Skip to main content
Iranian Journal of Biotechnology logoLink to Iranian Journal of Biotechnology
. 2015 Mar;13(1):36–42. doi: 10.15171/ijb.1034

Identification of Crocus sativus and its Adulterants from Chinese Markets by using DNA Barcoding Technique

Wei-juan Huang 1, Fei-fei Li 1, Yu-jing Liu, Chun-lin Long 1,2,*
PMCID: PMC5434985  PMID: 28959279

Abstract

Background

Saffron (Crocus sativus L.) is a common but very expensive herbal medicine. As an important traditional medicine, it has an outstanding effect in treating irregular and painful menstruation. Recently, the over-demand tendency of saffron results in an unusual phenomenon in the medicinal markets. Adulterants and saffron-like substitutes are intentionally mixed into medicinal markets and pharmacies or online stores, affecting drug safety and food quality.

Objectives

Our study aimed to identify saffron from its adulterants via DNA barcoding.

Materials and Methods

Samples (13 saffron + 4 others containing Carthamus tinctorius or Chrysanthemum x morifolium) obtained from 12 different provinces of China. Through DNA barcoding, samples were compared using three candidate markers, trnH-psbA, rbcL-a and ITS2.

Results

trnH-psbA and rbcL-a were capable of distinguishing different accessions. ITS2 could identify samples even at intra-specific level. According to these three barcodes, four samples were identified saffron-like substitutes.

Conclusions

The adulterant rate in Chinese markets reaches as high as 33.33% that may cause health risks and further may reduce saffron efficacy once is being used as herbal remedy. In order to make a distinction between C. sativus with other genera as adulterants, DNA barcoding is suggested.

Keywords: Adulterant identification, Classification, Crocus sativus, DNA barcoding

1. Background

Crocus sativus L., commonly known as saffron, or Zang-Hong-Hua in Chinese, is a perennial stemless herb of Iridaceae (1). Saffron originally grew in Iran, India, Spain, Greece. It has been also successfully cultivated in various places in China for many centuries (2). Since ancient times, the dried stigmas of C. sativus have been considered as the most precious and expensive medicine (3, 4). In folk, it is commonly used for its analgesic and/or sedative properties. In traditional Chinese medicine (TCM), it has been used as an anti-anginal (2). The other pharmacological activities of saffron, such as anti-cancer, anti-inflammatory, and anti-atherosclerotic activities have also been reported (5, 6). The major active constituents responsible for these biological activities are two natural carotenoids, crocin and crocetin (7). For example, crocetin, an antioxidant, has memory enhancing effects in aged mice (8) and crocin demonstrated to be useful in pharmacological alleviation of cognitive defects (9). Even saffron odor may be effective in treating menstrual distress (10). In addition, people use saffron to season their food for its flavor and taste.

However, due to the limited production and labor-intensive process of harvesting, it is sold at an extremely high price around $2,000/kg. Due to its high demand and price, adulterations are common with the crude drugs of Carthamus tinctorius, Chrysanthemum x morifolium, Zea mays and Nelumbo nucifera (11-14). These plants have fiber-type structure similar to C. sativus anthers that makes the differentiation rather impossible by just morphological investigation. However, the contents of the active compounds of these adulterants are distinct from that of saffron that obviously reduce the efficacy of C. sativus. Thus, for the benefits of consumers and the quality control of saffron, its correct identification is a must.

Although herbal medicine has a great sayings in pharmalogical sciences, it suffers from contaminations that may occur through the processing steps during collection, drying and grinding (15). To check the authenticity of a medicine, physical, chemical, and molecular marker techniques are amongst the suggested methods. Although physical methods such as microscopy are easy to operate, the amount of helpful data to check the purity of product is not enough. Chemical methods such as chromatography or spectroscopic analysis are time-consuming and cost-effective and may be strongly influenced by the experimental conditions. DNA barcoding on the other hand that takes advantage of using particular nuclear or organellar genome sequences as genetic markers seems a way forward in determination any impurities. This technique is rapid, sensitive, accurate and simple and in our case is efficient for species identification (16-18).

Recently, this technique has been widely applied to discriminate medicinal herbs of TCM, such as Codonopsis Radix, Paeoniae Radix Rubra, Clematis chinensis, using ITS2 (19-21). Sabia species and Radix astragali were correctly identified by the combined DNA barcodes (22, 23). Therefore, use of DNA barcodes in identification of medicinal herbs is recommended.

According to previous saffron identification studies, most materials came from wild or garden species (24, 25). The authentication of saffron from medicinal markets or drugstores was rarely tested (26). In this study, we employed three DNA barcodes, including trnH-psbA intergenic spacer (trnH-psbA), large subset of ribulose-bisphosphate carboxylase (rbcL-a) and nuclear internal transcribed spacer 2 (ITS2), to differentiate saffron from its adulterants by sequences diversity analysis.

2. Objectives

Our objectives were not only to investigate and detect the market substitution of saffron, but also to identify what the adulterants were as well as to remind people to be cautious to select.

3. Materials and Methods

3.1. Plant Materials

All 13 samples were called Zang-Hong-Hua in Chinese, which meant they had been used or sold as saffron (C. sativus). They were collected from 12 different provinces. Among them, only two samples were identified as C. sativus (S1) and Carthamus tinctorius (C1) respectively, based on their morphological characteristics. Other 11 samples unidentified, labeled saffron were bought from medicinal markets and drugstores during 2012-2013 (Table 1). These samples were from commercial products, except the one from Nanjing Botanical Garden Mem. Sun Yat-Zen. The familiar adulterants, such as Carthamus tinctorius (C2), Nelumbo nucifera (NN), Crysanthemum x morifolium (CM) and Zea mays (ZM), their relevant gene sequence numbers downloaded from Genbank were also listed in Table 1.

Table 1. Plant samples used in the study .

Latin name Sample ID Origin Genbank No.
Crocus sativus

(To be determined)

(To be determined)

(To be determined)
(To be determined)
(To be determined)

(To be determined)
(To be determined)
(To be determined)
(To be determined)
(To be determined)
(To be determined)
Carthamus tinctorius
Carthamus tinctorius
Nelumbo nucifera
Chrysanthemum x
morifolium
Zea mays
S1

S2

S3

S4
S5
S6

S7
S8
S9
S10
S11
S12
C1
C2
NN
CM

ZM
Nanjing Botanical Garden Mem.
Sun Yat-Sen, Jiangsu
Shanghai Plantation, Shanghai
Beijing Tongrentang Pharmacy,
Beijing
Lhasa Pharmacy, Xizang
Bozhou medicinal market, Anhui
Chengdu medicinal market,
Sichuan
Nanjing Pharmacy, Jiangsu
Dalian, Liaoning
Baoding, Hebei
Yantan, Shandong
Zhangzhou, Fujian
Kunming, Yunnan
Urumqi, Xinjiang
----
----
----

----

KF88648, KF88658, KF886671

KF886649, KF886659, KF886672

KF886650, KF886660, KF886673

KF886651, KF886661, KF886674
KF886652, KF886662, KF886675
KF886653, KF886663, KF886676

KF886654, KF886664, KF886677
KF886665
KF886666, KF886678
KF886667, KF886679
KF886655, KF886668, KF886680
KF886656, KF886669, KF886681
KF886657, KF886670, KF886682
GQ435089, GU990409, GU724317
AB331309, JN407324, JF977132
GU575275, JF949972, FJ539128

GU575286, M16836, DQ68301

3.2. DNA Isolation, Amplification and Sequencing

Total genomic DNA was isolated from the dried stigma (20 mg each). The stigma of each sample was immersed in liquid nitrogen and crushed into a fine powder. Plant Genome DNA Kit (DP305, Beijing, China) was used for DNA extraction. Quality of the extracted DNA was determined using gel electrophoresis.

Amplifications of the three loci trnH-psbA, rbcL-a, and ITS2 were obtained. The primer pair names, primer sequences, and reaction conditions (27-30) used are listed in Table 2.

Table 2. Primers and reaction conditions used in this study .

Locus Primer name Primer sequence (5'-3') Reaction conditions
trnH-psbA



rbcL-a



ITS2



PA
TH


R-F
R-R


ITS3F
ITS2R


GTTATGCATGAACGTAATGCTC
CGCGCATGGTGGATTCACAATCC


ATGTCACCACAAACAGAGACT
TCGCATGTACCTGCAG-TAGC


ATGCGATACTTGGTGTGAAT
GACGCTTCTCCAGACTACAAT


94ºC 5 min
94ºC 1 min, 55ºC 1 min,
72ºC 1.5 min, 35 cycles
72ºC 7 min
95ºC 2 min
94ºC 1min, 55ºC 30 s,
72ºC 1 min, 34 cycles
72ºC 7min
94ºC 5 min
94ºC 30 s, 56ºC 30 s,
72ºC 45 s, 40 cycles
72ºC 10 min

trnH-psbA: trnH-psbA intergenic spacer; rbcL-a: ribulose-1,4-bisphosphate carboxylase large subunit; ITS2: internal transcribed spacer 2.

Polymerase chain reaction (PCR) amplifications of the three candidate DNA barcode loci carried out in a T100 Thermal Cycler (Bio-Rad, United States) were performed in a 25 μL reaction mixture containing 2.5 μL of 10× PCR buffer, 2.0 μL of 25 mmol.L-1 MgCl2, 2.5 μL of 2.5 mmol.L-1 dNTPs, 0.5 μL of each primer (10 mmol.L-1), 0.5 U of Taq DNA polymerase, 1 μL of genomic DNA (~30 ng) and ddH2O. PCR products were examined using 1% agarose gel electrophoresis in 1×TAE buffer at 100 Volt for about 30 min. Gel images were obtained using Gel documentation imaging system (Bio-Rad, United States). Purifying and sequencing were completed by Biosune Co., Ltd (Beijing, China).

3.3. Sequence Alignment and Analysis

Sequences were assembled and aligned by Clustal X software (Version 1.83) and adjusted manually in CodonCode Aligner (Version 4.2.3). The nucleotide sequences data of the partial trnH-psbA spacer, rbcL-a and ITS2 genes were submitted to Genbank. Genetic distance was computed using MEGA5.2 by Kimura two-parameter (K2P) model (31). Based on each locus, maximum parsimony trees were built with bootstrap testing of 1000 replicates. The DNA sequences were then deposited in Genbank.

4. Results

Three genes from nuclear and chloroplast were selected to discover genetic variations and to carry out analysis on the identification of 11 samples retailed as saffron in different markets. A total of 39 DNA sequences from three DNA barcodes (trnH-psbA, rbcL-a, and ITS2) were generated (Table 3). They were able to differentiate authentic saffron from the substituted ones with inter-specifically variable sites among 11 commodity samples from S2 to S12. The three DNA barcodes were successfully amplified in the order of trnH-psbA (13/13) > rbcL-a (11/13) > ITS2 (10/13). By combining a portion of trnH-psbA gene with ITS2 gene (Figure 1), it was demonstrated that both sequence variations can distinguish C. sativus from different sources at intra-species taxa. Based on the genetic analysis of rbcL-a region, C1 and C2 were separated into two different clades with 67% supporting rate and clustered C1, S11, S12 and CM (C. x morifolium) into one clade with bootstrap support of 98%.

Table 3. Properties of the three DNA barcoding regions of C. sativus and its adulterants. Numbers about the polymorphic sites are their positions in the multiple sequence alignment.

Property Sample trnH-psbA rbcL-a ITS2
Sequence length
avg. (bp)
All inter-specific
distance (K2P)
Selected variable
sites
















S1
S2
S3
S4
S5
S6
S7
S8
S9
S10
S11
S12
C. tinctorius
C. x morifolium
N. nucifera
Z. mays
431
1.04
105bp-112bp
TCGGGAAA
TCGGGAAA
TCGGGAAA
TCGGGAAA
TCGGGAAA
TCGGGAAA
TCGGGAAA
TCGGGAAA
GTAGGATT
GTAGGATT
GTAGTATT
TTAGTAT-
GTAGTATT
GTACTAT-
ATTTTATT
TTTGCGAT
655
0.58
347bp-354bp
CCCCCTGC
CCCCCTGC
CCCCCTGC
CCCCCTGC
CCCCCTGC
CCCCCTGC
CCCCCTGC


CCTCCTGC
CCTACTGC
CCTACTGC
CCTACTGC
CCTACTGC
CCTCCTGC
GTCCCTGT
240
1.27
127bp-134bp
TCCGGCTT
TCCGGCTT
TCCGGCTT
TCCGGCTT
TCCCCCTC
TCCGGCTT
TCCGGCTT



CTAAAGAC
TTAAAAAC
CTAAAGAC
TTAAAAAC
GTGTGACC
CCCGGCGC

Figure 1 .


Figure 1

Classification tree of combining trnH-psbA with ITS2 gene using the Maximum Parsimony (MP) method

Figure 2 .


Figure 2

Classification tree of partial trnH-psbA gene using the Maximum Parsimony (MP) method

Maximum parsimony tree constructed by either single locus or combined loci suggested that the samples were divided into two major clades (Figures 1 and 2). Both of the phylogenetic trees demonstrated that S2 to S8 were authentic saffron among market samples, while S9 (Hebei), S10 (Shandong), S11 (Fujian) and S12 (Yunnan) were not with 99% bootstrap support (BS). The accessions including S9, S10, S11, S12, C1, C2 and CM were divided into two sub-clusters in the trnH-psbA tree. As for the relationship among species, S11 and S12 were closer to C. tinctorius (99% BS) and C. x morifolium (97% BS), respectively through phylogenetic analysis. From Figure 1, S9 and S10 were inferred to be the same species (99% BS) and could belong to Carthamus. Thus, S9 (Hebei), S10 (Shandong), S11 (Fujian) and S12 (Yunnan) were proved not saffron, but its adulterants.

5. Discussion

The result showed that the trnH-psbA region could place an unidentified specimen into a family and even genus (32), while rbcL-a may be effective in identifying specimen at family level. As one of the most common regions used for phylogenetic analyses, the ITS2 region was selected as a barcode candidate that can distinguish accessions from different geographical origin at the species level (33, 34). But one of potentially negative factor for sequencing ITS2 is the presence of poly-G, poly-C, and poly-A repeats (35). Moreover, multi-locus approach may be a much more effective strategy for species identification. As C. sativus and its adulterants are completely in different families, each of the three loci is adequate when used at the family level. In addition, DNA integrity and purity are the major concerns in DNA barcodes. Poor DNA quality and quantity may lead to the unsuccessful amplification of DNA barcodes in some of the commodity samples. When materials are highly processed or stored for a long time, total DNA is highly degraded or contaminated (36) that leads to the DNA amplification and sequencing difficulties.

When presented with a completely unknown sample, it would be highly desirable to place it in a smaller group of taxa (i.e. within one genus) (37). DNA based methods maybe more useful in quickly and efficiently discriminate adulterated or substituted raw materials (38). By using DNA barcoding method, total DNA of species can be achieved from fresh and dried plant parts, processed herbal drugs, as well as tablets and capsules. For its easy operation, DNA barcodes will also be powerful tool for non-professional users. Nowadays, with the exponential growth of international market and increasing demand of high quality medicinal materials, the adulterated or substituted source materials have sprung up and could confuse the wholesalers, retailers and consumers (39). Thus, correct identification by DNA barcoding technique has become an essential task for the regulatory authorities and related industries in order to ensure drugs safety and fair trade. As a result, adverse health problems can be avoided and negative effects such as purchasing products mixed with adulterants or protected species marketed as unprotected species can be reduced (40, 41). Though many substitutions have been disclosed by researchers, still lots of adulterants have remained undiscovered in the medicine market.

Through our research, we found the adulterant rate of saffron from Chinese markets reached as high as 33.33% (excluding the sample we collected from the botanical garden). Saffron can be identified by a unique DNA barcode or a combination of multiple DNA barcodes. This technology is useful in providing a reliable and effective means for the differentiation of saffron from its substitutes or adulterants. With the adoption of barcoding as an authentication tool, perhaps it will be possible to discourage medicinal plants substitution in the marketplace. As a high-valued product, the official authentication and monitoring of saffron become very important in China for safety reasons. And DNA barcode tool is highly recommended.

Acknowledgments

This research was supported by the National Natural Science Foundation of China (3.116114E+10), the Ministry of Education of China (B08044, MUC 2015MDTD16C and YLDX01013) and the Ministry of Science and Technology of China (2012FY110300).

References

  • 1.Ríos JL, Recio MC, Giner RM, Máòez S. An update review of saffron and its active constituents. Phytother Res. 1996;10:189–193. doi: 10.1002/(SICI)1099-1573(199605)10:3<189::AID-PTR754>3.0.CO;2-C. [DOI] [Google Scholar]
  • 2.Li N, Lin G, Kwana YW, Min ZD. Simultaneous quantifica-tion of five major biologically active ingredients of saffron by high-performance liquid chromatography. J Chromatogr A. 1999;849:349–355. doi: 10.1016/S0021-9673(99)00600-7. [DOI] [PubMed] [Google Scholar]
  • 3.Maggi L, Carmona M, Zalacain A, Kanakis CD, Anastasaki E, Tarantilis PA. et al. Changes in saffron volatile profile according to its storage time. Food Res Int. 2010;43:1329–1334. doi: 10.1016/j.foodres.2010.03.025. [DOI] [Google Scholar]
  • 4.Lozano P, Castellar MR, Simancas MJ, Iborra JL. Quantitative high-performance liquid chromatographic method to analyse commercial saffron (Crocus sativus L) products. J Chromatogr A. 1999;830:477–483. doi: 10.1016/S0021-9673(98)00938-8. [DOI] [Google Scholar]
  • 5.Melnyk JP, Wang SN, Massimo MF. Chemical and biological properties of the world’s most expensive spice: Saffron. Food Res Int. 2010;43:1981–1989. doi: 10.1016/j.foodres.2010.07.033. [DOI] [Google Scholar]
  • 6.Loskutov AV, Beningerb CW, Hosfield GL, Sink KC. Development of an improved procedure for extraction and quantitation of safranal in stigmas of Crocus sativus L using high-performance liquid chromatography. Food Chem. 2000;69:87–95. doi: 10.1016/S0308-8146(99)00246-0. [DOI] [Google Scholar]
  • 7.Bolhassani A, Khavari A, Bathaie SZ. Saffron and natural carotenoids: biochemical activities and anti-tumor effects. BBA-Rev on Cancer. 2014;1845(1):20–30. doi: 10.1016/j.bbcan.2013.11.001. [DOI] [PubMed] [Google Scholar]
  • 8.Papandreou MA, Tsachaki M, Efthimiopoulos S, Cordopatis P, Lamari FN, Margarity M. Memory enhancing effects of saffron in aged mice are correlated with antioxidant protection. Behav Brain Res. 2011;219(2):197–204. doi: 10.1016/j.bbr.2011.01.007. [DOI] [PubMed] [Google Scholar]
  • 9.Ghadrdoost B, Vafaei AA, Rashidy-Pour A, Hajisoltani R, Bandegi AR, Motamedi F. et al. Protective effects of saffron extract and its active constituent crocin against oxidative stress and spatial learning and memory deficits induced by chronic stress in rats. Eur J Pharmacol. 2011;667(1-3):222–229. doi: 10.1016/j.ejphar.2011.05.012. [DOI] [PubMed] [Google Scholar]
  • 10.Fukui H, Toyoshima K, Komaki R. Psychological and neu-roendocrinological effects of odor of saffron (Crocus sativus) Phytomed. 2011;18(8-9):726–730. doi: 10.1016/j.phymed.2010.11.013. [DOI] [PubMed] [Google Scholar]
  • 11.Yin YJ, Xu XR, Zhao HY. Contrast and identification of Crocus sativus L and its substitution. Academic J GCP. 1997;13(1):11–13. [Google Scholar]
  • 12.Lu XQ. Lu XQAuthentication of Crocus sativus Land its counter-feit corn stigma. Prim J Chin Mat Med. 1992;6(4):12–14. [Google Scholar]
  • 13.Wang BC, Wu GT. Several simple methods of identifying Crocus sativus L and its adulterants. Strait Pharma J. 2001;13(3):75–77. [Google Scholar]
  • 14.Zhao XG. Identification of Crocus sativus L and its counterfeit Lotus Stamen. Lishizhen Med Mat Med Res. 2001;12(12):1099–1102. [Google Scholar]
  • 15.Sujata V, Ravishankar GA, Venkataraman LV. Methods for the analysis of the saffron metabolites crocin, crocetins, picrocrocin and safranal for the determination of the quality of the spice using thin-layer chromatography, high-performance liquid chromatography and gas chromatography. J Chromatogr. 1992;624:497–502. doi: 10.1016/0021-9673(92)85699-T. [DOI] [Google Scholar]
  • 16.Torelli A, Marieschi M, Bruni R. Authentication of saffron (Crocus sativus L) in different processed, retail products by means of SCAR markers. Food Ctrl. 2014;36(1):126–131. doi: 10.1016/j.foodcont.2013.08.001. [DOI] [Google Scholar]
  • 17.Babaei S, Talebi M, Bahar M. Developing an SCAR and ITS reliable multiplex PCR-based assay for safflower adulterant detection in saffron samples. Food Ctrl. 2014;35(1):323–328. doi: 10.1016/j.foodcont.2013.07.019. [DOI] [Google Scholar]
  • 18.Enan M, Fawzi N, Al-Deeb M, Amiri K. DNA barcoding of Ricinus communis from different geographical origin by using chloroplast matK and internal transcribed spacers. Asia J Pharm Sci. 2012;3:1304–1310. doi: 10.4236/ajps.2012.39157. [DOI] [Google Scholar]
  • 19.Liu MZ, Liu P, Li MN, Yao H. Molecular identification of Codonopsis Radix and its adulterants based on ITS2 barcode. WST/MTCM Mat Med. 2011;13(2):412–417. [Google Scholar]
  • 20.Sun ZY, Song JY, Yao H, Sun C, Chen SL. Molecular iden-tification of Paeoniae Radix Rubra and its adulterants based on ITS2 DNA barcode. WST/MTCM Mat Med. 2011;13(2):407–411. [Google Scholar]
  • 21.Zeng X, Li L, Ye N. Molecular identification of Radix et Rhizoma clematis and its adulterants based on ITS2 DNA barcode. Global TCM. 2011;4(4):264–269. [Google Scholar]
  • 22.Sui XY, Huang Y, Tan Y, Guo Y, Long CL. Molecular authentication of the ethnomedicinal plant Sabia parviflora and its adulterants by DNA barcoding technique. Planta Med. 2011;77:492–496. doi: 10.1055/s-0030-1250468. [DOI] [PubMed] [Google Scholar]
  • 23.Guo HY, Wang WW, Yang N, Guo BL, Zhang S, Yang RJ. et al. DNA barcoding provides distinction between Radix Astragali and its adulterants. Sci China Life Sci. 2010;53(8):992–999. doi: 10.1007/s11427-010-4044-y. [DOI] [PubMed] [Google Scholar]
  • 24.Che J, Tang L, Liu YJ, He W, Chen F. Molecular identity of Crocus sativus and its misused substitutes by ITS sequence. China J Chin Mat Med. 2007;32(8):668–670. [PubMed] [Google Scholar]
  • 25.Mao SG, Luo YM, Shen J, Ding XY. Authentication of Crocus sativus L and its adulterants by rDNA ITS sequences and allele-specific PCR. J NJNU (Natural Science Edition) 2007;30(2):89–92. [Google Scholar]
  • 26.Jiang C, Cao L, Yuan Y, Chen M, Jin Y, Huang L. Barcoding melting curve analysis for rapid, sensitive, and discriminating authentication of saffron (Crocus sativus L) from its adulterants. Bio Med Res Int. 2014;809037:1–10. doi: 10.1155/2014/809037. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Fazekas AJ, Burgess KS, Kesanakurti PR, Graham SW, Newmaster SG, Husband BC. et al. Multiple multilocus DNA barcodes from the plastid genome discriminate plant species equally well. PLoS ONE. 2008;3:e2802. doi: 10.1371/journal.pone.0002802. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Kress WJ, Wurdack KJ, Zimmer EA, Weigt LA, Janzen DH. Use of DNA barcodes to identify flowering plants. Proc Natl Acad Sci USA. 2005;102:8369–8374. doi: 10.1073/pnas.0503123102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Yao H, Song JY, Liu C. Use of ITS2 region as the universal DNA barcode for plants and animals. PLoS ONE. 2010;10:e13102. doi: 10.1371/journal.pone.0013102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Kress WJ, Erickson DL. A two-locus global DNA barcode for land plants: the coding rbcL gene complements the noncoding trnH-psbA spacer region. PLoS ONE. 2007;6:e508. doi: 10.1371/journal.pone.0000508. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Chen SL, Song JY, Yao H, Shi LC, Luo K, Han JP. Strategy and key technique of identification of Chinese herbal medicine by using DNA barcoding. Chin J Nat Med. 2009;7(5):322–327. [Google Scholar]
  • 32.Chase MW, Salamin N, Wilkinson M, Dunwell JM, Kesanakurthi RP, Haidar N, Savolainen V. Land plants and DNA barcodes: short-term and long-term goals. Philos Trans R Soc B. 2005;360:1889–1895. doi: 10.1098/rstb.2005.1720. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Chen S1, Yao H, Han J, Liu C, Song J, Shi L, Zhu Y, Ma X, Gao T, Pang X, Luo K, Li Y, Li X, Jia X, Lin Y, Leon C. Validation of the ITS2 region as a novel DNA barcode for identifying medicinal plant species. PLoS ONE. 2010;5(1):e8613. doi: 10.1371/journal.pone.0008613. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Schultz J, Maisel S, Gerlach D, Mûller T. A common core of secondary structure of the internal transcribed spacer 2 (ITS2) throughout the Eukaryota. RNA. 2005;11:361–364. doi: 10.1261/rna.7204505RNA2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Sass C, Little DP, Stevenson DW, Specht CD. DNA barcoding in the cycadales: testing the potential of proposed barcoding markers for species identification of cycads. PLoS ONE. 2007;11:e1154. doi: 10.1371/journal.pone.0001154. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Li M, Au KY, Lam H, Cheng L, Jiang RW, But PP, Shaw PC. Identification of Baiying (Herba Solani Lyrati) commodity and its toxic substitute Xungufeng (Herba Aristolochiae Mollissimae) using DNA barcoding and chemical profiling techniques. Food Chem. 2012;135(3):1653–1658. doi: 10.1016/j.foodchem.2012.06.049. [DOI] [PubMed] [Google Scholar]
  • 37.Newmaster SG, Fazekas AJ, Ragupathy S. DNA barcoding in the land plants: evaluation of rbcL in a multigene tiered approach. Can J Bot. 2006;84(3):335–341. doi: 10.1139/b06-047. [DOI] [Google Scholar]
  • 38.Xue CY, Li DZ. Use of DNA barcode sensu lato to identify traditional Tibetan medicinal plant Gentianopsis paludosa (Gentianacea) J Syst Evol. 2011;49(3):267–270. doi: 10.1111/j.1759-6831.2011.00127.x. [DOI] [Google Scholar]
  • 39.Li M, But PP, Shaw PC. Molecular Pharmacognosy In: Huang LQ (ed) Molecular identification of traditional medicinal materials. Mol Pharm. 2013:45–66. [Google Scholar]
  • 40.Armstrong KF, Ball SL. DNA barcodes for biosecurity: invasive species identification. Philos Trans R Soc B. 2005;360:1813–1823. doi: 10.1098/rstb.2005.1713. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Wallace LJ, Boilard SM, Eagle S, Spall JL, Shokralla S, Hajibabaei M. DNA barcodes for everyday life: Routine authentication of natural health products. Food Res Int. 2012;49:446–452. doi: 10.1016/j.foodres.2012.07.048. [DOI] [Google Scholar]

Articles from Iranian Journal of Biotechnology are provided here courtesy of Iran National Institute of Genetic Engineering and Biotechnology

RESOURCES