Skip to main content
Proceedings of the National Academy of Sciences of the United States of America logoLink to Proceedings of the National Academy of Sciences of the United States of America
. 2017 May 1;114(20):E4065–E4074. doi: 10.1073/pnas.1617392114

Evolutionarily conserved TRH neuropeptide pathway regulates growth in Caenorhabditis elegans

Elien Van Sinay a, Olivier Mirabeau b, Geert Depuydt a, Matthias Boris Van Hiel a, Katleen Peymen a, Jan Watteyne a, Sven Zels a, Liliane Schoofs a,1, Isabel Beets a,1
PMCID: PMC5441806  PMID: 28461507

Significance

The hypothalamic neuropeptide TRH (thyrotropin-releasing hormone) is one of the major endocrine factors that regulate vertebrate physiology. For decades the general assumption has been that TRH neuropeptides are not present in protostomes, at least not in ecdysozoans, despite the presence of TRH receptor orthologs in these phyla. Here we identify a TRH-related neuropeptide–receptor pathway in the nematode Caenorhabditis elegans. TRH-like neuropeptides activate the C. elegans TRH receptor ortholog in cell-culture cells. Using RNAi and CRISPR/Cas9 reverse genetics, we discovered that TRH-related signaling in the pharyngeal system promotes C. elegans growth. Our study provides evidence of a functional TRH neuropeptide–receptor pathway in invertebrates, suggesting that TRH signaling had evolved in a bilaterian ancestor more than 700 million years ago.

Keywords: thyrotropin-releasing hormone, C. elegans, neuropeptide, molecular evolution, growth regulation

Abstract

In vertebrates thyrotropin-releasing hormone (TRH) is a highly conserved neuropeptide that exerts the hormonal control of thyroid-stimulating hormone (TSH) levels as well as neuromodulatory functions. However, a functional equivalent in protostomian animals remains unknown, although TRH receptors are conserved in proto- and deuterostomians. Here we identify a TRH-like neuropeptide precursor in Caenorhabditis elegans that belongs to a bilaterian family of TRH precursors. Using CRISPR/Cas9 and RNAi reverse genetics, we show that TRH-like neuropeptides, through the activation of their receptor TRHR-1, promote growth in C. elegans. TRH-like peptides from pharyngeal motor neurons are required for normal body size, and knockdown of their receptor in pharyngeal muscle cells reduces growth. Mutants deficient for TRH signaling have no defects in pharyngeal pumping or isthmus peristalsis rates, but their growth defect depends on the bacterial diet. In addition to the decrease in growth, trh-1 mutants have a reduced number of offspring. Our study suggests that TRH is an evolutionarily ancient neuropeptide, having its origin before the divergence of protostomes and deuterostomes, and may ancestrally have been involved in the control of postembryonic growth and reproduction.


After Harris’s initial proposal on the hypothalamic control of pituitary secretion (1), it took almost two decades to identify the first hypophysiotropic molecule. In 1969 the groups of Schally and Guillemin isolated the tripeptide pQHP-NH2 (2, 3), named “thyrotropin-releasing hormone” (TRH). The sequence of TRH is fully conserved across all vertebrates, indicating that strong evolutionary pressure has acted to preserve its structure (4). In all vertebrate phyla TRH is synthesized from a larger precursor protein (preproTRH) that contains five to eight copies of the TRH sequence (4). Following the explosion of genome and transcriptome sequence data, preproTRH was identified in chordate species lacking a bona fide pituitary, e.g., cephalochordates (5), and in the genomes of more ancient deuterostomes, including echinoderms (6, 7). In contrast to vertebrate (pQHP-NH2) and chordate (pQSP-NH2) tripeptide TRHs, most predicted echinoderm TRHs are tetrapeptides (pQ[W/Y][Y/F/P][T/G/A]-NH2) (8). Like vertebrate TRH, they are small peptides with an N-terminal pyroglutamate, a C-terminal amide (-NH2) group, and amino acids with aromatic or cyclic side chains at the second and third positions. TRH therefore is widely distributed throughout the deuterostomian lineage of the Animal Kingdom, suggesting an ancient origin for this neuropeptide hormone.

In mammals, hypothalamic TRH is the prime regulator of the set point of thyroid-stimulating hormone (TSH) synthesis and secretion by the anterior pituitary thyrotrophs (9). TSH secretion stimulates the thyroid gland to produce the thyroid hormones (THs) thyroxine (T4) and triiodothyronine (T3). The hypothalamus–pituitary–thyroid (HPT) axis is essential for growth, metabolism, and energy homeostasis (1012). THs have pleiotropic effects on vertebrate development, with amphibian metamorphosis being the most spectacular example (9). THs can also induce metamorphosis in urochordates, Amphioxus, and echinoderms (5, 13, 14). Although this function of THs likely originated early in deuterostomian evolution (15), the prime role of TRH in controlling TH levels seems to have evolved more recently in vertebrates. In fish and amphibians, TRH has no or only a minor effect on the production of TSH but allows the secretion of growth hormone (GH), prolactin (PRL), and α-melanocyte–stimulating hormone (α-MSH) (9, 16). In nonmammalian vertebrates corticotropin-releasing hormone (CRH), a prime regulator of stress responses, is a potent inducer of TSH secretion (16). These effects raise the question as to what the ancient function of TRH might have been. In addition to its role in the HPT axis, mammalian TRH has pleiotropic neuromodulatory functions in the control of arousal, sleep, food intake, thermogenesis, locomotor activity, and immunity (reviewed in refs. 17 and 18). TRH is also secreted from nonhypophysiotropic neurons in the CNS and from a number of peripheral organs, including the pituitary, thyroid, placenta, gallbladder, and testis (17, 18).

Like most neuropeptides, TRH acts through G protein-coupled receptors (GPCRs) named “TRH receptors” (TRHRs). Orthologs of mammalian TRHRs are conserved in all major deuterostomian lineages (19, 20). Phylogenetic analyses across bilaterians also revealed orthologs of deuterostomian TRHRs in Protostomia, in both lophotrochozoan and ecdysozoan species. TRHR orthologs were identified in the annelid Platynereis dumerilii and in the genomes and transcriptomes of mollusks, arthropods, and Caenorhabditis elegans (1921). However, with the exception of Platynereis and molluscan EFLGamides, no ortholog of the vertebrate TRH precursor was found in any protostomian genome (21, 22). Therefore, it has been proposed that the HPT axis of vertebrates, including TRH, has been lost in protostomes, at least in the ecdysozoan phyla (arthropods and nematodes) (2124). In contrast, the conserved TRH precursors in deuterostomes and the occurrence of TRHR orthologs in both deuterostomes and protostomes, including in ecdysozoans, suggests that the evolutionary origin of TRH signaling dates back to a common ancestor of bilaterian animals. The most parsimonious hypothesis for the evolutionary conservation of TRHRs across protostomes suggests the existence of a conserved protostomian TRH system. Here, we identified a TRH-related neuropeptide pathway in the nematode C. elegans. Using RNAi and CRISPR/Cas9 reverse genetics, we demonstrate that C. elegans TRH-like signaling is required for growth and regulates body size.

Results

Identification of a TRH Precursor Ortholog in C. elegans.

C. elegans has a single receptor ortholog of vertebrate TRHRs encoded by the gene C30F12.6 (19, 20). The protein is an orphan receptor of the rhodopsin GPCR family and was originally named “NMUR-4” based on its sequence similarity to mammalian neuromedin U receptors (NMURs). Phylogenetic analyses show that NMUR-4 is orthologous to vertebrate TRHRs (Fig. 1A and refs. 19 and 20). Therefore, we refer to NMUR-4 from here onwards as “TRHR-1.” To identify the cognate ligand(s) of this receptor, we expressed TRHR-1 with the promiscuous Gq-like Gα16 protein in Chinese hamster ovary (CHO) cells and monitored its activation by a bioluminescent calcium indicator (Fig. 1B). We challenged receptor-expressing cells with a synthetic library of more than 250 known and predicted C. elegans peptides, but none was able to activate TRHR-1.

Fig. 1.

Fig. 1.

C. elegans TRH-1 neuropeptides activate the TRHR ortholog TRHR-1. (A) Tree-like representation of the phylogenetic relationship between C. elegans TRHR-1, protostomian, and deuterostomian TRHRs. Sequences are identified using their genus or full scientific name (for Caenorhabditis species) and their GenBank accession number (by default), JGI (for Lottia and Capitella sequences), or WormBase identifiers (for nematode sequences). Groups of sequences are colored according to their phyletic distribution, indicated in italic from top to bottom as nematodes, arthropods, annelids, mollusks, ambulacrarians (echinoderms and hemichordates), and chordates. Human neuromedin U (Homo_NMUR1/2), neurotensin (Homo_NTR1/2), ghrelin (Homo_GHSR), and motilin (Homo_MTLR) receptors were used as outgroup to root the tree, because this group of sequences was previously shown to be most related to bilaterian TRHRs (19, 20). Branches with a support value below 0.5 were collapsed, and circles associated with each branch were drawn with a diameter proportional to the branch values. (B) Luminescence-based calcium mobilization assay for measuring GPCR activation. The GPCR is expressed in CHO cells coexpressing aequorin and the promiscuous human Gα16 subunit. Upon agonist binding, GPCR activation initiates the release of calcium from intracellular storage sites, which is monitored using the calcium-sensitive biosensor aequorin. (C) Domain structures of the C. elegans TRH-1 precursor. Predicted proprotein convertase sites are in purple; the arrowhead indicates the site of a premature stop codon in a trh-1–mutant allele, lst1118, generated by CRISPR/Cas9. C′, carboxyl terminus; N′, amino terminus. (D and E) TRH-1 neuropeptides dose-dependently activate TRHR-1 in a cellular assay described in B. The EC50 values (95% CI) are 0.27 nM (0.24–0.31 nM) for GRELF-NH2, 0.50 nM (0.39–0.66 nM) for ANELF-NH2, 0.98 nM (0.82–1.18 nM) for RGRELF-NH2, and 2.85 nM (2.41–3.37 nM) for RANELF-NH2. Cells transfected with an empty vector were used as a negative control. Dose–response data are shown as relative (%) to the highest value (100% activation) after normalization to the total calcium response. Error bars represent SEM; n ≥ 3.

The lack of TRHR-1 activation by known C. elegans peptides and the presence of orphan TRHR orthologs in Ecdysozoa and Lophotrochozoa led us to hypothesize that an as yet unknown family of TRH-like precursors might be present in these phyla and might encode the cognate ligand of TRHR-1. We therefore performed an in silico search for TRH-like neuropeptide precursors in C. elegans. Using a hidden Markov model (HMM)-based strategy (19, 20), we first generated a list of peptide precursor candidates in the C. elegans genome that showed conservation across protostomes. From this screening strategy the ELFamide precursor, encoded by the C. elegans gene C30H6.10, stood out as the most promising candidate, because (i) it was conserved across all the main protostomian phyla, and (ii) it yielded peptides with features similar to TRHs in terms of their small size (five or six amino acids) and biochemical characteristics (see below). The newly predicted ELFamide precursor has 96 amino acid residues including an N-terminal signal sequence (Fig. 1C). It contains two TRH-like progenitor sequences that are preceded by a triple basic site (KRR or RRR) (Fig. 1C). The presence of a C-terminal glycine residue in these peptide sequences is indicative of posttranslational modification to an amide (-NH2) group in the mature peptides (25). Based on its relationship to deuterostomian trh precursor genes, we propose designating C30H6.10 as the thyrotropin-releasing hormone 1 (trh-1) gene.

TRH-1 Neuropeptides Activate C. elegans TRHR-1.

To determine whether the predicted TRH-like peptides are ligands of TRHR-1, we tested synthetic peptide replicates of GRELF-NH2 and ANELF-NH2 in our calcium bioluminescence assay (Fig. 1B). Because both peptides are preceded by a tribasic site in the TRH-1 precursor, we also tested the activity of RGRELF-NH2 and RANELF-NH2 peptides that are generated if cleavage occurs after the second arginine residue. All TRH-1 peptides activated TRHR-1 dose dependently and with nanomolar EC50 values, whereas cells transfected with a control vector showed no calcium responses (Fig. 1 D and E). TRHR-1 was not activated by scrambled TRH-1 peptides (Fig. 2 A and B) or by any other neuropeptide-like protein (NLP) or FMRFamide-like peptide (FLP) of C. elegans. TRH-1 peptides therefore specifically activate TRHR-1 in cellulo, suggesting that they are the cognate ligands of this receptor. We further studied TRHR-1 signaling in cells lacking expression of the Gα16 subunit, which couples the receptor to the Gαq pathway regardless of its endogenous G-protein coupling. When expression of Gα16 was omitted, TRH-1 peptides elicited strong calcium responses (Fig. S1A), indicating that TRHR-1 can couple to endogenous Gαq proteins in CHO cells and can signal through the calcium pathway.

Fig. 2.

Fig. 2.

Different TRHR orthologs are activated by TRH-1 peptides in cellulo. (A and B) C. elegans TRHR-1 expressed in CHO cells (as described in Fig. 1B) is activated by TRH-1 peptides but not by scrambled peptides of GRELF-NH2 (peptide 1: RELFG-NH2; peptide 2: EFLRG-NH2; peptide 3: EGFLR-NH2) (A) and ANELF-NH2 (peptide 1: LFAEN-NH2; peptide 2: NELAF-NH2; peptide 3: FNEAL-NH2) (B). (C and D) TRH-1 peptides activate human (C) and Platynereis (D) TRHRs at micromolar concentrations in cell culture cells. Human TRH and Platynereis EFLGamide were used as positive controls. Statistical significance of peptide-evoked responses compared with the BSA control (***P < 0.001) was determined by two-way ANOVA and Sidak multiple comparison test. Data are shown as the ratio of peptide-evoked responses to total calcium responses. Error bars represent SEM; n ≥ 3.

Fig. S1.

Fig. S1.

(A) Dose-dependent activation of TRHR-1 by GRELF-NH2 and ANELF-NH2 in CHO cells expressing TRHR-1 in the absence of the promiscuous Gα16 protein. The EC50 values for GRELF-NH2 and ANELF-NH2 are 0.09 nM (95% CI, 0.06–0.13 nM) and 0.14 nM (95% CI, 0.10–0.21 nM), respectively. (B) Calcium responses of TRHR-1/Gα16–expressing cells challenged with truncated or nonnematode TRH peptides. Data are shown as the ratio of the peptide-evoked response to the total calcium response. Species abbreviations are Caenorhabditis elegans, Cele; Homo sapiens, Hsap; Platynereis dumerilii, Pdum; and Strongylocentrotus purpuratus, Spur. Statistical significance (***P < 0.001) compared with the BSA control was determined using two-way ANOVA and Sidak multiple comparison test. Error bars represent SEM; n ≥ 3. (C and D) Dose–response curves of calcium responses induced by a series of alanine analogs of GRELF-NH2 and ANELF-NH2 in TRHR-1/Gα16–expressing CHO cells. Data are shown as relative (%) to the highest value (100% activation) after normalization to the total calcium response. Error bars represent SEM; n ≥ 3. (E) Relative activation of TRH-1 alanine analogs at a concentration of 10−6 M compared with GRELF-NH2 or ANELF- NH2. EC50 values and 95% CIs are given for peptides for which the dose–response curve reached a plateau at 1 μM.

Neuropeptide ligands have been identified for vertebrate and Platynereis TRHRs (22, 26). We tested whether TRH-like peptides of these species could activate C. elegans TRHR-1 in cell-culture cells (Fig. 1B). Both vertebrate TRH (pQHP-NH2) and Platynereis EFLGamide (FSEFLG-NH2) activated TRHR-1 at 10 μM (Fig. S1B). The predicted echinoderm TRH of Strongylocentrotus purpuratus (pQYPG-NH2 and ref. 6) elicited no calcium response (Fig. S1B). C. elegans TRH-1 peptides also activated the human and Platynereis TRHRs at concentrations down to 1 µM (Fig. 2 C and D). Because ligand–receptor couples coevolve, cross-activation of TRHRs by TRH-like peptides from different species is expected to require high ligand concentrations. Taken together, these results support the evolutionary conservation of a TRH-related signaling system in C. elegans.

C. elegans TRH-1 peptides have five to six amino acid residues. To determine residues that are crucial for activation of TRHR-1, we tested a series of analogs in which amino acids of TRH-1 were replaced by alanine residues (Fig. S1 CE). Substitution of the N-terminal glycine, arginine, or asparagine residues had nearly no effect on peptide activity. By contrast, the activity of TRH-1 peptides was strongly reduced when residues of the C-terminal ELFamide sequence were replaced by alanine (Fig. S1 CE). Hence the ELF-NH2 tripeptide motif, which is conserved in all TRH-1 peptides, is important for activating TRHR-1, although it is not sufficient to elicit full receptor activation (Fig. S1B).

Comparison of TRH-Like Neuropeptides in Protostomia.

In addition to C. elegans TRH-1, our in silico search for TRH precursor orthologs identified TRH-like sequences in the genomes of several protostomes, including annelids, mollusks, arthropods, and other nematode species (Fig. 3). Like deuterostome TRHs, all protostomian TRH-like peptides have short sequences and a C-terminal amide group. All listed TRH-like peptides contain five to eight amino acids in protostomes, four residues in echinoderms, and three amino acids in vertebrates. The C-terminal E-[L/F]-[L/F/V]-[G/Ø]-NH2 motif is common to all protostomian TRH-like sequences. On the other hand, all deuterostomian TRHs share a pyroglutamate residue (pQ) that can be generated from an N-terminal glutamine or glutamic acid residue. In protostomes, the glutamic acid residue is not situated at the N terminus, suggesting that the pyroglutamate modification most likely arose later in evolution. Furthermore, all TRH precursors yield multiple related peptides, ranging from two copies in C. elegans to more than 20 variants in annelids and Branchiostoma.

Fig. 3.

Fig. 3.

Amino acid sequence alignment of TRH-like neuropeptides of representative protostomians and deuterostomians. Identical amino acids are highlighted in black, and similar amino acids are highlighted in gray (pQ is a posttranslationally modified glutamate or glutamine). Sequences were placed and colored according to their phyletic group, following the scheme in Fig. 1A. Names of TRH-like peptides that have already been identified and named in some species (EFLGamides in Platynereis dumerilii, fulicins in Achatina fulica, and TRH in chordates) are indicated in bold. The C-terminal amide (-NH2) groups are indicated by “a” and pyroglutamate residues as “pQ.” Sequences can be identified by their names, either through GenBank (for most sequences), JGI (for Capitella), or the Contig number (for Pristionchus). The number of peptides with a sequence identical to the one shown and the total number of TRH-like peptides encoded by the precursor are indicated in parentheses at the end of the names. For example, there are four copies of the FGEFLGa Capitella peptide in the precursor (GenBank ID: 198246), which codes for 21 peptides in total. For each species, only the most abundant peptide sequence or two examples of peptides in the precursor are represented. Protostomian sequences share a common core signature E-[L/F]-[L/F/V], and deuterostomian sequences harbor a common N-terminal pyroglutamate residue.

C. elegans TRH-1 and TRHR-1 Are Expressed at the Neuromuscular Pharynx.

To gain hints on putative functions of TRH-1 signaling, we determined the expression patterns of trh-1 and trhr-1. Transgenic C. elegans expressing translational fosmid-recombineered GFP transgenes or a polycistronic Ptrhr-1::trhr-1::SL2::gfp reporter transgene showed trhr-1 expression only at the pharynx (Fig. 4A and Fig. S2 A and B). The pharynx is a neuromuscular feeding organ that consists of three functional parts: the corpus, subdivided into an anterior procorpus and a posterior metacorpus, the isthmus, and the terminal bulb (27). More specifically, TRHR-1 localized to pharyngeal muscle cells of the metacorpus (pm4) and the isthmus (pm5).

Fig. 4.

Fig. 4.

(A and B) Representative confocal Z-stack projections of the head region showing expression of a gfp reporter transgene containing the promoter and cDNA sequences of trhr-1 (A) and trh-1 (B). Asterisks mark fluorescence in the intestine resulting from the coinjection marker Pelt-2::mCherry. (Scale bars, 10 µm.) (C and D) trh-1(lst1118) mutants fed E. coli OP50 have normal isthmus peristalsis (n = 22) (C) and pharyngeal pumping rates (n = 10) (D). Data were analyzed by a two-tailed unpaired t test (ns, not significant: P > 0.05). Error bars represent SD.

Fig. S2.

Fig. S2.

Representative confocal Z-stack projections of the head region showing expression of a translational fosmid-recombineered gfp reporter transgene of trhr-1 (A) or a gfp reporter transgene containing the promoter and genomic sequences of trhr-1 (B) or trh-1 (C). Expression of trh-1 is observed consistently in motor neurons M4 and M5 and is observed occasionally in an additional cell. (Scale bars, 10 µm.)

Reporter transgenes for trh-1, including the trh-1 promoter region and the gene's genomic or cDNA sequence, showed similar expression patterns in the pharyngeal nervous system that is separated from the CNS by a basal lamina but is thought to secrete signals to the pseudocoelomic fluid (28). We identified trh-1–expressing cells as the pharyngeal motor neurons M4 and M5 based on their position and morphology (Fig. 4B and Fig. S2C). M4 directly innervates the pharyngeal muscle pm5 and controls isthmus peristalsis; the function of the motor neuron M5 is unclear (27, 29).

CRISPR/Cas9-Induced Knockout Mutants of trh-1 Have Normal Pharyngeal Pumping and Peristalsis Rates.

The pharyngeal motor neuron M4, which expresses trh-1, is essential for feeding because it controls peristalsis of the posterior isthmus muscles of the pharynx (30, 31). We therefore hypothesized that TRH-1 neuropeptides might regulate isthmus peristalsis. Because no null mutants of trh-1 were available, we used CRISPR/Cas9-mediated genome editing to introduce mutations in the trh-1 gene. We isolated a loss-of-function trh-1 allele, lst1118, with an 8-bp indel (Fig. 1C). The mutation caused a frameshift and premature stop codon immediately downstream of the signal peptide sequence, which should target the aberrant trh-1 transcripts for nonsense-mediated decay and fully eliminate trh-1 function.

We examined the isthmus peristalsis rate of trh-1 mutants by feeding worms red fluorescent Escherichia coli OP50 bacteria, allowing direct visualization of the peristaltic contractions of the pharyngeal isthmus (32, 33). There was no difference in the isthmus peristalsis rates of wild-type and trh-1–mutant worms fed OP50 (Fig. 4C). The rates of pharyngeal pumping while feeding on E. coli OP50 were similar as well (Fig. 4D). These results suggest that TRH-1 neuropeptides have no obvious effects on isthmus peristalsis or on pharyngeal pumping.

The TRH-1/TRHR-1 Pathway Promotes Growth in C. elegans.

Although the role of TRH-like peptides in protostomes has remained unknown, TRH signaling in vertebrates regulates several aspects of physiology, such as development, growth, reproduction, and locomotor activity (9, 3439). We investigated if TRH-1 neuropeptides mediate C. elegans locomotion by measuring the forward speed of worms on a bacterial lawn and off food. In both cases, trh-1 mutants crawled at a speed similar to that of wild-type worms (Fig. S3 A and B).

Fig. S3.

Fig. S3.

(A and B) The absolute speed of trh-1(lst1118) mutants on an OP50 bacterial lawn (A) and off food (B) is not significantly different (P > 0.05) from that of wild-type worms. Data were analyzed by a two-tailed unpaired t test. Error bars represent SD; n ≥ 27 (A) and n = 18 (B). (C) Progression of egg-laying of wild-type worms (n = 72) and trh-1(lst1118) mutants (n = 57). trh-1(lst1118) mutants display a normal temporal pattern of egg-laying but have a significantly lower rate of fertile egg production at all time points except at 60 h, at 120 h, and from 144 h onwards. (D) Total number of offspring of wild-type worms (n = 72), trh-1(lst1118) mutants (n = 57), and trh-1 mutants expressing trh-1 under the control of its promoter (Ptrh-1::trh-1). Data were analyzed by a two-tailed unpaired t test; for multiple comparisons, statistical significance was determined using the Holm–Sidak method, with α = 5%. Error bars represent SEM (C) or SD (D). *P < 0.05; ***P < 0.001; ns, not significant.

In vertebrates, TRH promotes growth as a stimulatory factor of GH secretion (9). To determine whether trh-1 regulates growth in C. elegans, we quantified worm sizes by measuring the length and width of formaldehyde-fixed or anesthetized worms and approximated their volume as a cylinder. We synchronized a population of worms by embryonic starvation, leading to developmental arrest at the first larval stage (L1), and quantified the body volume every 24 h after feeding until the fifth day of adulthood. The body size of trh-1 mutants was smaller than that of wild-type worms 24 h after L1 arrest. This size defect increased and persisted in subsequent larval and adult stages (Fig. 5A and Fig. S4 A and B). The trh-1 mutants showed a reduced growth rate from early larval stages to adulthood (Fig. S4 C and D). The largest difference was seen around 48 h after the L1 arrest, corresponding to the fourth larval (L4) stage and its transition to adulthood. The body size defect was most pronounced at the adult stage (Fig. 5A). Therefore 1-day-old adult worms were used in further experiments. trh-1 mutants had a significantly smaller body length and width, resulting in a reduced body volume (Fig. 5 BD). Restoring trh-1 expression under the control of its promoter rescued the size defect (Fig. 5D); hence TRH-1 neuropeptides are required for normal body size. Overexpression of the neuropeptide significantly increased the body volume of wild-type worms, suggesting that trh-1 is sufficient to induce growth (Fig. 5D).

Fig. 5.

Fig. 5.

TRH-1/TRHR-1 signaling promotes growth in C. elegans. (A) Growth curves of wild-type and trh-1(lst1118) mutants fed E. coli OP50. Each time point represents the average body volume of at least 3,000 worms. The first time point corresponds to the time when L1 larvae, synchronized by embryonic starvation, were fed. Worms reach the adult stage between 48 and 72 h. trh-1(lst1118) mutants show a reduced body volume compared with wild-type worms from 24 h after feeding (Inset) to the adult stage. (B and C) Body length (B) and width (C) of 1-day-old adults. (D) Body volume of 1-day-old adults. Expression of trh-1 under the control of its promoter sequence (Ptrh-1::trh-1) rescues the small body size of trh-1(lst1118) mutants, and worms overexpressing (OE) trh-1 have a larger body size than wild-type worms. Similar to trh-1(lst1118) mutants, RNAi-mediated knockdown of trhr-1 decreases body volume in three independent knockdown strains. (E) trh-1 and trhr-1 function together in vivo. The body size of trh-1(lst1118);trhr-1(RNAi) worms is similar to that of trh-1(lst1118)–mutant and trhr-1(RNAi) worms. trh-1 overexpression increases body size of wild-type worms, but this effect is suppressed by knockdown of its receptor trhr-1. (F) M4-specific expression of trh-1 from the ceh-28 promoter (Pceh-28::trh-1) partially rescues the reduced body size of trh-1(lst1118) mutants. (G) Expression of trh-1 under the control of the glr-8 promoter sequence (Pglr-8::trh-1) rescues the small body size of trh-1(lst1118) mutants. (H) TRHR-1 signaling in pharyngeal muscles mediates growth. Tissue-specific knockdown of trhr-1 in pharyngeal muscles reduces body volume. Data are shown relative to the body volume, length, or width of wild-type worms (100%). Statistical significance (compared with wild-type worms unless indicated otherwise) was determined using one-way ANOVA and Sidak multiple comparison test (B and EH) or a two-tailed unpaired t test (C and D). Error bars represent SEM; n is shown in each bar. *P < 0.05; **P < 0.01; ***P < 0.001; ns, not significant.

Fig. S4.

Fig. S4.

Growth curves of wild-type and trh-1(lst1118) mutants fed E. coli OP50 at 20 °C. (A and B) Each time point represents the average body length (A) and width (B) of at least 3,000 worms. The first time point corresponds to the time when L1 larvae, synchronized by embryonic starvation, were fed. Worms reach the adult stage between 48 and 72 h. The trh-1(lst1118) mutants show reduced body length and width compared with wild-type worms from 24 h after feeding to the adult stage. (C and D) Increase in body length (C) and width (D) over time of wild-type and trh-1(lst1118) mutants, fed E. coli OP50 at 20 °C. The R2 values of the sigmoid logistic regression fit vary from 0.97 to 0.99. Gray shading indicates statistically significant (P < 0.05) differences in growth rate between wild-type and trh-1(lst1118) mutants. This difference is most prominent around 48 h after L1 arrest, at the larval-to-adult transition. Statistical significance was determined by two-way ANOVA and Sidak test. Error bars represent SEM.

We next investigated the role of TRHR-1 in growth regulation. Although a strain carrying a trhr-1 mutant allele is available (RB1284), we found that a genomic sequence of the reported deletion is still present in the strain's background and that it is unlikely to be a trhr-1–null mutant. We therefore applied RNAi using trhr-1 promoter-driven sense and antisense (sas) transgenes (40). Knockdown of trhr-1 significantly decreased body volume (Fig. 5D). To verify that TRH-1 and its receptor function together in vivo, we combined knockdown of trhr-1 with overexpression or knockout of trh-1. The body size of trh-1(lst1118);trhr-1(RNAi) worms was similar to that of trh-1(lst1118) mutants or trhr-1(RNAi) worms (Fig. 5E). trh-1 overexpression increased the body size of wild-type worms, and knockdown of trhr-1 suppressed this effect (Fig. 5E). Taken together, these results indicate that TRH-1 regulates growth through the activation of its receptor TRHR-1.

A reduction in body volume may result from slower development caused by impaired TRH-1 signaling. However, trh-1 overexpression increased the body size of wild-type worms. The size defect of trh-1 mutants also persisted at least 5 days into adulthood (from 72 h onwards; Fig. 5A), suggesting that growth, and not development, is affected. Corroborating this finding, trh-1 mutants displayed little to no delay in reproductive maturation (Fig. S3C). As with wild-type worms, egg-laying of trh-1 mutants started within 72 h after synchronized L1 larvae were fed and reached its maximum at the second day of adulthood (Fig. S3C). Although reproductive maturation was normal, the number of viable offspring was significantly reduced by 17% in trh-1 mutants compared with wild-type worms (Fig. S3D). This defect may indicate a role of trh-1 in regulating C. elegans reproduction. However, reintroducing a wild-type copy of trh-1 cDNA that restored the growth defect failed to rescue the reduced brood size of the mutant strain (Fig. S3D).

Pharyngeal TRH-1 Signaling Controls Body Size.

Both TRH-1 neuropeptides and their receptor are expressed at the neuromuscular pharynx. To determine the cellular basis of TRH-1–mediated growth, we transgenically restored trh-1 gene expression in specific neurons in worms otherwise lacking trh-1 function. Although no cell-specific promoter is known to drive expression in the M5 neuron, we used the ceh-28 promoter to restore trh-1 expression only in the pharyngeal motor neuron M4 (41). M4-specific expression of trh-1 partially rescued the reduced body size of trh-1 mutants (Fig. 5F), indicating that trh-1 is required in M4 to promote growth. The partial rescue effect suggests that growth regulation likely depends on trh-1 functions in M4 and M5 neurons. The growth defect of trh-1 mutants was fully rescued when we restored trh-1 expression under the control of trh-1 or glr-8 promoters (Fig. 5 D and G), which drive expression in both M4 and M5 neurons (in addition to other neurons driven by the glr-8 promoter) (Table S1) (42). To determine the cellular focus of trhr-1, we performed a tissue-specific knockdown of the receptor in pharyngeal muscle cells by expressing sense and antisense transgenes under control of the myo-2 promoter (43). Knockdown of trhr-1 in the pharyngeal muscles resulted in a significantly decreased body volume, comparable to the reduced size of the trh-1 mutant (Fig. 5H).

Table S1.

Promoters and their expression patterns

Promoter Expression Reference
trh-1 M4 and M5 This paper
trhr-1 pm4 and pm5 This paper
ceh-28 M4 (41)
glr-8 I1, I2, MC, NSM, M3 (left/right), I3, MI M4, M3 (left/right), I6, M5, BDU, ALM, PLM, and URB (left/right) (42)
myo-2 pharyngeal muscles (43)

TRH-1 Signaling Regulates Growth Independently of TGF-β Signaling and Depending on Bacterial Diet.

DBL-1, a ligand of the TGF-β superfamily, is a major growth regulator in C. elegans. Among other cells, it is synthesized in the trh-1–expressing neuron M4 (44, 45). Similar to trh-1 mutants, worms deficient in dbl-1 signaling hatch as L1 larvae indistinguishable in length from wild-type L1s and display a continuously reduced body size throughout development (46). To determine whether trh-1 and dbl-1 act in the same growth-regulatory pathway, we measured the body volume of trh-1;dbl-1 mutants. Double-mutant worms were significantly smaller than trh-1 and dbl-1 single mutants (Fig. 6A), suggesting that trh-1 regulates body size independently of DBL-1/TGF-β signaling.

Fig. 6.

Fig. 6.

TRH-1 signaling promotes growth independently of DBL-1 signaling. (A) Body volume of 1-day-old adults fed E. coli OP5O. (B) The growth-stimulatory effects of TRH-1 neuropeptides depend on the bacterial diet. The body volume of trh-1(lst1118) mutants is similar to that of wild-type worms when they are fed a high-quality food source, E. coli HB101. Data are shown relative to the body volume of wild-type worms (100%). Statistical significance (compared with wild-type worms unless indicated otherwise) was determined using one-way ANOVA and Sidak multiple comparison test (A) or a two-tailed unpaired t test (B). Error bars represent SEM; n is shown in each bar. *P < 0.05; ***P < 0.001; ns, not significant.

C. elegans body size also depends on the type of bacteria and quality of the food (4749). Because growth is regulated by TRH-1/TRHR-1 signaling in the pharyngeal system, we hypothesized that its regulation of body size might be food-dependent. We therefore compared the body volume of wild-type and trh-1–mutant worms grown on the standard laboratory food source E. coli OP50 with those fed E. coli HB101, a high-quality food source which better supports growth (4750). Although trh-1 mutants grown on OP50 have a growth defect, their body volume is similar to that of wild-type worms when they are fed E. coli HB101 bacteria (Fig. 6B). For both bacterial strains, trh-1 mutants showed normal pharyngeal pumping and isthmus peristalsis rates (Fig. 4 C and D and Fig. S5), indicating no obvious defects in food intake.

Fig. S5.

Fig. S5.

(A and B) Isthmus peristalsis rate (n = 22) (A) and pharyngeal pumping rate (B) of wild-type worms (n = 10) and trh-1(lst1118) mutants (n = 11) fed E. coli HB101. The isthmus peristalsis rates of wild-type and trh-1–mutant worms were 44.6 ± 1.7 and 41.6 ± 1.2, respectively. Wild-type worms had a pharyngeal pumping rate of 160 ± 4.2, similar to that of trh-1–mutant worms (155.6 ± 2.6). Data were analyzed by a two-tailed unpaired t test. Error bars represent SD. ns, not significant: P > 0.05.

Discussion

In this study we identified a functional TRH-like neuropeptide system in C. elegans. Our findings expand our understanding of the evolutionary history of the TRH neuropeptide family, for which we identified similar peptides in all major protostomian phyla of the Ecdysozoa (nematodes and arthropods) and Lophotrochozoa (annelids and mollusks).

Phylogenetic analyses of TRHRs show a clear conservation of this receptor family in Protostomia and Deuterostomia (19, 20), including the C. elegans TRHR ortholog NMUR-4, which we named TRHR-1. In silico studies and peptidomics previously identified 31 FLP and 52 NLP precursors in C. elegans (51, 52), but none of the corresponding peptides show sequence similarity to deuterostomian TRHs or were able to activate TRHR-1 in cell-culture cells. Given the presence of orphan protostomian TRHR orthologs (1921), we hypothesized that an as yet unknown family of neuropeptide precursors in these phyla might encode the cognate ligand of TRHR-1, and we performed an in-depth in silico search. Our search identified the trh-1 precursor (C30H10.6) as the most promising candidate, because this precursor shows a phylogenetic distribution similar to protostomian TRHRs and encodes two peptides with TRH-like sequence features in terms of length and biochemical properties. We found that TRH-1 neuropeptides (R)GRELF-NH2 and (R)ANELF-NH2 are cognate ligands of TRHR-1 in vivo and activate C. elegans, Platynereis, and human TRHRs in cellulo, supporting the homology of TRH-1 to deuterostomian TRH precursors.

Based on the lack of evidence for TRHR ligands in protostomes, except in Platynereis (22), it was proposed that TRH neuropeptides have been lost in this lineage, or at least in Ecdysozoa (2123, 53). Our in silico search revealed the presence of TRH-like peptides in nematodes, arthropods, annelids, and mollusks. Various lines of evidence suggest that they belong to the TRH neuropeptide family. (i) The conservation of their precursor proteins across Ecdysozoa and Lophotrochozoa matches the evolutionary conservation of TRHR orthologs in these phyla. (ii) Similar to vertebrate preproTRH, all the identified protostomian precursors contain multiple copies of TRH-like peptides. (iii) The encoded peptides are short amidated sequences (five to eight amino acids), like TRHs, that show the highest degree of similarity for the C-terminal tripeptide motif E-[L/F]-[L/F/V]. (iv) This core signature shares the acidic residue of deuterostomian TRHs (pyroglutamate in all deuterostomes and glutamic acid in all protostomes), whereas the hydrophobic residue at position two is also found in deuterostomian echinoderm TRHs. (v) Neuropeptides encoded by the C. elegans TRH-1 precursor activated the C. elegans, Platynereis, and human TRHRs in our cellular assays. The ELFamide motif of TRH-1 peptides, which resembles the protostomian core signature, is crucial for receptor activation. In Platynereis the EFLGamide peptides were recently shown to activate the TRHR ortholog in this species (22). Our results are in line with this study. We identified the annelid EFLGamides and the related fulicin peptides in mollusks as homologs of the C. elegans TRH-1 peptides. Based on these lines of evidence we suggest that the annelid EFLGamides and molluscan fulicins, together with the related peptides that we identified in nematodes and arthropods, are all part of the TRH neuropeptide family (Fig. 3).

Our search in public databases for TRH-like peptides and receptors indicates that this signaling system is present in major protostomian groups including annelids, mollusks, arthropods, and nematodes. However, we could retrieve only a low number of TRHR sequences in insects that were restricted to the Hemiptera (Nilaparvata, Cimex, and Diaphorina) and Diptera (Rhagoletis) groups. Furthermore, we found a TRH-like precursor in only one insect species, the Firebrat (Thermobia domestica). These findings suggest that the TRH system has been lost in many insect groups. TRHRs share strong sequence similarity with ecdysis-triggering hormone (ETH) receptors, which are well conserved in insects. However, phylogenetic studies indicate that they are not orthologous to TRHRs. ETH receptor orthologs are present in nonarthropod species, including in some deuterostomes, and coexist with TRH-like peptides and TRHRs in some arthropods (e.g., Ixodes and Daphnia) (54). These findings suggest that the TRH and ETH systems were both established in an early bilaterian and potentially evolved from a common ancestral receptor-encoding gene (19, 20). Differential loss of the TRH or ETH system may explain the conservation of only one of the two systems in some arthropods.

The role of TRH-like neuropeptides in protostomes is largely unknown. A function was previously described for fulicin peptides in the African giant snail, Achatina fulica. Fulicin and fulyal, a fulicin gene-related peptide, modulate female and male copulatory behavior (5557). Both peptides, which are TRH-like, show an excitatory effect on contractions of the vagina and the oviduct and potentiate contraction of the penis retractory muscle. TRH-1 peptides also may have a role in regulating hermaphrodite reproduction in C. elegans. We found that trh-1 mutants produce fewer offspring. However, reintroducing wild-type copies of trh-1 cDNA failed to rescue the brood-size defect in the mutant strain, although it rescued other phenotypic defects. A possible explanation might be that the reproductive phenotype is highly sensitive to trh-1 expression levels. Alternatively, brood size may be regulated by trh-1 at the germline, where the expression of transgene arrays with repetitive gene or cDNA copies is silenced (58).

Using CRISPR/Cas9 gene editing and RNAi, we found that TRH-1/TRHR-1 signaling regulates body size in C. elegans. TRH-1 neuropeptides are required for promoting growth and regulating body size through activation of their receptor TRHR-1. The trh-1 mutants are smaller than wild-type worms throughout the larval and adult stages, but they have no delay in reproductive maturation, indicating that TRH-like signaling promotes growth rather than development. The reduced growth rate of trh-1 mutants was most pronounced around the period of larval-to-adult transition, although a reduction is already seen at earlier larval stages. This temporal pattern for growth rate and body size defects resembles that of DBL-1/TGF-β and feeding-defective mutants (46, 59, 60), but we found no indications that trh-1 is involved in feeding or in interacting with DBL-1/TGF-β signals.

We showed that TRH-1 peptides are synthesized and required for growth in pharyngeal motor neurons, including M4 and most likely M5. These motor neurons innervate or are in close apposition to the pharyngeal muscles that express the peptide’s receptor TRHR-1. Expression of trhr-1 localizes to a subset of muscles that constitute the metacorpus (pm4) and isthmus (pm5) and are involved in sequestering and regulating the flow of food in the pharynx (28). Tissue-specific knockdown confirmed that TRHR-1 signaling in pharyngeal muscle cells regulates growth. Although reported previously (61), we did not observe intestinal expression of trhr-1 using a translational reporter transgene. This discrepancy could be explained by the absence of cis-acting regulatory sequences in the transcriptional reporters used previously (61).

How might TRH-like signaling regulate growth in C. elegans? TRHR-1 acts in the pharyngeal muscles, which regulate body size through their function in feeding and development of the pharynx (60, 6264). Knockout of trh-1 caused no obvious defects in pharynx morphology. The frequency of the two main motions that constitute feeding—pharyngeal pumping and isthmus peristalsis—was also unaffected, although we cannot rule out the possibility that TRH signaling might have subtle modulatory effects on food intake. Interestingly, TRH-1 neuropeptides and their receptor are expressed together with signaling components of the DBL-1/TGF-β pathway, which plays a major role in the regulation of body size. Our results indicate that trh-1 regulates body size independently of dbl-1. Because TRH-1 mediates growth by signaling to the pharyngeal muscles, we hypothesized that its regulation of body size might be food-dependent. Worms are usually cultured on the laboratory food source E. coli OP50. HB101 bacteria are considered a high-quality E. coli food source, which better supports growth (4750). Although trh-1 mutants fed OP50 are growth-defective, they have a normal body volume when growing on HB101. E. coli HB101 bacteria are larger and have a different nutrient composition, containing higher levels of monounsaturated fatty acids and carbohydrates than OP50 (47, 50). This finding suggests that the body size defect of trh-1 mutants might result from a reduction in the efficiency with which nutrients in the OP50 strain are absorbed.

Vertebrate TRH is a releasing factor of growth-stimulating hormones, including GH and THs (9). Evidence for the existence of these hormones and their receptors in nematodes is lacking (23). However, THs or TH receptors have been described for some mollusks, flatworms, echinoderms, and nonvertebrate chordates and may be conserved regulators of postembryonic development (5, 65, 66). These findings suggest that the evolutionary origin of the TH system likely dates back to a common ancestor of bilaterians, although its function may have been lost or taken over by other endocrine factors in Ecdysozoa (23, 24, 67, 68). Like many invertebrates, C. elegans has a homolog of vertebrate glycoprotein receptors, which include TSH receptors. The ortholog FSHR-1 is involved in innate immunity, stress responses, and germline fertility (6971). The C. elegans genome also encodes two genes, flr-2 and T23B12.8, for α and β glycoprotein subunits (72, 73). It will be interesting to see whether TRH-like signaling regulates the release of invertebrate glycoproteins, similar to its function in vertebrates, or whether its role in these species points to a different ancestral function.

Taken together, our results lend further support to the ancestral origin of TRH neuropeptides predating the split of protostomian and deuterostomian animals. Our genetic analysis of the C. elegans TRH-like system suggests that this pathway may be a conserved regulator of growth and reproductive behaviors. The protostomian TRH-like peptides that we identified in this study provide a molecular basis for further investigations of whether these functions are shared by TRH in other invertebrates and whether TRH signaling may have ancestrally regulated animal growth and reproduction.

Materials and Methods

In Silico Search for TRH Precursors.

We first performed an in silico search for neuropeptide precursors in C. elegans using a screening strategy described in ref. 20. From this list we extracted potential peptide precursors that had not been associated with a receptor and did not belong to known nematode-specific families of peptide precursors, such as most RFamide precursors. We then used BLAST and degenerate motif search to search the GenBank, Joint Genome Institute (JGI), and nematode databases [www.pristionchus.org (74)] for precursor sequences from protostomian lineages that contained peptides resembling each of the C. elegans candidate peptides. We retained C. elegans candidates with a phylogenetic distribution spanning the arthropod, annelid, and molluscan lineages as expected from phylogenetic TRHR analysis. From that screening strategy the ELFamide precursor, encoded by the C. elegans gene C30F12.6, stood out as the most promising candidate, because it was clearly conserved across all the main protostomian phyla and yielded peptides which had features similar to TRH peptides in terms of length (3 ≤ N ≤ 8) and biochemical characteristics (N-terminal pyroglutamate in deuterostomians and conserved glutamic acid close to the C terminus in protostomians).

Aequorin Bioluminescence Assay.

CHO cells expressing the luminescent calcium indicator aequorin and (unless otherwise stated) the human Gα16 subunit were transfected with pcDNA3.1/receptor plasmid. Two days posttransfection, cells were loaded with coelenterazine H (Invitrogen) for 4 h at room temperature. Luminescence after the addition of peptides dissolved in BSA medium was measured for 30 s at 469 nm with a Mithras LB940 (Berthold Technologies) reader.

C. elegans Strains and Maintenance.

The wild-type (N2) and NU3 dbl-1(nk3) strains were obtained from the Caenorhabditis Genetics Center at the University of Minnesota. The LSC1118 trh-1(lst1118) strain was created by CRISPR/Cas9 and contains an 8-bp indel, causing a frameshift and premature stop codon immediately after the signal peptide sequence (Fig. 1C). Details of mutant and transgenic strains can be found in Table S2. The guide RNA (gRNA) sequences used to target trh-1 and the corresponding 3′ protospacer adjacent motif (PAM) sequences are listed in Table S3. All strains were cultivated at 20 °C on nematode growth medium (NGM) plates seeded with E. coli OP50 bacteria, unless otherwise indicated.

Table S2.

Strains and corresponding figures

Strain Genotype Figures
N2 Wild-type Bristol strain Figs. 3 C and D, 5 AH, and 6 A and B and Figs. S3 AD, S4 AD, and S5 A and B
NU3 dbl-1(nk3) Fig. 6A
LSC892 lstEx573 [pEVS04 (Ptrh-1::trh-1::SL2::gfp), 20 ng/µL + pCIM01 (Pelt-2::mCherry), 50 ng/µL] Fig. 3B
LSC893 lstEx574 [pEVS03 (Ptrh-1::trh-1::SL2::gfp), 20 ng/µL + pCIM01 (Pelt-2::mCherry), 50 ng/µL] Fig. S2C
LSC944 lstEx575 [pEVS01 (Ptrhr-1::trhr-1::SL2::gfp), 50 ng/µL + pCIM01 (Pelt-2::mCherry), 50 ng/µL] Fig. S2B
LSC945 lstEx576 [pEVS01 (Ptrhr-1::trhr-1::SL2::gfp), 50 ng/µL + pCIM01 (Pelt-2::mCherry), 50 ng/µL]
LSC946 lstEx577 [pEVS01 (Ptrhr-1::trhr-1::SL2::gfp), 50 ng/µL + pCIM01 (Pelt-2::mCherry), 50 ng/µL]
LSC1015 lstEx580 [trhr-1FOSMID::gfp, 50 ng/µL + pCIM01 (Pelt-2::mCherry), 50 ng/µL] Fig. S2A
LSC1016 lstEx581 [pEVS02 (Ptrhr-1::trhr-1::SL2::gfp), 5 ng/µL + pCIM01 (Pelt-2::mCherry), 50 ng/µL] Fig. 3A
LSC1023 lstEx585 [trhr-1FOSMID::gfp, 20 ng/µL + pCIM01 (Pelt-2::mCherry), 50 ng/µL]
LSC1118 trh-1(lst1118) Figs. 3 C and D, 5 AH, and 6 A and B and Figs. S3 AD, S4 AD, and S5 A and B
LSC1279 trh-1(lst1118); lstEx670 [pEVS04 (Ptrh-1::trh-1::SL2::gfp), 30 ng/µL + pCIM02 (Punc-122::dsRED), 50 ng/µlL Fig. 5D and Fig. S3D
LSC1324 lstEx734 [pEVS04 (Ptrh-1::trh-1::SL2::gfp), 20 ng/µL + pCIM02 (Punc-122::dsRED), 50 ng/µL] Fig. 5E
LSC1325 lstEx735 [pEVS04 (Ptrh-1::trh-1::SL2::gfp), 20 ng/µL + pCIM02 (Punc-122::dsRED), 50 ng/µL] Fig. 5D
LSC1339 lstEx742 [Ptrhr-1::trhr-1 (sas), 20 ng/µL + pCIM01 (Pelt-2::gfp), 50 ng/µL] Fig. 5 D and E
LSC1340 lstEx743 [Ptrhr-1::trhr-1 (sas), 20 ng/µL + pCIM01 (Pelt-2:: gfp), 50 ng/µL] Fig. 5D
LSC1341 lstEx744 [Ptrhr-1::trhr-1 (sas), 20 ng/µL + pCIM01 (Pelt-2:: gfp), 50 ng/µlL Fig. 5D
LSC1385 dbl-1(nk3) trh-1(lst1118) Fig. 6A
LSC1389 lstEx734 [pEVS04 (Ptrh-1::trh-1::SL2::gfp), 20 ng/µL + pCIM02 (Punc-122::dsRED), 50 ng/µL];lstEx742 [Ptrhr-1::trhr-1 (sas), 20 ng/µL + pCIM01 (Pelt-2::mCherry), 50 ng/µL] Fig. 5E
LSC1422 trh-1(lst1118); lstEx742 [Ptrhr-1::trhr-1 (sas), 20 ng/µL + pCIM01 (Pelt-2::gfp), 50 ng/µL] Fig. 5E
LSC1424 lstEx772 [Pmyo-2::trhr-1 (sas), 20 ng/µL + pCIM01 (Pelt-2::gfp), 50 ng/µL Fig. 5H
LSC1428 trh-1(lst1118); lstEx776 [Pglr-8::trh-1::SL2::gfp, 50 ng/µL + pCIM02 (Punc-122::dsRED), 50 ng/µL] Fig. 5G
LSC1452 trh-1(lst1118); lstEx777 [pEVS05 (Pceh-28::trh-1::SL2::gfp), 50 ng/µL + pCIM02 (Punc-122::dsRED), 50 ng/µL] Fig. 5F

—, no figure.

Table S3.

gRNA sequences used to target trh-1 and the corresponding 3′ PAM sequences

Gene Targeting RNA sequence PAM
trh-1 GCTCCTCTTCGTCGAACCACAT GGG
trh-1 GTCGAACCACATGGGTGAGG CGG
trh-1 GCTCCTCTTCGTCGAACCACA TGG

Body Size Quantification.

Worm volumes were measured in two different ways. (i) For growth curves, images of synchronized worms fixed in 4% (wt/vol) formaldehyde were captured. For every sample, the average length and width of at least 1,500 particles were calculated by a RapidVUE Particle Shape and Size Analyzer (Beckman Coulter) (75). Two independent experiments were performed, and each sample was run three or four times (technical replicates). (ii) For rescue, overexpression, and RNAi experiments, worm length and width (just behind the pharynx) were measured from images of anesthetized day 1 adult worms with ImageJ on at least two independent days. In both methods, worm volume was approximated using the cylinder formula V = πL(D/2)2, where L is the length of the worm, and D represents its diameter (width). Worm growth rates were modeled by regressing the length and width data obtained by the RapidVUE Particle Shape and Size Analyzer using a sigmoid (logistic) function. The regression was further used to compute the increase in length and width over time.

Detailed descriptions of all methods and reagents and extended experimental procedures are provided in SI Materials and Methods.

SI Materials and Methods

Phylogenetic Analysis of TRHRs.

The collection of known bilaterian sequences orthologous to TRHRs (19, 20) was expanded by BLASTing C. elegans TRHR-1 (C30F12.6) against all arthropod, annelid, and mollusk cDNA sequences contained in the National Center for Biotechnology Information (NCBI) repository (both nr/nt and est databases). A new phylogenetic tree was built from these sequences using SATE, which simultaneously infers an alignment and a phylogenetic tree from a set of sequences (76, 77). It makes use of a suite of alignment and tree reconstruction tools, including MAFFT 6.717 (78) to align sequences, MUSCLE 3.7 (79) for merging alignments, and FastTree 2.1.4 (80) for maximum likelihood-based tree reconstruction. Default parameters were used for all programs. For the substitution model a General Time Reversible Model with a Gamma distribution approximated by 20 rate-across-sites categories (GTR+20 model) was used.

Molecular Biology.

Plasmids for receptor expression in mammalian cells were constructed as described (81). The cDNA sequence of the trhr-1 (nmur-4) gene was amplified by PCR using cDNA from mixed-stage wild-type C. elegans as template and the following gene-specific primers: forward, 5′-CACCAGATGACGTCAGCCTC-3′ and reverse, 5′-ATGTATCACGGAGTTCCAGC-3′. The PCR product was directionally cloned in the eukaryotic expression vector pcDNA3.1/V5-His-TOPO TA (Invitrogen). The pcDNA3.1 plasmid for the human TRHR was obtained from the Missouri University of Science and Technology cDNA Resource Center. The pcDNA3.1 plasmid of the Platynereis EFLGa receptor was kindly provided by G. Jékely of the Max Planck Institute for Developmental Biology, Tuebingen, Germany.

GFP reporter and rescue constructs were generated in a modified pSM vector carrying a GFP reporter sequence preceded by an SL2 transsplicing site (kindly provided by C. Bargmann, Rockefeller University, New York). Reporter constructs for trhr-1 were made by cloning the trhr-1 promoter and gene locus (pEVS01) or cDNA (pEVS02) between the MscI and KpnI restriction sites. For pEVS02, the trhr-1 promoter (3.5 kb) was inserted between NotI and XmaI restriction sites. For trh-1 reporter and rescue constructs, the genomic trh-1 fragment (pEVS03) or its cDNA (pEVS04) were first cloned at the NheI/KpnI sites. The trh-1 promoter (1.8 kb) then was cloned between NotI and KpnI sites. A translational fosmid-based GFP reporter construct for trhr-1 was obtained from the C. elegans TransgeneOme project (82) and confirmed the expression pattern obtained with the pSM-derived reporter constructs.

Cell-specific trh-1 rescue strains were generated using Gateway constructs or linear PCR fragments. The glr-8 promoter [2.9 kb (42)] was fused by overlap extension PCR to the trh-1 cDNA::SL2::gfp::unc-54 3′ UTR sequence amplified from pEVS04. A Pceh-28::trh-1::SL2::gfp::let-858 3′UTR rescue construct (pEVS05) was made using the MultiSite Gateway Three-Fragment Vector Construction Kit (Invitrogen). This construct was generated using the ceh-28 promoter [3.7 kb (41)] and trh-1 cDNA amplified from pEVS04. Table S1 summarizes the promoter sequences used and their expression patterns.

Short guide RNA (sgRNA) constructs for CRISPR/Cas9 genome editing were constructed as described (83). Briefly, the targeting oligonucleotides (Table S3) were inserted into the EcoRI site between the rpr-1 promoter and the gRNA scaffold (Addgene plasmid no. 48961) by Gibson assembly. C. elegans codon-optimized Streptococcus pyogenes Cas9 nuclease with a nuclear localization sequence (NLS) and 3×FLAG tag (Addgene plasmid no. 48960) was used as the Cas9 expression plasmid.

The sas transgenes for trhr-1 knockdown were constructed as described (40). The trhr-1 promoter (3.5 kb) and myo-2 promoter [1 kb (43)] were fused to a trhr-1 genomic fragment spanning exons 4–8 (1.5 kb) in sense and antisense orientation.

Peptides.

A library of more than 250 synthetic C. elegans peptides was compiled from in silico predictions and peptidomics data (84) and was custom-synthesized by Thermo Scientific and GL Biochem Ltd. C. elegans TRH-1 peptides, alanine-substituted and scrambled TRH-1 peptides, and nonnematode TRHs were synthesized by GL Biochem Ltd. and were HPLC purified.

Aequorin Bioluminescence Assay.

CHO K1 cells stably overexpressing the mitochondrially targeted apo-aequorin and human Gα16 subunit were transiently transfected with trhr-1/pcDNA3.1, human TRHR/pcDNA3.1, Platynereis EFLGa receptor/pcDNA3.1, or empty pcDNA3.1 (control) plasmid using Lipofectamine LTX and Plus reagent (Invitrogen) at 60–80% confluency. After transfection, cells were grown overnight at 37 °C and then were transferred to 28 °C and incubated for another 24 h. CHO cells were detached and loaded with coelenterazine H (Invitrogen) for 4 h at room temperature, allowing the formation of the calcium-sensitive photoprotein aequorin. The incubated cells were added to synthetic peptides in DMEM/BSA, and luminescence was measured for 30 s at 469 nm using a Mithras LB940 reader (Berthold Technologies). Then Triton X-100 (0.1%) was added for 8 s to measure the total calcium response. To determine the mode of downstream signaling, CHO-K1 cells lacking Gα16 expression were used. Concentration–response measurements were performed in triplicate on at least two different days. Sigmoidal concentration–response curves were created and EC50 values were calculated with GraphPad Prism software.

Generation of Transgenic Worms and Expression Pattern Analysis.

GFP reporter constructs for expression analysis were injected into the syncytial gonad of young adult wild-type worms at concentrations ranging from 5 to 50 ng/µL (Table S2) with 50 ng/µL of the coinjection marker Pelt-2::mCherry (pCIM01) or Punc-122::dsRED (pCIM02) and 17 ng/µL of a 1-kb DNA ladder (Thermo Scientific) as carrier DNA.

Expression patterns were confirmed in at least two independent transgenic strains. Strains for which data are shown in figures are indicated in Table S2. Hermaphrodites were mounted on 2% agarose pads with 25 mM sodium azide in S-basal solution. Expression patterns were visualized using an Olympus FluoView FV1000 (IX81) confocal microscope. Confocal Z-stack projections were analyzed with Imaris 7.2 (Olympus) software.

CRISPR/Cas9-Mediated Knockout of trh-1.

To target trh-1, we searched for potential gRNA sequences of the form G(N)19–21NGG with the help of the online CRISPR design tool (crispr.mit.edu). From the generated list of possible guides, we selected three gRNAs complementary to the coding sequence of trh-1 because of their faithfulness of on-target activity (Table S3). DNA mixes containing a gRNA construct (30 ng/µL), Cas9-expressing vector [30 ng/µL (83)], Punc-122::mCherry coinjection marker (50 ng/µL), and a 1-kb DNA ladder (17 ng/µL), were injected into C. elegans hermaphrodites. After injection, F1 transgenic worms were transferred to individual NGM plates and allowed to produce F2 progeny. F1 worms then were lysed with a proteinase K treatment and screened by PCR for the presence of mutations near the gRNA-targeted region. DNA fragments (∼100 bp) surrounding the targeted PAM site were amplified and subsequently analyzed on a 15% Tris/borate/EDTA polyacrylamide gel (Bio-Rad) by electrophoresis. Sanger sequencing was used to confirm the presence of indel mutations.

Quantification of Isthmus Peristalsis Rate.

To quantify the isthmus peristalsis rate on OP50 bacteria, worms were grown and observed on NGM culture plates supplemented with 1 mM isopropyl β-d-1-thiogalactopyranoside (IPTG) and 50 µg/mL ampicillin and seeded with dsRED-expressing OP50 bacteria (32). To quantify the isthmus peristalsis rate on HB101 bacteria, worms were first cultured on NGM plates seeded with OP50 and on the day of the measurement were transferred individually to a new NGM plate seeded with mCherry-expressing HB101 bacteria (33); worms were allowed to recover for 20 min after transfer. Isthmus peristalsis was observed by looking under a stereomicroscope with a rhodamine fluorescence filter for red signal passing through the posterior isthmus of synchronized, well-fed day 1 adults. The worms were recorded using a digital microscope camera (AmScope MU035) and ToupView (ToupTek) software with focus on the pharynx. The number of isthmus peristalsis movements was counted for 30 s on two independent days.

Quantification of Pharyngeal Pumping.

The pharyngeal pumping rate of worms fed E. coli HB101 or OP50 was determined by transferring synchronized, well-fed day 1 adults from their culture plate to individual new plates seeded with HB101 or OP50. After transfer, worms were allowed to recover for 5 min. The worms then were recorded using a GigEPRO camera (NET GmbH) and StreamPix software (Norpix) for 2 min with focus on the pharynx. Pharyngeal pumping was counted for 30 s; for every worm the average of four counts was plotted.

Locomotion Assays.

For on-food locomotion assays, well-fed day 1 adults were transferred from their culture plate to a freshly seeded NGM plate and allowed to recover for 5 min. The worms then were recorded for 1 min using a digital microscope camera (AmScope MU035) and ToupView (ToupTek) software. For off-food tracking, synchronized, well-fed day 1 adults were first transferred from their culture plate to an unseeded NGM plate for 5 min to remove residual bacteria. Worms then were placed at the center of a second unseeded NGM plate and were allowed to acclimate for another 5 min. As in the on-food locomotion assays, the worms were recorded for 1 min on two different days. The video data were analyzed using automated tracking software (OptoTracker; Gotschalk laboratory, www.biochem.uni-frankfurt.de/index.php?id=236), and speed was computed by the WormAnalyzer package. All assays were performed in a temperature-controlled room at 20 °C.

Egg-Laying Assays.

Egg-laying behavior was quantified as described (85) unless stated otherwise. Egg-laying was assayed in synchronized worms placed on individual NGM plates seeded with OP50 bacteria 48 h after L1 arrest. Worms were transferred to freshly seeded NGM plates three times each day, once after a 12-h period and twice after a 6-h period, until day 5 of adulthood. Viable offspring was counted when in the L4/adult stage. Incomplete offspring data resulting from the escape or death of parental worms were omitted from the analyses. The data shown for wild-type and trh-1 mutants are combined from two independent experiments.

Acknowledgments

We thank the Caenorhabditis Genetics Center, funded by NIH Office of Research Infrastructure Programs Grant P40 OD010440, for providing the wild-type and dbl-1(nk3) C. elegans strains; the TransGeneOme project for the trhr-1 fosmid-based reporter construct; W. De Haes for advice on statistics; F. J. Naranjo-Galindo and E. Vandeweyer for technical assistance; B. Braeckman for advice and use of equipment; and C. Bargmann, G. Jékely, and J. Møller-Jensen for reagents. E.V.S., K.P., J.W., and I.B. are fellows of the Research Foundation - Flanders (FWO). This research was supported by European Research Council Grant 340318 and FWO Grant G069713N.

Footnotes

The authors declare no conflict of interest.

This article is a PNAS Direct Submission.

This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.1073/pnas.1617392114/-/DCSupplemental.

References

  • 1.Harris GW. The hypothalamus and endocrine glands. Br Med Bull. 1950;6:345–350. doi: 10.1093/oxfordjournals.bmb.a073628. [DOI] [PubMed] [Google Scholar]
  • 2.Bøler J, Enzmann F, Folkers K, Bowers CY, Schally AV. The identity of chemical and hormonal properties of the thyrotropin releasing hormone and pyroglutamyl-histidyl-proline amide. Biochem Biophys Res Commun. 1969;37:705–710. doi: 10.1016/0006-291x(69)90868-7. [DOI] [PubMed] [Google Scholar]
  • 3.Burgus R, Dunn TF, Desiderio D, Guillemin R. [Molecular structure of the hypothalamic hypophysiotropic TRF factor of ovine origin: Mass spectrometry demonstration of the PCA-His-Pro-NH2 sequence] C R Acad Sci Hebd Seances Acad Sci D. 1969;269:1870–1873. [PubMed] [Google Scholar]
  • 4.Vaudry H, et al. The pituitary-skin connection in amphibians. Reciprocal regulation of melanotrope cells and dermal melanocytes. Ann N Y Acad Sci. 1999;885:41–56. doi: 10.1111/j.1749-6632.1999.tb08664.x. [DOI] [PubMed] [Google Scholar]
  • 5.Paris M, Brunet F, Markov GV, Schubert M, Laudet V. The amphioxus genome enlightens the evolution of the thyroid hormone signaling pathway. Dev Genes Evol. 2008;218:667–680. doi: 10.1007/s00427-008-0255-7. [DOI] [PubMed] [Google Scholar]
  • 6.Rowe ML, Elphick MR. The neuropeptide transcriptome of a model echinoderm, the sea urchin Strongylocentrotus purpuratus. Gen Comp Endocrinol. 2012;179:331–344. doi: 10.1016/j.ygcen.2012.09.009. [DOI] [PubMed] [Google Scholar]
  • 7.Rowe ML, Achhala S, Elphick MR. Neuropeptides and polypeptide hormones in echinoderms: New insights from analysis of the transcriptome of the sea cucumber Apostichopus japonicus. Gen Comp Endocrinol. 2014;197:43–55. doi: 10.1016/j.ygcen.2013.12.002. [DOI] [PubMed] [Google Scholar]
  • 8.Semmens DC, et al. Transcriptomic identification of starfish neuropeptide precursors yields new insights into neuropeptide evolution. Open Biol. 2016;6:150224. doi: 10.1098/rsob.150224. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Galas L, et al. TRH acts as a multifunctional hypophysiotropic factor in vertebrates. Gen Comp Endocrinol. 2009;164:40–50. doi: 10.1016/j.ygcen.2009.05.003. [DOI] [PubMed] [Google Scholar]
  • 10.Mullur R, Liu Y-Y, Brent GA. Thyroid hormone regulation of metabolism. Physiol Rev. 2014;94:355–382. doi: 10.1152/physrev.00030.2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Lechan RM, Fekete C. The TRH neuron: A hypothalamic integrator of energy metabolism. Prog Brain Res. 2006;153:209–235. doi: 10.1016/S0079-6123(06)53012-2. [DOI] [PubMed] [Google Scholar]
  • 12.Danforth E, Jr, Burger A. The role of thyroid hormones in the control of energy expenditure. Clin Endocrinol Metab. 1984;13:581–595. doi: 10.1016/s0300-595x(84)80039-0. [DOI] [PubMed] [Google Scholar]
  • 13.Patricolo E, Cammarata M, D’Agati P. Presence of thyroid hormones in ascidian larvae and their involvement in metamorphosis. J Exp Zool. 2001;290:426–430. doi: 10.1002/jez.1084. [DOI] [PubMed] [Google Scholar]
  • 14.Hodin J. Expanding networks: Signaling components in and a hypothesis for the evolution of metamorphosis. Integr Comp Biol. 2006;46:719–742. doi: 10.1093/icb/icl038. [DOI] [PubMed] [Google Scholar]
  • 15.Paris M, Laudet V. The history of a developmental stage: Metamorphosis in chordates. Genesis. 2008;46:657–672. doi: 10.1002/dvg.20443. [DOI] [PubMed] [Google Scholar]
  • 16.De Groef B, Van der Geyten S, Darras VM, Kühn ER. Role of corticotropin-releasing hormone as a thyrotropin-releasing factor in non-mammalian vertebrates. Gen Comp Endocrinol. 2006;146:62–68. doi: 10.1016/j.ygcen.2005.10.014. [DOI] [PubMed] [Google Scholar]
  • 17.Shibusawa N, Hashimoto K, Yamada M. Thyrotropin-releasing hormone (TRH) in the cerebellum. Cerebellum. 2008;7:84–95. doi: 10.1007/s12311-008-0033-0. [DOI] [PubMed] [Google Scholar]
  • 18.Hollenberg AN. The role of the thyrotropin-releasing hormone (TRH) neuron as a metabolic sensor. Thyroid. 2008;18:131–139. doi: 10.1089/thy.2007.0251. [DOI] [PubMed] [Google Scholar]
  • 19.Jékely G. Global view of the evolution and diversity of metazoan neuropeptide signaling. Proc Natl Acad Sci USA. 2013;110:8702–8707. doi: 10.1073/pnas.1221833110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Mirabeau O, Joly J-S. Molecular evolution of peptidergic signaling systems in bilaterians. Proc Natl Acad Sci USA. 2013;110:E2028–E2037. doi: 10.1073/pnas.1219956110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Tanaka Y, Suetsugu Y, Yamamoto K, Noda H, Shinoda T. Transcriptome analysis of neuropeptides and G-protein coupled receptors (GPCRs) for neuropeptides in the brown planthopper Nilaparvata lugens. Peptides. 2014;53:125–133. doi: 10.1016/j.peptides.2013.07.027. [DOI] [PubMed] [Google Scholar]
  • 22.Bauknecht P, Jékely G. Large-scale combinatorial deorphanization of Platynereis neuropeptide GPCRs. Cell Reports. 2015;12:684–693. doi: 10.1016/j.celrep.2015.06.052. [DOI] [PubMed] [Google Scholar]
  • 23.De Loof A, Lindemans M, Liu F, De Groef B, Schoofs L. Endocrine archeology: Do insects retain ancestrally inherited counterparts of the vertebrate releasing hormones GnRH, GHRH, TRH, and CRF? Gen Comp Endocrinol. 2012;177:18–27. doi: 10.1016/j.ygcen.2012.02.002. [DOI] [PubMed] [Google Scholar]
  • 24.Laudet V. The origins and evolution of vertebrate metamorphosis. Curr Biol. 2011;21:R726–R737. doi: 10.1016/j.cub.2011.07.030. [DOI] [PubMed] [Google Scholar]
  • 25.Eipper BA, Stoffers DA, Mains RE. The biosynthesis of neuropeptides: Peptide α-amidation. Annu Rev Neurosci. 1992;15:57–85. doi: 10.1146/annurev.ne.15.030192.000421. [DOI] [PubMed] [Google Scholar]
  • 26.Duthie SM, Taylor PL, Anderson L, Cook J, Eidne KA. Cloning and functional characterisation of the human TRH receptor. Mol Cell Endocrinol. 1993;95:R11–R15. doi: 10.1016/0303-7207(93)90043-j. [DOI] [PubMed] [Google Scholar]
  • 27.Albertson DG, Thomson JN. The pharynx of Caenorhabditis elegans. Philos Trans R Soc Lond B Biol Sci. 1976;275:299–325. doi: 10.1098/rstb.1976.0085. [DOI] [PubMed] [Google Scholar]
  • 28.Altun ZF, Hall DH. WormAtlas. Cold Spring Harbor; New York: 2009. Alimentary system, pharynx. [DOI] [Google Scholar]
  • 29.Avery L. The genetics of feeding in Caenorhabditis elegans. Genetics. 1993;133:897–917. doi: 10.1093/genetics/133.4.897. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Avery L, Horvitz HR. A cell that dies during wild-type C. elegans development can function as a neuron in a ced-3 mutant. Cell. 1987;51:1071–1078. doi: 10.1016/0092-8674(87)90593-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Avery L, Horvitz HR. Pharyngeal pumping continues after laser killing of the pharyngeal nervous system of C. elegans. Neuron. 1989;3:473–485. doi: 10.1016/0896-6273(89)90206-7. [DOI] [PubMed] [Google Scholar]
  • 32.Simonsen KT, et al. A role for the RNA chaperone Hfq in controlling adherent-invasive Escherichia coli colonization and virulence. PLoS One. 2011;6:e16387. doi: 10.1371/journal.pone.0016387. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Song BM, Avery L. Serotonin activates overall feeding by activating two separate neural pathways in Caenorhabditis elegans. J Neurosci. 2012;32:1920–1931. doi: 10.1523/JNEUROSCI.2064-11.2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Sharp T, Bennett GW, Marsden CA, Tulloch IF. A comparison of the locomotor effects induced by centrally injected TRH and TRH analogues. Regul Pept. 1984;9:305–315. doi: 10.1016/0167-0115(84)90083-1. [DOI] [PubMed] [Google Scholar]
  • 35.Taylor JA, Boyd SK. Thyrotropin-releasing hormone facilitates display of reproductive behavior and locomotor behavior in an amphibian. Horm Behav. 1991;25:128–136. doi: 10.1016/0018-506x(91)90046-k. [DOI] [PubMed] [Google Scholar]
  • 36.Miyamoto M, Nagawa Y. Mesolimbic involvement in the locomotor stimulant action of thyrotropin-releasing hormone (TRH) in rats. Eur J Pharmacol. 1977;44:143–152. doi: 10.1016/0014-2999(77)90100-5. [DOI] [PubMed] [Google Scholar]
  • 37.Kalivas PW, Stanley D, Prange AJJ., Jr Interaction between thyrotropin-releasing hormone and the mesolimbic dopamine system. Neuropharmacology. 1987;26:33–38. doi: 10.1016/0028-3908(87)90041-4. [DOI] [PubMed] [Google Scholar]
  • 38.Hall TR, Harvey S, Scanes CG. Control of growth hormone secretion in the vertebrates: A comparative survey. Comp Biochem Physiol A. 1986;84:231–253. doi: 10.1016/0300-9629(86)90608-0. [DOI] [PubMed] [Google Scholar]
  • 39.Harvey S. Thyrotrophin-releasing hormone: A growth hormone-releasing factor. J Endocrinol. 1990;125:345–358. doi: 10.1677/joe.0.1250345. [DOI] [PubMed] [Google Scholar]
  • 40.Esposito G, Di Schiavi E, Bergamasco C, Bazzicalupo P. Efficient and cell specific knock-down of gene function in targeted C. elegans neurons. Gene. 2007;395:170–176. doi: 10.1016/j.gene.2007.03.002. [DOI] [PubMed] [Google Scholar]
  • 41.Ray P, Schnabel R, Okkema PG. Behavioral and synaptic defects in C. elegans lacking the NK-2 homeobox gene ceh-28. Dev Neurobiol. 2008;68:421–433. doi: 10.1002/dneu.20599. [DOI] [PubMed] [Google Scholar]
  • 42.Brockie PJ, Madsen DM, Zheng Y, Mellem J, Maricq AV. Differential expression of glutamate receptor subunits in the nervous system of Caenorhabditis elegans and their regulation by the homeodomain protein UNC-42. J Neurosci. 2001;21:1510–1522. doi: 10.1523/JNEUROSCI.21-05-01510.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Ardizzi JP, Epstein HF. Immunochemical localization of myosin heavy chain isoforms and paramyosin in developmentally and structurally diverse muscle cell types of the nematode Caenorhabditis elegans. J Cell Biol. 1987;105:2763–2770. doi: 10.1083/jcb.105.6.2763. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Morita K, Chow KL, Ueno N. Regulation of body length and male tail ray pattern formation of Caenorhabditis elegans by a member of TGF-beta family. Development. 1999;126:1337–1347. doi: 10.1242/dev.126.6.1337. [DOI] [PubMed] [Google Scholar]
  • 45.Suzuki Y, et al. A BMP homolog acts as a dose-dependent regulator of body size and male tail patterning in Caenorhabditis elegans. Development. 1999;126:241–250. doi: 10.1242/dev.126.2.241. [DOI] [PubMed] [Google Scholar]
  • 46.Savage-Dunn C, et al. SMA-3 smad has specific and critical functions in DBL-1/SMA-6 TGFbeta-related signaling. Dev Biol. 2000;223:70–76. doi: 10.1006/dbio.2000.9713. [DOI] [PubMed] [Google Scholar]
  • 47.So S, Miyahara K, Ohshima Y. Control of body size in C. elegans dependent on food and insulin/IGF-1 signal. Genes Cells. 2011;16:639–651. doi: 10.1111/j.1365-2443.2011.01514.x. [DOI] [PubMed] [Google Scholar]
  • 48.Avery L, Shtonda BB. Food transport in the C. elegans pharynx. J Exp Biol. 2003;206:2441–2457. doi: 10.1242/jeb.00433. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Shtonda BB, Avery L. Dietary choice behavior in Caenorhabditis elegans. J Exp Biol. 2006;209:89–102. doi: 10.1242/jeb.01955. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Brooks KK, Liang B, Watts JL. The influence of bacterial diet on fat storage in C. elegans. PLoS One. 2009;4:e7545. doi: 10.1371/journal.pone.0007545. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Frooninckx L, et al. Neuropeptide GPCRs in C. elegans. Front Endocrinol (Lausanne) 2012;3:167. doi: 10.3389/fendo.2012.00167. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Husson SJ, et al. Worm peptidomics. EuPA Open Proteom. 2014;3:280–290. [Google Scholar]
  • 53.Badisco L, et al. Transcriptome analysis of the desert locust central nervous system: Production and annotation of a Schistocerca gregaria EST database. PLoS One. 2011;6:e17274. doi: 10.1371/journal.pone.0017274. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Roller L, et al. Ecdysis triggering hormone signaling in arthropods. Peptides. 2010;31:429–441. doi: 10.1016/j.peptides.2009.11.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55.Ohta N, et al. Fulicin, a novel neuropeptide containing a D-amino acid residue isolated from the ganglia of Achatina fulica. Biochem Biophys Res Commun. 1991;178:486–493. doi: 10.1016/0006-291x(91)90133-r. [DOI] [PubMed] [Google Scholar]
  • 56.Yasuda-Kamatani Y, et al. A novel D-amino acid-containing peptide, fulyal, coexists with fulicin gene-related peptides in Achatina atria. Peptides. 1997;18:347–354. doi: 10.1016/s0196-9781(96)00343-9. [DOI] [PubMed] [Google Scholar]
  • 57.Fujisawa Y, Masuda K, Minakata H. Fulicin regulates the female reproductive organs of the snail, Achatina fulica. Peptides. 2000;21:1203–1208. doi: 10.1016/s0196-9781(00)00260-6. [DOI] [PubMed] [Google Scholar]
  • 58.Kelly WG, Xu S, Montgomery MK, Fire A. Distinct requirements for somatic and germline expression of a generally expressed Caernorhabditis elegans gene. Genetics. 1997;146:227–238. doi: 10.1093/genetics/146.1.227. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Nyström J, et al. Increased or decreased levels of Caenorhabditis elegans lon-3, a gene encoding a collagen, cause reciprocal changes in body length. Genetics. 2002;161:83–97. doi: 10.1093/genetics/161.1.83. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Mörck C, Pilon M. C. elegans feeding defective mutants have shorter body lengths and increased autophagy. BMC Dev Biol. 2006;6:39. doi: 10.1186/1471-213X-6-39. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61.McKay SJ, et al. Gene expression profiling of cells, tissues, and developmental stages of the nematode C. elegans. Cold Spring Harb Symp Quant Biol. 2003;68:159–169. doi: 10.1101/sqb.2003.68.159. [DOI] [PubMed] [Google Scholar]
  • 62.Avery L, You Y-J. C. elegans feeding. WormBook. 2012 doi: 10.1895/wormbook.1.150.1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Raharjo WH, Ghai V, Dineen A, Bastiani M, Gaudet J. Cell architecture: Surrounding muscle cells shape gland cell morphology in the Caenorhabditis elegans pharynx. Genetics. 2011;189:885–897. doi: 10.1534/genetics.111.132449. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64.George-Raizen JB, Shockley KR, Trojanowski NF, Lamb AL, Raizen DM. Dynamically-expressed prion-like proteins form a cuticle in the pharynx of Caenorhabditis elegans. Biol Open. 2014;3:1139–1149. doi: 10.1242/bio.20147500. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Wu W, Niles EG, LoVerde PT. Thyroid hormone receptor orthologues from invertebrate species with emphasis on Schistosoma mansoni. BMC Evol Biol. 2007;7:150. doi: 10.1186/1471-2148-7-150. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 66.Huang W, et al. Identification of thyroid hormones and functional characterization of thyroid hormone receptor in the pacific oyster Crassostrea gigas provide insight into evolution of the thyroid hormone system. PLoS One. 2015;10:e0144991. doi: 10.1371/journal.pone.0144991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Laron Z. The somatostatin-GHRH-GH-IGF-I axis. In: Merimee TJ, Laron Z, editors. Growth Hormone, IGF-I and Growth: New Views of Old Concepts. Modern Endocrinology and Diabetes. Freund Publishing House Ltd; Tel Aviv: 1996. [Google Scholar]
  • 68.Géminard C, et al. Control of metabolism and growth through insulin-like peptides in Drosophila. Diabetes. 2006;55:5–8. [Google Scholar]
  • 69.Powell JR, Kim DH, Ausubel FM. The G protein-coupled receptor FSHR-1 is required for the Caenorhabditis elegans innate immune response. Proc Natl Acad Sci USA. 2009;106:2782–2787. doi: 10.1073/pnas.0813048106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Cho S, Rogers KW, Fay DS. The C. elegans glycopeptide hormone receptor ortholog, FSHR-1, regulates germline differentiation and survival. Curr Biol. 2007;17:203–212. doi: 10.1016/j.cub.2006.12.027. [DOI] [PubMed] [Google Scholar]
  • 71.Miller EV, Grandi LN, Giannini JA, Robinson JD, Powell JR. The conserved G-protein coupled receptor FSHR-1 regulates protective host responses to infection and oxidative stress. PLoS One. 2015;10:e0137403. doi: 10.1371/journal.pone.0137403. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 72.Oishi A, et al. FLR-2, the glycoprotein hormone alpha subunit, is involved in the neural control of intestinal functions in Caenorhabditis elegans. Genes Cells. 2009;14:1141–1154. doi: 10.1111/j.1365-2443.2009.01341.x. [DOI] [PubMed] [Google Scholar]
  • 73.Hsu SY, Nakabayashi K, Bhalla A. Evolution of glycoprotein hormone subunit genes in bilateral metazoa: Identification of two novel human glycoprotein hormone subunit family genes, GPA2 and GPB5. Mol Endocrinol. 2002;16:1538–1551. doi: 10.1210/mend.16.7.0871. [DOI] [PubMed] [Google Scholar]
  • 74.Dieterich C, Roeseler W, Sobetzko P, Sommer RJ. Pristionchus.org: A genome-centric database of the nematode satellite species Pristionchus pacificus. Nucleic Acids Res. 2007;35:D498–D502. doi: 10.1093/nar/gkl804. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 75.De Haes W, et al. Metformin promotes lifespan through mitohormesis via the peroxiredoxin PRDX-2. Proc Natl Acad Sci USA. 2014;111:E2501–E2509. doi: 10.1073/pnas.1321776111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 76.Liu K, Raghavan S, Nelesen S, Linder CR, Warnow T. Rapid and accurate large-scale coestimation of sequence alignments and phylogenetic trees. Science. 2009;324:1561–1564. doi: 10.1126/science.1171243. [DOI] [PubMed] [Google Scholar]
  • 77.Liu K, et al. SATe-II: Very fast and accurate simultaneous estimation of multiple sequence alignments and phylogenetic trees. Syst Biol. 2012;61:90–106. doi: 10.1093/sysbio/syr095. [DOI] [PubMed] [Google Scholar]
  • 78.Katoh K, Misawa K, Kuma K, Miyata T. MAFFT: A novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Res. 2002;30:3059–3066. doi: 10.1093/nar/gkf436. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79.Edgar RC. MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004;32:1792–1797. doi: 10.1093/nar/gkh340. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80.Price MN, Dehal PS, Arkin AP. FastTree 2–approximately maximum-likelihood trees for large alignments. PLoS One. 2010;5:e9490. doi: 10.1371/journal.pone.0009490. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 81.Beets I, et al. Vasopressin/oxytocin-related signaling regulates gustatory associative learning in C. elegans. Science. 2012;338:543–545. doi: 10.1126/science.1226860. [DOI] [PubMed] [Google Scholar]
  • 82.Sarov M, et al. A recombineering pipeline for functional genomics applied to Caenorhabditis elegans. Nat Methods. 2006;3:839–844. doi: 10.1038/nmeth933. [DOI] [PubMed] [Google Scholar]
  • 83.Chen C, Fenk LA, de Bono M. Efficient genome editing in Caenorhabditis elegans by CRISPR-targeted homologous recombination. Nucleic Acids Res. 2013;41:e193. doi: 10.1093/nar/gkt805. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 84.Husson SJ, Clynen E, Baggerman G, De Loof A, Schoofs L. Discovering neuropeptides in Caenorhabditis elegans by two dimensional liquid chromatography and mass spectrometry. Biochem Biophys Res Commun. 2005;335:76–86. doi: 10.1016/j.bbrc.2005.07.044. [DOI] [PubMed] [Google Scholar]
  • 85.Van Rompay L, Borghgraef C, Beets I, Caers J, Temmerman L. New genetic regulators question relevance of abundant yolk protein production in C. elegans. Sci Rep. 2015;5:16381. doi: 10.1038/srep16381. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Proceedings of the National Academy of Sciences of the United States of America are provided here courtesy of National Academy of Sciences

RESOURCES