-seq results by showing that the ron1Δ mutant is defective in inducing the GlcNAc catabolic genes even after longer times of exposure to GlcNAc.

NGS1 is needed for regulation of GlcNAc catabolic genes

The ngs1Δ mutant was also analyzed by RNA-seq to examine the expression of the GlcNAc catabolic genes (Figure 5A). A previous study examined an ngs1Δ mutant for ability to express a subset of the GlcNAc catabolic genes (NGT1, HXK1, and DAC1) by qRT-PCR, and found that it was defective in inducing these genes in response to 2.5 mM GlcNAc (Su et al. 2016). We observed similar results by RNA-seq using 50 mM GlcNAc, which helped to ensure that the defects in responding to GlcNAc were not due to reduced sensitivity to a low dose of GlcNAc. The RNA-seq results also showed that the ngs1Δ mutant failed to induce other GlcNAc-regulated genes including NAG1 and GIG1 (Figure 5A). In addition, the ngs1Δ mutant failed to induce the GlcNAc genes in galactose plus GlcNAc medium. Although the GlcNAc genes were not significantly induced in the ngs1Δ mutant, the basal level of HXK1 expression was ∼10-fold higher in the ngs1Δ mutant than in the ron1Δ mutant (Table S2 in File S2), consistent with the susceptibility of the ngs1Δ mutant to the toxic effects of GlcNAc, which requires the function of HXK1 (Figure 2D).

Figure 5.

The ngs1Δ mutant is defective in regulating the GlcNAc catabolic genes. (A) Regulation of the GlcNAc catabolic genes in wild-type (LLF100) and ngs1Δ (SN1428) strains, as indicated at the top. Color coded map of RNA-seq results shows log₂ ratios for cells grown in GlcNAc vs. dextrose, or galactose + GlcNAc vs. galactose. Cells were grown at 37° in 50 mM dextrose and then switched to 50 mM GlcNAc for 30 min, or grown in 50 mM galactose and then GlcNAc was added to one sample for 30 min. Samples were analyzed as described in the Materials and Methods. (B) NGT1-GFP and HXK1-GFP reporter genes were constructed in wild-type control cells (SN1421 and SN1422) and in ngs1Δ (SN1431 and SN1432) cells by tagging the 3′ end of the open reading frame with GFP. Cells were grown at 30° in 50 mM galactose medium, GlcNAc was added to part of the sample for 2 hr, and then the cells were photographed by fluorescence microscopy to detect GFP fluorescence (lower panels). Upper panels show light microscope images as a reference for cell morphology. Bar, 10 µm.

To confirm the RNA-seq results, NGT1-GFP and HXK1-GFP reporter genes were introduced into the ngs1Δ mutant. As for the ron1Δ mutant, the ngs1Δ mutant did not induce these reporter genes after a 2-hr induction in galactose plus GlcNAc medium (Figure 5B). Similar results were observed at longer times of incubation including overnight incubation (data not shown). Altogether, these results indicate that the ngs1Δ mutant is strongly defective in inducing the family of GlcNAc-regulated genes.

The ron1Δ and ngs1Δ mutants are defective in responding to GlcNAc to form hyphae in liquid medium

To determine whether the mutant cells could be induced to form hyphae, they were grown in medium containing galactose to provide a source of energy and then GlcNAc was added to 2.5, 50, or 250 mM. As expected, the wild-type control strain was induced to form filamentous cells under all three conditions (Figure 6). Although the ngt1Δ mutant lacking the GlcNAc transporter did not form hyphae efficiently at 2.5 mM GlcNAc, it was induced at the higher concentrations of GlcNAc where this sugar can be taken up by alternative pathways (Alvarez and Konopka 2007). In contrast, both the ron1Δ and ngs1Δ cells showed a strong defect in forming hyphae even at the higher concentrations of GlcNAc (Figure 6B).

Figure 6.

The ron1Δ mutant has a partial defect and ngs1Δ mutant is strongly defective in forming hyphae in response to GlcNAc. (A) The cells indicated on the left were incubated in synthetic medium containing the sugar indicated at the top. Some samples were grown in the presence of 10 mM PIPES to buffer the ambient environment to pH 6.8. One set of samples was induced with 10% serum to form hyphae. Note that the ron1Δ and ngs1Δ mutants were defective in being induced by GlcNAc to form hyphae, but both strains were induced efficiently by serum. Samples were incubated at 37° for 4 hr and then photographed. Bar, 10 µM. (B) Graph summarizing the percent of filamentous cells after growth in the indicated conditions. The wild-type control strain was DIC185, the ron1Δ strain was SN1424, the ron1Δ + RON1 complemented strain was SN1425, the ngs1Δ strain was 1429, and the ngs1Δ + NGS1 complemented strain was SN1430.

The ron1Δ mutant was distinct in that it formed an elevated level of filamentous cells when grown in galactose (Figure 6). About 6.5% of the ron1Δ cells were in a filamentous morphology in galactose medium, as compared to ∼3.3% for the wild-type control (P < 0.05). This is consistent with the elevated basal level of expression of hyphal-specific genes in the ron1Δ mutant (see below). The number of filamentous cells went up to ∼10% with 2.5 mM GlcNAc and then increased to ∼20% in medium containing 50 mM GlcNAc or 250 mM GlcNAc (Figure 6B). These results indicate that although the ron1Δ mutant showed an increased basal level of filamentous growth, it was only weakly induced by GlcNAc to form additional hyphae.

The ron1Δ mutant was also tested for hyphal growth in medium buffered with PIPES to raise the pH to ∼6.8, as would normally occur for wild-type cells grown in GlcNAc. Whereas cells grown in dextrose or galactose acidify the medium, cells grown in GlcNAc raise the ambient pH, which can synergize with GlcNAc to stimulate hyphal growth (Naseem et al. 2015). However, raising the ambient pH with PIPES did not increase the ability of GlcNAc to induce the ron1Δ mutant (Figure 6).

The ngs1Δ mutant was strongly defective in hyphal growth; there were essentially no filamentous cells detected even after treatment with high concentrations of GlcNAc or the addition of PIPES to raise the ambient pH. The hyphal defect was not due to the inhibitory effects of GlcNAc on the growth of ngs1Δ cells, since deletion of HXK1 from ngs1Δ prevented the inhibitory effects of GlcNAc (Figure 2D) but the ngs1Δ hxk1Δ cells did not form hyphae in response to GlcNAc (Figure 7B). During our studies, Su et al. (2016) reported that deleting HXK1 from the ngs1Δ mutant restored the ability to form hyphae. The reason for these differences are unclear. However, we note that we were careful to preculture the cells at 37° and to maintain them at low cell density to prevent hyphal induction caused by a temperature shift or the removal of farnesol when diluting dense cultures of cells (Enjalbert and Whiteway 2005). These were important factors to consider, as the ngs1Δ and ron1Δ mutants can respond to other hyphal inducers (see below).

Figure 7.

The ron1Δ mutant was delayed in forming invasive hyphae on GlcNAc medium whereas the ngs1Δ mutant was strongly defective. (A) The cells indicated on the left were spotted onto agar plates containing the sugar listed at the top. The plates were incubated at 37° and then photographed after the indicated number of days. Note that the ron1Δ cells showed a delay in forming invasive hyphae into medium containing GlcNAc. The ngs1Δ mutant was strongly defective and did not form invasive filaments. (B) Analysis of ngs1Δ hxk1Δ cells for invasive growth as described above. Cells were grown on galactose plus GlcNAc medium for 4 days and then the edge of the spot of cells was photographed. The strains included the wild-type control (DIC185), ron1Δ (SN1424), ron1Δ + RON1 complemented strain (SN1425), ngs1Δ (SN1429), and ngs1Δ + NGS1 complemented strain (SN1430), and two independent isolates of ngs1Δ hxk1Δ (KM1433).

To determine whether the ron1Δ and ngs1Δ mutants were defective in responding to other hyphal inducers, we examined their ability to be stimulated by serum, which contains several factors that promote hyphal morphogenesis (Xu et al. 2008). Interestingly, both the ron1Δ and ngs1Δ mutants were stimulated efficiently by serum to form hyphae (Figure 6). These results suggest that Ron1 and Ngs1 function in an upstream step specific to GlcNAc, rather than a downstream step that would be required in common by other inducers of hyphal growth.

The ron1Δ mutant shows delayed invasive hyphal growth and the ngs1Δ mutant is strongly defective

The mutant cells were also tested for ability to undergo invasive hyphal growth into agar in a GlcNAc-dependent manner. Wild-type control cells formed detectable invasive hyphae within 1 day after spotting the cells onto the surface of an agar plate containing galactose plus GlcNAc, and the zone of hyphal growth continued to expand through day 4 (Figure 7A). This invasive hyphal growth was stimulated by GlcNAc, as there were essentially no detectable hyphae emanating from the zone of growth for the wild-type cells spotted onto galactose or dextrose medium.

The ron1Δ mutant showed only rare hyphal outgrowths after 1 day of incubation on agar containing galactose plus GlcNAc, but hyphal cells could be readily seen by day 2 and 3 (Figure 7A). After 4 days of incubation there was extensive invasive growth into the agar. As for the wild-type control cells, this invasive growth was dependent on GlcNAc. There were essentially no hyphal filaments seen invading into the agar for ron1Δ cells grown on galactose. This shows that ron1Δ cells are capable of invasive hyphal growth, but are delayed in comparison to the wild type.

The ngs1Δ cells were strongly defective in invasive growth, as there were no hyphal outgrowths seen even after 4 days of incubation on galactose plus GlcNAc agar (Figure 7A). To determine whether GlcNAc toxicity played a role in this, we examined ngs1Δ hxk1Δ cells and found that they were completely defective in forming invasive hyphae (Figure 7B). Thus, the hyphal defect of ngs1Δ cells does not appear to be due to the cells taking a longer time to adapt to new media or to the toxic effects of GlcNAc on the growth of this mutant.

Abnormal regulation of hyphal-specific genes in ron1Δ and ngs1Δ mutants

To gain a better understanding of the ron1Δ and ngs1Δ defects in hyphal morphogenesis, we examined the RNA-seq data for the expression of a set of genes that are induced by GlcNAc and other hyphal-inducing stimuli (Figure 8A). Interestingly, most of the hyphal-induced genes that were identified in previous microarray studies were also induced by the transition from dextrose to GlcNAc (Gunasekera et al. 2010; Naseem et al. 2015). The observation that some hyphal genes were not as highly induced as in previous studies may reflect the fact that the cells were only induced for 30 min in the RNA-seq study shown in Figure 8, whereas previous microarray studies used a 2-hr induction. Consistent with a previous microarray study, hyphal genes were not as highly induced in galactose + GlcNAc medium as compared to GlcNAc alone (Naseem et al. 2015). A set of control genes including ACT1 (actin), CYR1 (adenylyl cyclase), and NRG1 (hyphal repressor), did not show a significant change in expression in the presence or absence of GlcNAc.

Figure 8.

Abnormal regulation of hyphal-specific genes in ron1Δ and ngs1Δ mutants. Summary of RNA-seq results for expression of hyphal genes in wild-type control cells vs. (A) ron1Δ or (B) ngs1Δ mutants. The color-coded diagram illustrates the relative log₂ change in gene expression as indicated by the scale bar at the bottom. The left side shows the fold induction of a set of hyphal-regulated genes by GlcNAc for cells grown in GlcNAc vs. dextrose, or galactose + GlcNAc vs. galactose. The right side compares the basal level of expression of the hyphal genes for ron1Δ vs. wild-type control cells grown in dextrose or in galactose, as indicated. Numbers in white boxes correspond to TPM values that included a zero value, which prevented calculation of a log₂ ratio.

The set of 11 hyphal genes was not significantly induced by GlcNAc in the ron1Δ cells, consistent with the defect of this mutant in hyphal morphogenesis. However, the hyphal genes were expressed at a high basal level in the ron1Δ mutant under noninducing conditions. All 11 hyphal genes showed an elevated level of expression in ron1Δ cells vs. the wild-type control cells when cells were grown in glucose, and similar results were seen in galactose (Figure 8A, right side). In contrast, control genes, such as ACT1, CYR1, and NRG1, did not show a significant difference in expression between ron1Δ and wild-type cells grown in dextrose or galactose. The high basal level of expression correlates with the presence of filamentous cells in cultures of ron1Δ cells grown in galactose (Figure 6) or dextrose (data not shown). Altogether, these results indicate that Ron1 is important both to induce hyphal genes and to prevent their expression in the absence of GlcNAc.

The ngs1Δ mutant showed a very different profile of hyphal-specific gene expression (Figure 8B). There was no consistent pattern for the effects of GlcNAc on the set of hyphal genes in the ngs1Δ cells. A subset of the hyphal genes may have been weakly induced (<fourfold), but the magnitude of these changes was usually minor since the majority of hyphal genes showed lower basal levels of expression in the ngs1Δ cells. These results are consistent with the strong defect of ngs1Δ cells in hyphal morphogenesis in response to GlcNAc.

Discussion

GlcNAc is well known as a structural component of the fungal cell surface, and is now emerging as an important signaling molecule in a wide range of fungi. For example, in C. albicans GlcNAc stimulates hyphal morphogenesis, gene expression, epigenetic switching from white to opaque phase, and under special conditions, cell death (Simonetti et al. 1974; Kumar et al. 2000; Huang et al. 2010; Du et al. 2015; Naseem and Konopka 2015). GlcNAc also stimulates hyphal morphogenesis in the yeast Yarrowia lipolytica as well as the dimorphic fungal pathogens Histoplasma capsulatum and Blastomyces dermatitidis (Kim et al. 2000; Gilmore et al. 2013). Other studies have implicated GlcNAc in colonization of rice by Magnaporthe oryzae (Kumar et al. 2016) and for recycling of chitin in intraradical mycelium of arbuscular mycorrhizal fungi (Kobae et al. 2015). GlcNAc signaling is also important for a broad range of organisms beyond the fungal kingdom, as it regulates virulence functions in bacteria and inflammasome activation in mammalian cells (Naseem and Konopka 2015; Wolf et al. 2016).

The mechanisms of GlcNAc signaling are not well defined, in part because the model yeasts S. cerevisiae and Schizosaccharomyces pombe have lost the genes required to metabolize exogenous GlcNAc and do not appear to respond to it (Alvarez and Konopka 2007; Wendland et al. 2009). Thus, studies on GlcNAc signaling in C. albicans are providing a useful model for understanding the mechanisms by which GlcNAc regulates cell signaling. To better define the mechanisms of GlcNAc-regulated morphogenesis and gene expression in this study, we identified and characterized two genes needed for the ability to grow on GlcNAc: RON1 and NGS1. As discussed further below, the results were surprising in that these genes were also important for hyphal induction by GlcNAc.

Ngs1 regulates growth on GlcNAc and other sugars

Ngs1 belongs to a group of proteins containing a family 3 glycohydrolase domain and a GNAT acetyltransferase domain (Qin et al. 2015). The Ngs1 amino acid sequence predicts it is defective in glycohydrolase activity (Figure 2A), which suggests it could act as a sensor by binding GlcNAc. Recent studies by Su et al. (2016) suggested that Ngs1 acts with the Ndt80-family transcription factor Rep1 to regulate the GlcNAc catabolic genes by binding GlcNAc with the N-terminal glycohydrolase domain and then influencing gene expression via the GNAT family acetyltransferase domain. This is consistent with the defect of ngs1Δ cells in inducing the GlcNAc catabolic genes in our studies (Figure 5). However, we found that Ngs1 has a complex function; the ngs1Δ mutant grew poorly on maltose, especially at 37° (Figure 2). The ngs1Δ mutant was also slow to resume growth when the carbohydrate source was switched, and or when cells were switched from rich YPD medium to synthetic medium (Figure 2 and Figures S1 and S2 in File S1). These results are consistent with reports that the Rep1 has other roles, including regulating the expression of the MDR1 drug efflux pump (Hiller et al. 2006). Thus, Ngs1 does not specifically regulate the GlcNAc catabolic genes.

The ngs1Δ mutant was strongly defective in responding to GlcNAc to undergo hyphal morphogenesis (Figure 6 and Figure 7). This was not due to an inhibitory effect of GlcNAc on growth, since deletion of HXK1 to create ngs1Δ hxk1Δ double mutant abrogated the toxic effects of GlcNAc but did not enable cells to form hyphae (Figure 2, Figure 7, and Figure S2 in File S1). Based on the broad role of Ngs1 in metabolism, it is difficult to assign a specific role for Ngs1 in transducing the GlcNAc signal to induce hyphae. It will likely require special mutations to distinguish the role of Ngs1 in transducing a signal for GlcNAc vs. other sugars. However, Ngs1 does show some specificity in that the ngs1Δ cells could be induced by serum to form hyphae (Figure 6).

Ron1 regulates GlcNAc catabolic genes and hyphal morphogenesis

Consistent with the failure to grow on GlcNAc medium, RNA-seq studies showed that the C. albicans ron1Δ mutant failed to express the GlcNAc catabolic genes (Figure 4A). Analysis of two reporter genes (NGT1-GFP and HXK1-GFP) showed that the ron1Δ mutant was strongly defective in inducing these genes in response to GlcNAc, even after long periods of induction (Figure 4B). Ron1 appears to be specific for amino sugars, as the ron1Δ mutant grew well on other sugars, such as maltose and galactose (Figure 1). Thus, although C. albicans Ndt80, Rep1, and Ron1 all contain a similar DNA-binding domain, only Ron1 appears to be specific for regulating GlcNAc catabolism.

A ron1Δ mutant was partially defective in forming hyphae in response to GlcNAc, which is the first evidence for a role of Ron1 in hyphal morphogenesis. Although the ron1Δ cells showed a slightly higher basal level of filamentous cells under noninducing conditions, the mutant cells were only induced to a limited degree to form hyphal cells after a short exposure to GlcNAc in liquid (Figure 6). Longer induction on solid agar plates demonstrated that ron1Δ cells could form extensive invasive hyphal filaments after delay of ∼24–48 hr compared to the wild type (Figure 7). This defect was surprising, since the GlcNAc catabolic genes (HXK1 NAG1 DAC1) are not required for induction of hyphal responses (Naseem et al. 2011). One difference between ron1Δ and the hxk1Δ nag1Δ dac1Δ triple mutant is that ron1Δ cells also fail to induce GIG1 (Figure 4). However, the absence of GIG1 expression is unlikely to be the basis for the ron1Δ hyphal defect because a gig1Δ mutant does not have a hyphal defect (Gunasekera et al. 2010) and a quadruple mutant lacking the GlcNAc catabolic genes and GIG1 (hxk1Δ nag1Δ dac1Δ gig1Δ) formed hyphae efficiently (Figure S3 in File S1).

Control studies showed that the ron1Δ morphogenesis defect was specific to GlcNAc, since hyphal growth could be induced by serum (Figure 6). Furthermore, the failure of ron1Δ cells to induce hyphae was not due to an inhibitory effect on growth that is seen for the nag1Δ, dac1Δ, or ngs1Δ mutants (Figure 1). Interestingly, the elevated level of filamentous cells seen when the ron1Δ mutant was grown in medium containing noninducing sugars, such as galactose (Figure 6), correlated with the increased basal level of hyphal-regulated genes (Figure 8). This indicates that Ron1 also negatively regulates the hyphal genes. Thus, the partial defect of ron1Δ cells in undergoing hyphal growth in response to GlcNAc may stem from abnormal regulation of the hyphal pathways in these mutant cells.

Mitochondrial function is needed for GlcNAc catabolism, but not hyphal growth

Mitochondrial complex 1 mutants mci4Δ and nuo1Δ grew poorly on GlcNAc (Figure 3), as did several other mitochondrial mutants in the deletion mutant collection created by Noble et al. (2010). This likely explains why other mutants with defects in growing on nonfermentable carbon sources fail to grow on GlcNAc (Guan et al. 2015; Jia et al. 2015). One possibility is that this is related to the ability of GlcNAc to induce cell death under special conditions, which is correlated with increased mitochondrial activity (Du et al. 2015). Interestingly, the mci4Δ and nuo1Δ mitochondrial mutants grew well in the presence of galactose plus GlcNAc, and could be induced to form hyphae (Figure 3). Although mitochondrial function has been linked to the cAMP pathway and regulation of hyphal growth (Morales et al. 2013), it may not be important for GlcNAc to induce hyphae since this amino sugar can activate cAMP-independent pathways (Parrino et al. 2017).

Role of transcription factors in hyphal morphogenesis

A large set of transcription factors regulates the induction of filamentous growth by hyphal inducers or biofilm-forming conditions, including Efg1, Cph1, Bcr1, Bgr1, Tec1, Ume6, Rim101, Nrg1, and Tup1 (Finkel and Mitchell 2011; Carlisle and Kadosh 2013; Lu et al. 2014). Although this suggests it should be possible to identify target genes that stimulate hyphal morphogenesis, this goal has been elusive. Only a core set of eight genes was induced under a variety of different hyphal growth conditions, and none of these genes is key for hyphal growth (Martin et al. 2013). In addition, hyphae can be induced under some conditions with limited or no obvious induction of the typical hyphal-regulated genes (Naseem et al. 2015). Furthermore, a recent study found that diminished expression of the CAK1 protein kinase could bypass several of the transcription factors that are needed for hyphal morphogenesis (Woolford et al. 2016). Thus, the role of transcriptional regulators in hyphal morphogenesis is complex. The special role for Ron1 in GlcNAc signaling therefore provides an important new tool for defining the interplay between transcription factors and hyphal morphogenesis.

Supplementary Material

Supplemental material is available online at www.genetics.org/lookup/suppl/doi:10.1534/genetics.117.201491/-/DC1.