Skip to main content
Applications in Plant Sciences logoLink to Applications in Plant Sciences
. 2017 May 12;5(5):apps.1700034. doi: 10.3732/apps.1700034

Chloroplast and mitochondrial microsatellites for Millettia pinnata (Fabaceae) and cross-amplification in related species1

Yanling Wang 2,3, Hongxian Xie 4, Yi Yang 2,3, Yelin Huang 4, Jianwu Wang 2,3,5, Fengxiao Tan 2,3,5
PMCID: PMC5435409  PMID: 28529836

Abstract

Premise of the study:

Chloroplast and mitochondrial microsatellites were identified to study the population genetics of Millettia pinnata (Fabaceae).

Methods and Results:

Based on publicly available plastid genome sequence data of M. pinnata, 42 primer pairs were developed, of which 17 displayed polymorphisms across 89 individuals from four populations. For chloroplast loci, two to six alleles were recovered and the unbiased haploid diversity per locus ranged from 0.391 to 0.857. For mitochondrial loci, two to four alleles were recovered and the unbiased haploid diversity ranged from 0.264 to 0.740. Sixteen of the 17 screened markers could be successfully amplified in the related species M. pulchra.

Conclusions:

The 17 microsatellite markers developed here exhibited variation in M. pinnata and 16 presented transferability in the related species M. pulchra, suggesting that these markers will be valuable for genetic studies across M. pinnata and its related species.

Keywords: chloroplast microsatellite, cross-amplification, Fabaceae, Millettia pinnata, Millettia pulchra, mitochondrial microsatellite


Millettia pinnata (L.) Panigrahi (syn. Pongamia pinnata (L.) Pierre; Fabaceae) is an arboreal legume of the subfamily Papilionoideae and, more specifically, of the tribe Millettieae. According to Scott et al. (2008), this species is widely distributed in the Indian subcontinent and Southeast Asia, extending to Polynesia and northern Australia. Historically, this plant has been used as a source of traditional medicine, animal fodder, green manure, timber, fish poison, and fuel in India and neighboring regions (Satyavati et al., 1987). Seeds of M. pinnata contain oils that are inedible but useful for biodiesel, and thus it has received increasing attention as a sustainable biofuel crop in the past decade.

Population genetic studies on M. pinnata have used molecular biological methods including amplified fragment length polymorphisms (AFLPs), three endonuclease (TE)-AFLP (Sharma et al., 2011), inter-simple sequence repeats (ISSRs) (Sahoo et al., 2010; Sharma et al., 2014), and the chloroplast trnK/matK and the internal transcribed spacer (ITS) region of nuclear ribosomal DNA (Hu et al., 2000, 2002; Arpiwi et al., 2013). Huang et al. (2016) developed nuclear simple sequence repeat (SSR) markers for M. pinnata; however, there is still a lack of plastid (chloroplast and mitochondrial) SSR markers capable of detecting high levels of polymorphism in this species. The uniparentally inherited characteristics of chloroplast and mitochondria can supply information on phylogenetic relationships between individuals because their lineages are not disturbed by recombination (Soranzo et al., 1999). In general, for the maternally inherited chloroplast, the higher sequence variations of SSR loci are distributed throughout the noncoding regions and the flanking regions are conserved (Powell et al., 1995), which makes it possible to monitor the population structure affected by pollen flow and seed-mediated gene flow (Provan et al., 2001). The search for mitochondrial SSR (mtSSR) loci might also be informative, although preliminary studies on plant mitochondrial microsatellites have shown little intraspecific variability (Soranzo et al., 1999). Therefore, plastid SSR markers can be effective for analyzing genetic diversity, population structure, paternity inheritance, and germplasm resource identification (Provan et al., 2001).

In this study, we developed a set of novel SSRs based on publicly available chloroplast and mitochondrial genome sequence data of M. pinnata to assess the genetic variation and population genetic structure of this species. Furthermore, we tested the transferability of these markers in the related species M. pulchra (Benth.) Kurz.

METHODS AND RESULTS

In this study, the complete chloroplast and mitochondrial genome sequence data of M. pinnata were downloaded from the National Center for Biotechnology Information (NCBI) GenBank database (GenBank accession no. JN673818.2 and JN872550.1, respectively). The SSR loci distributed throughout the M. pinnata chloroplast and mitochondrial genomes were screened using MISA software (Thiel et al., 2003). The SSR motifs contained one to five nucleotides with the minimum number of repeats as follows: 10 for mononucleotides, five for dinucleotides, four for trinucleotides, and three for tetranucleotides and pentanucleotides. A total of 97 repeat motifs were identified in the chloroplast and mitochondrial genomes, among which the most frequent types were mononucleotides (69 [71.1%]) and dinucleotides (17 [17.5%]), while tri- (5 [5.1%]) and tetranucleotide (6 [6.2%]) motifs were rare. Forty-two loci were selected at random to design primers using Primer3 (Rozen and Skaletsky, 1999), with the optimum conditions set at length of 22 bp (20–26 bp), temperature of 55–60°C, and product size range of 100–500 bp.

Eighty-nine individuals of M. pinnata from four natural populations (Appendix 1) were used to evaluate polymorphism of the target microsatellite loci. Genomic DNA from silica-dried leaves was isolated using the advanced cetyltrimethylammonium bromide (CTAB) method (Doyle, 1991). PCR amplifications were performed in a final volume of 15 μL, containing 30 ng of genomic DNA, 1× PCR buffer (10 mM Tris-HCl [pH 8.4] and 1.5 mM MgCl2; TransGen Biotech Co., Beijing, China), 0.2 mM dNTPs (Bocai Biotech Co., Shanghai, China), 0.5 μM of each primer (BGI Sequencing Co., Beijing, China), and 0.5 units EasyTaq DNA polymerase (TransGen Biotech Co.). PCR reactions were conducted in a Bio-Rad PTC-200 thermal cycler (Bio-Rad Laboratories, Hercules, California, USA) under the following conditions: initial denaturation at 94°C for 4 min; followed by 35 cycles of 94°C for 1 min, 45 s at the specific annealing temperature for each primer pair (Table 1), and 72°C for 60 s; and a final extension of 10 min at 72°C. PCR products were detected using 1.0% agarose gel electrophoresis to test the utility of the primers. Finally, among the 42 selected primer pairs, 40 were successfully amplified but products from only 17 primer pairs exhibited clear SSR polymorphisms. Six individuals from the related species M. pulchra were used to evaluate the transferability of these polymorphic markers applying the 17 screened primers. With the Quant-iT PicoGreen dsDNA Reagent and Kit (including the 35–400-bp Range DNA Ladder; Invitrogen, Carlsbad, California, USA), the Fragment Analyzer Automated CE System (Advanced Analytical Technologies [AATI], Ames, Iowa, USA) was applied to perform SSR genotyping. Raw data were exported, and the number of alleles and allele sizes per locus were called using PROSize software (version 2.0, AATI). All sequences of cpSSR and mtSSR loci were deposited in GenBank, and their accession numbers are presented in Table 1. Because it would be difficult to score the mononucleotide microsatellites consistently, we conducted direct sequencing of the PCR products using the BigDye Terminator v3.1 Cycle Sequencing Kit and ABI PRISM 3730 sequencer (Applied Biosystems, Waltham, Massachusetts, USA) with both forward and reverse primers, to verify the allelic variants tested in this study. Sequences were visualized and analyzed with the DNASTAR software package (DNASTAR, Madison, Wisconsin, USA).

Table 1.

Characteristics of 17 novel microsatellite markers developed in Millettia pinnata.

Locus Primer sequences (5′–3′) Repeat motif Ta (°C) ES (bp) Positiona GenBank accession no.
POSSRB38b F: TTAAGGAGGCCCCTAATGAAAT (T)10…(A)10 55 258 trnG-psaI IGS KY189098
R: TTTTAGATACGGGCAGTAGGGA
POSSRB548b F: ATTAATCGGGGATACACGACAG (T)10…(A)13 55 191 ycf3 CDS KY189099
R: ATTCCGACAACTTCAGGAGAAA
POSSR22b F: ATTGCAGGTTAACCCCCTTC (AT)7 55 190 rpl20 intron KY189089
R: AAAATCGGCGGAGAAGTTTT
POSSR30b F: TCGTCGGTAAATTCAACGGT (AT)7 55 360 trnD intron KY189092
R: AGGGGATCCCTCTTGTTTTT
POSSR44b F: GAATTTGTTTCTTCGTCTTTACAAAA (AT)7 55 173 trnH intron KY189093
R: GTGGATCAAGGCAGTGGATT
POSSR81b F: GCTCCGTTCCATGTCTCATT (TA)8 55 275 ycf1 intron KY189096
R: TGAAAAATCATCGCAAACCTC
POSSRB253b F: AATTAGGCTCGATCAACTGGAA (T)12 56 242 ycf2-ycf15 IGS KY411953
R: CTGTTCCTATCTAACGGAACGC
POSSRB426b F: ATTCAGTATCCTGCCACGAAAT (A)10 56 175 ycf2-ycf15 IGS KY411954
R: CGACCTTGCATTTTTCTACCTC
POSSRS6b F: CTGTTCCTATCTAACGGAACGC (A)12 56 242 ycf2-ycf15 IGS KY411955
R: AATTAGGCTCGATCAACTGGAA
POSSRS89b F: TTCGTGATTCCTTGGTAAATCC (A)10 56 203 atpF CDS KY411956
R: AGGCCATTTTATCGACATGAGT
POSSRS217b F: GATTACGATAAATTGGATCGGC (T)11 56 168 rps7 intron KY411957
R: ATCTTTCGAGATCCACCCTACA
POSSRS225b F: TTTCTTCCAACATAACAACCCC (T)15 56 152 rps18 intron KY411958
R: AAAGCGAGTCGACCACTAGAAC
POSSRB218c F: CGTTCCTTTTCTCTTGGACATC (TATTA)5 55 168 atp9 intron KY189090
R: TGCATGGGTCTTCCTTTCTTAT
POSSRB310c F: GAGTTTGAATTGACCCGGTTAG (CT)6 55 242 trnD-trnI IGS KY189091
R: CTAGGCAGCTATCGGAAAGAAA
POSSR53c F: AGGCTGCTAGGAAGGAGGAC (TA)6 55 175 ccmC-rps3 IGS KY189094
R: GGCACCATTTCAGAGAGGAG
POSSR61c F: CGGTGAAGTACCCCCTTACA (GA)6 55 242 nad1-atp1 IGS KY189095
R: GCTTCGGTGTAAGCACCAGT
POSSR95c F: GTATGTACCCCGATTCGCAC (CAAA)5 55 203 Rrn26-mttB IGS KY189097
R: GTCTAGGCTGATTTGGCAGG

Note: A = number of alleles; CDS = coding sequence; ES = expected band size; IGS = intergenic spacer; Ta = annealing temperature.

a

Position of each SSR is according to the NCBI sequence information of M. pinnata (GenBank accession no. JN673818.2 for the complete chloroplast genome and JN872550.1 for the complete mitochondrial genome).

b

Loci located in the chloroplast.

c

Loci located in the mitochondria.

The 17 selected primers exhibited high polymorphisms across 89 individuals of four M. pinnata populations. For each of these loci, the number of alleles per population, the number of effective alleles per population, Shannon’s information index, and the unbiased haploid diversity (hunb) of each microsatellite locus were calculated using GenAlEx version 6.5 (Peakall and Smouse, 2012). Among chloroplast loci, the number of alleles per locus per population varied from two to six, while hunb ranged from 0.391 to 0.857. For mitochondrial loci, two to four alleles per locus per population were detected and hunb ranged from 0.264 to 0.740 (Table 2). Subsequently, 16 of the 17 developed markers were successfully amplified in the related species M. pulchra, demonstrating their transferability (Table 2).

Table 2.

Characterization of 17 novel microsatellite markers in populations of Millettia pinnata and M. pulchra.a

Millettia pinnata Millettia pulchra
POPH (N = 26) POLS (N = 25) POCN (N = 14) PONS (N = 24) MVSD (N = 6)
Locus A Ae I hunb A Ae I hunb A Ae I hunb A Ae I hunb A Ae I hunb
POSSRB38b 4 3.159 1.209 0.711 3 2.323 0.944 0.593 3 2.882 1.079 0.703 4 3.032 1.190 0.699 3 2.571 1.011 0.733
POSSRB548b 5 4.225 1.487 0.794 6 4.496 1.614 0.810 3 2.579 1.004 0.659 5 3.945 1.452 0.779 3 2.000 0.868 0.600
POSSR22b 4 2.840 1.185 0.674 3 1.947 0.779 0.507 2 1.690 0.598 0.440 2 1.600 0.562 0.391 2 1.800 0.637 0.533
POSSR30b 4 3.314 1.266 0.726 3 2.462 0.974 0.620 2 1.960 0.683 0.527 3 1.646 0.675 0.409 2 2.000 0.693 0.600
POSSR44b 3 2.828 1.068 0.673 2 1.771 0.627 0.453 2 1.690 0.598 0.440 3 2.743 1.051 0.663 3 2.000 0.868 0.600
POSSR81b 4 2.704 1.170 0.655 4 3.307 1.290 0.727 2 1.849 0.652 0.495 4 2.969 1.200 0.692 2 1.800 0.637 0.533
POSSRB253b 4 2.704 1.170 0.655 3 1.947 0.779 0.507 4 2.390 1.055 0.626 4 3.245 1.228 0.723 3 2.571 1.011 0.733
POSSRB426b 5 3.347 1.345 0.729 4 2.376 1.085 0.603 4 2.882 1.195 0.703 6 5.434 1.738 0.851 2 1.800 0.637 0.533
POSSRS6b 5 2.522 1.173 0.628 6 5.631 1.760 0.857 4 3.267 1.277 0.747 6 3.556 1.501 0.750 2 2.000 0.693 0.600
POSSRS89b 4 3.414 1.307 0.735 3 2.828 1.068 0.673 4 3.379 1.272 0.758 4 2.717 1.179 0.659 3 2.571 1.011 0.733
POSSRS217b 5 3.453 1.401 0.740 5 3.307 1.315 0.727 4 3.267 1.254 0.747 5 3.550 1.397 0.751 2 1.800 0.637 0.533
POSSRS225b 4 3.073 1.220 0.702 5 3.342 1.356 0.730 5 3.500 1.390 0.769 5 3.789 1.471 0.768 2 1.471 0.500 0.400
POSSRB218c 4 3.414 1.307 0.735 2 1.676 0.593 0.420 2 1.324 0.410 0.264 3 2.743 1.051 0.663 3 2.571 1.011 0.733
POSSRB310c 3 2.770 1.058 0.665 3 1.900 0.807 0.493 2 1.960 0.683 0.527 3 2.323 0.960 0.594 2 1.800 0.637 0.533
POSSR53c 4 2.965 1.174 0.689 4 2.706 1.111 0.657 3 2.579 1.004 0.659 3 1.805 0.739 0.466 2 1.800 0.637 0.533
POSSR61c 3 2.104 0.901 0.547 3 2.990 1.097 0.693 2 1.960 0.683 0.527 3 2.667 1.028 0.652
POSSR95c 4 3.453 1.309 0.740 2 1.923 0.673 0.500 3 2.085 0.892 0.560 4 3.097 1.238 0.707 3 2.000 0.868 0.600

Note: — = not available; A = number of alleles per population; Ae = number of effective alleles per population; hunb = unbiased haploid diversity; I = Shannon’s information index; N = number of individuals analyzed.

a

Voucher and locality information are provided in Appendix 1.

b

Loci located in the chloroplast.

c

Loci located in the mitochondria.

CONCLUSIONS

The 17 polymorphic SSR markers developed here proved useful in the evaluation of the genetic diversity of M. pinnata, and 16 showed high transferability within the related species M. pulchra. This set of novel polymorphic SSR markers will serve as a very useful tool for the genetic diversity analysis, clonal identification, and germplasm conservation of M. pinnata and its related species.

Appendix 1.

Sampling information for the populations of Millettia pinnata and M. pulchra used in this study.

Species Population code Collection locality Geographic coordinates N Voucher no.a
Millettia pinnata (L.) Panigrahi POPH Perhentian Islands, Malaysia 5°54′34.12″N, 102°44′42.43″E 26 Liu20150926
POLS Laem Son, Thailand 6°56′21.10″N, 99°42′43.64″E 25 Huang20160701
POCN Chilaw, Sri Lanka 7°33′43.16″N, 79°48′5.96″E 14 Liu20161001
PONS Tainan, Taiwan, China 23°1′1.2″N, 120°7′1.20″E 24 He20121208
Millettia pulchra (Benth.) Kurz MVSD Heishiding, Guangdong, China 23°27′43.91″N, 111°54′32.37″E 6 Shi20161210

Note: N = number of individuals sampled.

a

All voucher specimens are deposited at the herbarium of Sun Yat-sen University (SYS), Guangzhou, China.

LITERATURE CITED

  1. Arpiwi N. L., Yan G., Barbour E. L., Plummer J. A. 2013. Genetic diversity, seed traits and salinity tolerance of Millettia pinnata (L.) Panigrahi, a biodiesel tree. Genetic Resources and Crop Evolution 60: 677–692. [Google Scholar]
  2. Doyle J. J. 1991. DNA protocols for plants. In G. M. Hewitt, A. W. B. Johnston, and J. P. W. Young [eds.], Molecular techniques in taxonomy, 283–293. Springer-Verlag, Berlin, Germany. [Google Scholar]
  3. Hu J. M., Lavin M., Wojciechowski M. F., Sanderson M. J. 2000. Phylogenetic systematics of the tribe Millettieae (Leguminosae) based on chloroplast trnK/matK sequences and its implications for evolutionary patterns in Papilionoideae. American Journal of Botany 87: 418–430. [PubMed] [Google Scholar]
  4. Hu J. M., Lavin M., Wojciechowski M. F., Sanderson M. J. 2002. Phylogenetic analysis of nuclear ribosomal ITS/5.8S sequences in the tribe Millettieae (Fabaceae): Poecilanthe-Cyclolobium, the core Millettieae, and the Callerya group. Systematic Botany 27: 722–733. [Google Scholar]
  5. Huang J. Z., Guo X. H., Hao X. H., Zhang W. K., Chen S. Y., Huang R. F., Gresshoff P. M., Zheng Y. Z. 2016. De novo sequencing and characterization of seed transcriptome of the tree legume Millettia pinnata for gene discovery and SSR marker development. Molecular Breeding 36: 75. [Google Scholar]
  6. Peakall R., Smouse P. E. 2012. GenAlEx 6.5: Genetic analysis in Excel. Population genetic software for teaching and research–An update. Bioinformatics (Oxford, England) 28: 2537–2539. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Powell W., Morgante M., Andre C., McNicol J. W., Machray G. C., Doyle J. J., Tingey S. V., Rafalski J. A. 1995. Hypervariable microsatellites provide a general source of polymorphic DNA markers for the chloroplast genome. Current Biology 5: 1023–1029. [DOI] [PubMed] [Google Scholar]
  8. Provan J., Powell W., Hollingsworth P. M. 2001. Chloroplast microsatellites: New tools for studies in plant ecology and evolution. Trends in Ecology & Evolution 16: 142–147. [DOI] [PubMed] [Google Scholar]
  9. Rozen S., Skaletsky H. 1999. Primer3 on the WWW for general users and for biologist programmers. In S. Misener and S. A. Krawetz [eds.], Methods in molecular biology, vol. 132: Bioinformatics: Methods and protocols, 365–386. Humana Press, Totowa, New Jersey, USA. [DOI] [PubMed] [Google Scholar]
  10. Sahoo D. P., Aparajita S., Rout G. R. 2010. Inter and intra-population variability of Pongamia pinnata: A bioenergy legume tree. Plant Systematics and Evolution 285: 121–125. [Google Scholar]
  11. Satyavati G. V., Gupta A. K., Tandon N. 1987. Medicinal plants of India, vol. 2, p. 490. India Council of Medicinal Research, New Delhi, India. [Google Scholar]
  12. Scott P. T., Pregelj L., Chen N., Hadler J. S., Djordjevic M. A., Gresshoff P. M. 2008. Pongamia pinnata: An untapped resource for the biofuels industry of the future. BioEnergy Research 1: 2–11. [Google Scholar]
  13. Sharma S. S., Negi M. S., Sinha P., Kumar K., Tripathi S. B. 2011. Assessment of genetic diversity of biodiesel species Pongamia pinnata accessions using AFLP and Three Endonuclease-AFLP. Plant Molecular Biology Reporter 29: 12–18. [Google Scholar]
  14. Sharma S. S., Islam M. A., Negi M. S., Tripathi S. B. 2014. Isolation and characterization of a first set of nine polymorphic microsatellite loci in Pongamia pinnata (Fabaceae). Journal of Genetics 93: e70–e74. [PubMed] [Google Scholar]
  15. Soranzo N., Provan J., Powell W. 1999. An example of microsatellite length variation in the mitochondrial genome of conifers. Genome 42: 158–161. [PubMed] [Google Scholar]
  16. Thiel T., Michalek W., Varshney R. K., Graner A. 2003. Exploiting EST databases for the development and characterization of gene-derived SSR-markers in barley (Hordeum vulgare L.). Theoretical and Applied Genetics 106: 411–422. [DOI] [PubMed] [Google Scholar]

Articles from Applications in Plant Sciences are provided here courtesy of Wiley

RESOURCES