Abstract
Premise of the study:
Microsatellite primers were developed for Begonia luzhaiensis (Begoniaceae) to assess genetic diversity and population genetic structure.
Methods and Results:
Based on the transcriptome data of B. luzhaiensis, 60 primer pairs were selected for initial validation, of which 16 yielded polymorphic microsatellite loci in 57 individuals. The number of alleles observed for these 16 loci ranged from one to nine. The observed and expected heterozygosity ranged from 0.000 to 1.000 and from 0.000 to 0.804 with averages of 0.370 and 0.404, respectively. Five loci could be successfully amplified in B. leprosa.
Conclusions:
The expressed sequence tag–simple sequence repeat markers are the first specifically developed for B. luzhaiensis and the first developed in Begonia sect. Coelocentrum. These markers will be useful for future studies of the genetic structure and phylogeography of B. luzhaiensis.
Keywords: Begonia leprosa, Begonia luzhaiensis, Begoniaceae, expressed sequence tag–simple sequence repeat (EST-SSR), section Coelocentrum, transcriptome
The immense terrain of limestone karsts stretching from southern China to northern Vietnam (Sino-Vietnamese limestone karsts; SVLK) is a renowned biodiversity hotspot. It is noted for extremely high species diversity and endemicity of narrowly distributed calciphilous plants that are increasingly threatened by habitat destruction caused by rapid economic growth in recent decades (Chung et al., 2014). To design effective conservation strategies, a better understanding of the evolutionary mechanisms underlying the rich and distinct SVLK flora is essential. With ca. 70 species distributed exclusively in the SVLK, Begonia L. sect. Coelocentrum Irmsch. (Begoniaceae) is one of the most characteristic plant groups (Chung et al., 2014; Peng et al., 2014, 2015; Li et al., 2016), presenting an ideal model system for studying limestone plant speciation. Species of the section exhibit great morphological variation in leaf shape, texture, and variegation; they are usually confined to caves and cave-like microhabitats that occur abundantly in the karst areas of southern China (Guangdong, Guangxi, and Yunnan provinces) and northern Vietnam (Chung et al., 2014). Most species of sect. Coelocentrum are known from a single or a few localities, with the exception of B. cavaleriei H. Lév., B. leprosa Hance, and B. luzhaiensis T. C. Ku (Gu et al., 2007).
Based on phylogenetic analyses of Asian limestone Begonia species, Chung et al. (2014) proposed that the excess of moisture brought by the onset of East Asian monsoons since the late Miocene accelerated rates of karstification of Sino-Vietnamese limestone terrains, triggering widespread allopatric speciation in the SVLK. To test the microevolutionary processes underlying the speciation hypothesis of Chung et al. (2014), we investigate the population genetics and phylogeography of B. luzhaiensis. In this article, we report microsatellite markers developed for B. luzhaiensis. Expressed sequenced tag–simple sequence repeat (EST-SSR) markers are valuable in tests of cross-transferability, facilitating studies of population genetic diversity in many plant species (e.g., Dikshit et al., 2015; Zhou et al., 2016). Here, we used next-generation transcriptome sequencing to develop a set of microsatellite markers for B. luzhaiensis. Additionally, we tested the transferability of these markers for B. leprosa, another widespread species of sect. Coelocentrum.
METHODS AND RESULTS
To maximize potential loci, total RNAs were extracted from fresh leaves and male floral buds (from C.-I Peng 18732, denoted as Pool AC) and fruit (C.-I Peng 18735, Pool B) of B. luzhaiensis, respectively. RNA extraction was performed using the PureLink RNA Mini Kit (Invitrogen, Carlsbad, California, USA) according to the manufacturer’s instructions, and quality and quantity were measured by an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, California, USA). Illumina TruSeq library preparation and sequencing using the Illumina MiSeq system (2 × 250 bp paired-end; Illumina, San Diego, California, USA) were performed by Tri-I Biotech (New Taipei City, Taiwan). Reads were de-multiplexed, quality-trimmed, and assembled using SOAPdenovo2 (Luo et al., 2012). All sequence information has been deposited in the National Center for Biotechnology Information (NCBI) Sequence Read Archive (SRA; PRJNA378679). Our assembly generated 40,226 and 28,454 contigs for the Pool AC and Pool B assemblies. The average contig length was 874 and 850 bp for Pool AC and Pool B, respectively. In combined B. luzhaiensis assemblies (combined Pool AC and B), 44,368 contigs with an average length of 864 bp were generated.
The program Simple Sequence Repeat Identification Tool (SSRIT; Temnykh et al., 2001; http://archive.gramene.org/db/markers/ssrtool) was used to identify sequences containing at least five di-, tri-, tetra-, penta-, and hexanucleotide microsatellite repeats. In combined B. luzhaiensis assemblies, 5602 microsatellite-containing sequences were identified, of which 60 potential loci were selected for primer design using Primer-BLAST (Ye et al., 2012), with the optimum conditions set at a length of 20 bp (18–22 bp), a melting temperature of 60°C (57–63°C), and a product size range of 120–250 bp.
To characterize the degree of polymorphism of each locus, 57 individuals from three populations were genotyped using the 60 newly designed primer pairs (Appendix 1). Total genomic DNA was extracted from silica gel–dried leaves based on protocols outlined in Chung et al. (2014). The PCR reaction was conducted with a final volume of 20 μL containing approximately 30 ng of genomic DNA, 1 μL of 10 μM of each primer, and 10 μL of 2× Master Mix Red (Ampliqon, Odense, Demark). The following PCR conditions were used: an initial denaturation of 94°C for 5 min; 32 cycles of 95°C for 40 s, 53°C for 35 s, and 72°C for 1 min; followed by an extension of 5 min at 72°C. The amplified products were analyzed on an ABI 3500 Genetic Analyzer (Applied Biosystems, Waltham, Massachusetts, USA) with GeneScan 600 LIZ Size Standard (Applied Biosystems). Genotypes were determined using GeneMarker version 3.7 (Holland and Parson, 2011).
Of the 60 primer pairs, 16 loci were polymorphic among the three tested populations (Table 1). The number of alleles per locus, expected heterozygosity, and observed heterozygosity were calculated with GenAlEx 6.503 (Peakall and Smouse, 2012). GENEPOP 4.2 (Raymond and Rousset, 1995) was used to perform exact tests of Hardy–Weinberg equilibrium and linkage disequilibrium. The total number of alleles ranged from one to nine with a mean of 3.379 (Table 2). The observed and expected heterozygosity ranged from 0.000 to 1.000 and from 0.000 to 0.804 with averages of 0.370 and 0.404, respectively. Significant deviations of Hardy–Weinberg equilibrium in terms of heterozygosity deficiency were detected at three loci (BLZ01, BLZ06, BLZ16) in the Luzhai population (LZ, Table 2). Significant linkage disequilibrium was not detected between any pair of loci (P < 0.001). The putative functions of SSR-associated sequences were determined by BLASTX against the nonredundant GenBank database.
Table 1.
Characteristics of 16 microsatellite loci developed for Begonia luzhaiensis.
| Locusa | Primer sequences (5′–3′) | Repeat motif | Fluorescent label | Allele size range (bp) | Putative function [Organism] | E-value | GenBank accession no. |
| BLZ01 | F: TCGGTTGAGCTGCTCTTTTT | (GA)20 | FAM | 188–228 | No hit | – | KY659210 |
| R: CCGCATGAATGCCTCTTATT | |||||||
| BLZ02 | F: AGCTCCCTCTTCCATCTTCC | (TCT)11 | FAM | 164–200 | No hit | – | KY659211 |
| R: CGTGTCCTCCTTCCCTACAA | |||||||
| BLZ03 | F: GACGAACGAAGGGTGACTGT | (CGAAC)5 | NED | 205–240 | No hit | – | KY659212 |
| R: CGGCTTCAGATTACCAGGAC | |||||||
| BLZ04 | F: TGTCACCGTGGAAGAAGATG | (AGGGAG)5 | NED | 163–217 | Cyclin-L1-1 isoform X1 [Lupinus angustifolius] | 3.7 | KY659213 |
| R: CTCTCGCTCTCGTTCCTTGT | |||||||
| BLZ05 | F: TGAAGCCAGAGCATGAGATG | (GATGGA)5 | PET | 209–257 | Transcription factor MYB114 isoform X2 [Eucalyptus grandis] | 0.004 | KY659214 |
| R: ACTGGAACACCCATTTACGC | |||||||
| BLZ06 | F: AGCATCAGAGGAAAGCTTCG | (TTC)12 | FAM | 135–153 | Mlo-related protein [Corchorus capsularis] | 8e-08 | KY659215 |
| R: CCTCCATCCTCAATGGAAAA | |||||||
| BLZ07 | F: GCAAGGAGTTGCAGAGGAAG | (CAG)11 | VIC | 200–248 | No hit | – | KY659216 |
| R: CCAAAACCATTGCCCAGTAG | |||||||
| BLZ08 | F: TTTTGGAGAAGACGACCCTTT | (GAAAG)5 | NED | 182–192 | Hypothetical protein [Gossypium raimondii] | 0.17 | KY659217 |
| R: AGCGCAAGGCATTCATATTC | |||||||
| BLZ09 | F: GATCTGGCAAGGTTTTGGAA | (CCCATT)6 | PET | 185–227 | Hypothetical protein [Citrus clementina] | 3e-12 | KY659218 |
| R: GTGGCTGATCTTGCAGCATA | |||||||
| BLZ10 | F: AAAATGGCTAAGACGTGGAAA | (GAA)10 | VIC | 150–210 | No hit | – | KY659219 |
| R: TTTGGTTGCGAGAAGTTGC | |||||||
| BLZ11 | F: ACGTGCGACTCTGGAAAACT | (AAAT)5 | FAM | 226–242 | 1,4-dihydroxy-2-naphthoyl-CoA thioesterase 1 [Malus domestica] | 2e-11 | KY659220 |
| R: GGCTTTCAATTCCTCGAAAA | |||||||
| BLZ12 | F: AAATGGGGAAGAACGGGTTA | (TTTG)5 | NED | 151–199 | Uncharacterized protein [Vitis vinifera] | 0.46 | KY659221 |
| R: GTATAAGCCCAGCTGCCAAG | |||||||
| BLZ13 | F: TCCAAGTTCAGGACCCAAAA | (TTCTCC)6 | PET | 186–222 | E3 ubiquitin-protein ligase UPL1 isoform X3 [Cucumis melo] | 9e-13 | KY659222 |
| R: TCTGTGCGTGCATTTCTAGC | |||||||
| BLZ14 | F: ATCCCATGGCTATCAGCATT | (GACCGA)5 | VIC | 197–227 | No hit | – | KY659223 |
| R: GGTATGGCGAGACCTAGTGC | |||||||
| BLZ15 | F: AGCAACACCCAGACTTCCAC | (GAGATG)5 | FAM | 210–228 | Hypothetical protein [Gossypium raimondii] | 1e-13 | KY659224 |
| R: CGCCTGAGTCATCGTTTTCT | |||||||
| BLZ16 | F: GACGTGATAAGGCCACAACC | (TCTCCA)5 | NED | 223–259 | No hit | – | KY659225 |
| R: CTTCTCCTCCACCTTCATCG |
Annealing temperature was 53°C for all loci.
Table 2.
Genetic characterization of 16 newly developed polymorphic microsatellites of Begonia luzhaiensis.a
| YS (n = 15) | LZ (n = 20) | XC (n = 22) | |||||||
| Locus | A | Ho | He | A | Ho | He | A | Ho | He |
| BLZ01 | 8 | 0.667 | 0.784 | 9 | 0.235 | 0.804* | 2 | 0.048 | 0.210 |
| BLZ02 | 4 | 0.600 | 0.604 | 5 | 0.895 | 0.733 | 6 | 0.773 | 0.732 |
| BLZ03 | 4 | 0.467 | 0.647 | 3 | 0.167 | 0.531 | 3 | 0.167 | 0.329 |
| BLZ04 | 5 | 0.400 | 0.498 | 5 | 1.000 | 0.722 | 2 | 0.455 | 0.351 |
| BLZ05 | 3 | 0.067 | 0.135 | 2 | 0.067 | 0.064 | 3 | 0.190 | 0.177 |
| BLZ06 | 4 | 0.800 | 0.604 | 3 | 0.000 | 0.304* | 2 | 0.000 | 0.124 |
| BLZ07 | 7 | 0.786 | 0.661 | 4 | 0.667 | 0.722 | 3 | 0.143 | 0.217 |
| BLZ08 | 2 | 0.133 | 0.444 | 2 | 0.556 | 0.475 | 2 | 0.273 | 0.236 |
| BLZ09 | 5 | 0.857 | 0.712 | 4 | 0.778 | 0.660 | 4 | 0.417 | 0.576 |
| BLZ10 | 5 | 0.643 | 0.663 | 7 | 0.737 | 0.742 | 2 | 0.333 | 0.337 |
| BLZ11 | 4 | 0.214 | 0.258 | 1 | 0.000 | 0.000 | 1 | 0.000 | 0.000 |
| BLZ12 | 2 | 0.000 | 0.124 | 3 | 0.500 | 0.615 | 2 | 0.091 | 0.087 |
| BLZ13 | 2 | 0.286 | 0.245 | 2 | 0.050 | 0.049 | 2 | 0.632 | 0.465 |
| BLZ14 | 3 | 0.467 | 0.380 | 3 | 0.684 | 0.655 | 4 | 0.619 | 0.652 |
| BLZ15 | 3 | 0.533 | 0.518 | 1 | 0.000 | 0.000 | 2 | 0.273 | 0.236 |
| BLZ16 | 2 | 0.067 | 0.064 | 3 | 0.000 | 0.204* | 2 | 0.050 | 0.049 |
Note: A = number of alleles; He = expected heterozygosity; Ho = observed heterozygosity; n = number of individuals sampled.
Locality and voucher information are provided in Appendix 1.
*Highly significant deviation from Hardy–Weinberg equilibrium (P < 0.001).
The interspecific transferability of the 16 markers was evaluated in B. leprosa, another widespread species of sect. Coelocentrum (Table 3). Five markers were successfully cross-amplified in B. leprosa.
Table 3.
Cross-amplification results for the 16 microsatellites developed for Begonia luzhaiensis in seven populations of B. leprosa (n = 1).a
| Locus | LK | QL | TP | FL | DL | LG | LS |
| BLZ01 | — | + | — | — | — | — | — |
| BLZ02 | + | + | — | + | + | + | + |
| BLZ03 | — | — | — | — | — | — | + |
| BLZ04 | + | + | + | + | + | + | + |
| BLZ05 | + | + | — | — | — | + | + |
| BLZ06 | + | + | + | + | + | + | + |
| BLZ07 | — | — | — | — | — | — | + |
| BLZ08 | + | + | + | + | + | + | + |
| BLZ09 | + | + | + | + | + | + | + |
| BLZ10 | + | + | — | + | + | — | + |
| BLZ11 | — | — | — | — | — | — | — |
| BLZ12 | — | + | + | + | + | — | + |
| BLZ13 | + | + | + | + | + | + | + |
| BLZ14 | + | * | * | * | * | + | * |
| BLZ15 | + | * | * | * | * | + | * |
| BLZ16 | + | * | * | * | * | + | * |
Note: + = successful amplification; — = failed amplification; * = PCR has not been performed.
Locality and voucher information are provided in Appendix 1.
CONCLUSIONS
The 16 microsatellite markers described here are the first developed for B. luzhaiensis and also the first study in Begonia sect. Coelocentrum. These microsatellites can be applied to the investigation of genetic diversity, population genetic structure, mating system, and gene flow, thus facilitating our understanding of evolutionary mechanisms and species diversification of the limestone flora. Data from such studies will contribute to the conservation and management of B. luzhaiensis that is increasingly threatened by habitat destruction.
Appendix 1.
Voucher information for Begonia luzhaiensis used in this study. All voucher specimens are deposited in the Herbarium of the Biodiversity Research Center (HAST), Academia Sinica, Taipei, Taiwan.
| Species | Population code | n | Collection locality | Geographic coordinates | Voucher no. |
| Begonia luzhaiensis T. C. Ku | – | 1 | Puyi Township, Yanshuo County, Gulin City, Guangxi Province, China | 24°43′41.0″N, 110°31′44.0″E | C.-I Peng 18732 |
| – | 1 | Puyi Township, Yanshuo County, Gulin City, Guangxi Province, China | 24°42′34.0″N, 110°32′7.0″E | C.-I Peng 18735 | |
| YS | 15 | County Town, Yanshuo County, Gulin City, Guangxi Province, China | 24°46′12.9″N, 110°27′43.4″E | H.-Y. Huang 008 | |
| LZ | 20 | Liuzhou City, Luzhai County, Guangxi Province, China | 24°43′37.9″N, 109°39′50.6″E | H.-Y. Huang 018 | |
| XC | 22 | Laibin City, Xingcheng County, Guangxi Province, China | 24°03′49.5″N, 108°40′8.9″E | H.-Y. Huang 102 | |
| B. leprosa Hance | LK | 1 | Luokeng Town, Qujiang District, Shaoguan City, Guangdong Province, China | 24°31′24.4″N, 113°21′19.3″E | C.-I Peng 23998 |
| QL | 1 | Qinglian Town, Yangshan County, Shaoguan City, Guangdong Province, China | 24°27′23.0″N, 112°45′53.3″E | C.-I Peng 24045 | |
| TP | 1 | Taiping Town, Yangshan County, Shaoguan City, Guangdong Province, China | 24°10′33.4″N, 112°33′10.8″E | C.-I Peng 24055 | |
| FL | 1 | Fuli Town, Yangshuo County, Gulin City, Guangxi Province, China | 24°47′8.2″N, 110°31′22.5″E | H.-Y. Huang 005 | |
| DL | 1 | Donglan County, Hechi City, Guangxi Province, China | 24°26′47.1″N, 107°20′34.6″E | H.-Y. Huang 079 | |
| LG | 1 | Longhushan, Longan County, Nanning City, Guangxi Province, China | 22°57′10.2″N, 107°38′02.7″E | H.-Y. Huang 089 | |
| LS | 1 | Longhushan, Longan County, Nanning City, Guangxi Province, China | 22°57′41.9″N, 107°37′28.2″E | H.-Y. Huang 092 |
Note: n = number of individuals sampled.
LITERATURE CITED
- Chung K.-F., Leong W.-C., Rubite R. R., Repin R., Kiew R., Liu Y., Peng C.-I. 2014. Phylogenetic analyses of Begonia sect. Coelocentrum and allied limestone species of China shed light on the evolution of Sino-Vietnamese karst flora. Botanical Studies (Taipei, Taiwan) 55: 1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Dikshit H. K., Singh A., Singh D., Aski M. S., Prakash P., Jain N., Meena S., et al. 2015. Genetic diversity in Lens species revealed by EST and genomic simple sequence repeat analysis. PLoS ONE 10: e0138101. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gu C.-Z., Peng C.-I, Turland N. J. 2007. Begoniaceae. In Z.-Y. Wu, P. H. Raven, and D. Y. Hong [eds.], Flora of China, vol. 13, 153–207. Science Press, Beijing, China, and Missouri Botanical Garden Press, St. Louis, Missouri, USA. [Google Scholar]
- Holland M. M., Parson W. 2011. GeneMarker® HID: A reliable software tool for the analysis of forensic STR data. Journal of Forensic Sciences 56: 29–35. [DOI] [PubMed] [Google Scholar]
- Li C., Yang L.-H., Tian D.-K., Chen Y., Wu R.-J., Fu N.-F. 2016. Begonia leipingensis (Begoniaceae), a new compound-leaved species with unique petiolule pattern from Guangxi of China. Phytotaxa 244: 45–56. [Google Scholar]
- Luo R.-B., Liu B.-H., Xie Y.-L., Li Z.-Y., Huang W.-H., Yuan J.-Y., He G.-Z., et al. 2012. SOAPdenovo2: An empirically improved memory-efficient short-read de novo assembler. GigaScience 1: https://doi.org/10.1186/2047-217X-1-18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Peakall R., Smouse P. E. 2012. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research–An update. Bioinformatics (Oxford, England) 28: 2537–2539. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Peng C.-I, Ku S.-M., Yang H.-A., Leong W.-C., Liu Y., Nguyen T. H., Kono Y., Chung K.-F. 2014. Two new species of Begonia sect. Coelocentrum, B. guixiensis and B. longa, from Sino-Vietnamese limestone karsts. Botanical Studies (Taipei, Taiwan) 55: 52. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Peng C.-I, Lin C.-W., Yang H.-A., Kono Y., Nguyen H. Q. 2015. Six new species of Begonia (Begoniaceae) from limestone areas in Northern Vietnam. Botanical Studies (Taipei, Taiwan) 56: 9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Raymond M., Rousset F. 1995. GENEPOP (Version 1.2): Population genetics software for exact tests and ecumenicism. Journal of Heredity 86: 248–249. [Google Scholar]
- Temnykh S., DeClerck G., Lukashova A., Lipovich L., Cartinhour S., McCouch S. 2001. Computational and experimental analysis of microsatellites in rice (Oryza sativa L.): Frequency, length variation, transposon associations, and genetic marker potential. Genome Research 11: 1441–1452. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ye J., Coulouris G., Zaretskaya I., Cutcutache I., Rozen S., Madden T. L. 2012. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics 13: 134. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Zhou Q., Luo D., Ma L.-C., Xie W.-G., Wang Y., Wang Y.-R., Liu Z.-P. 2016. Development and cross-species transferability of EST-SSR markers in Siberian wildrye (Elymus sibiricus L.) using Illumina sequencing. Scientific Reports 6: 20549. [DOI] [PMC free article] [PubMed] [Google Scholar]