ABSTRACT
This study further evaluated the in vitro and in vivo anti-Helicobacter pylori activities and potential underlying mechanism of patchouli alcohol (PA), a tricyclic sesquiterpene. In the in vitro assay, the capacities of PA to inhibit and kill H. pylori were tested on three standard strains at different pH values and on 12 clinical isolates. The effects of PA on H. pylori adhesion (and its alpA, alpB, and babA genes), motility (and its flaA and flaB genes), ultrastructure, and flagellation were investigated. Moreover, the H. pylori resistance to and postantibiotic effect (PAE) of PA were determined. Furthermore, the in vivo effects of PA on H. pylori eradication and gastritis were examined. Results showed that MICs of PA against three standard strains (pH 5.3 to 9) and 12 clinical isolates were 25 to 75 and 12.5 to 50 μg/ml, respectively. The killing kinetics of PA were time and concentration dependent, and its minimal bactericidal concentrations (MBCs) were 25 to 75 μg/ml. In addition, H. pylori adhesion, motility, ultrastructure, and flagellation were significantly suppressed. PA also remarkably inhibited the expression of adhesion genes (alpA and alpB) and motility genes (flaA and flaB). Furthermore, PA treatment caused a longer PAE and less bacterial resistance than clarithromycin and metronidazole. The in vivo study showed that PA can effectively eradicate H. pylori, inhibit gastritis, and suppress the expression of inflammatory mediators (COX-2, interleukin 1β, tumor necrosis factor alpha, and inducible nitric oxide synthase [iNOS]). In conclusion, PA can efficiently kill H. pylori, interfere with its infection process, and attenuate gastritis with less bacterial resistance, making it a potential candidate for new drug development.
KEYWORDS: patchouli alcohol, Helicobacter pylori, antiadhesion, antimotility, antigastritis
INTRODUCTION
Helicobacter pylori is a Gram-negative and spiral bacterium proved to be a major pathogen causing chronic gastritis, ulcer, and even gastric carcinoma (1, 2). Although triple therapy (combined use of a proton pump inhibitor, clarithromycin [CLR], and metronidazole [MET] or amoxicillin) has shown a reliable therapeutic effect against H. pylori, the prevalence of antibiotic-resistant H. pylori has become a worldwide concern (3). The eradication rate in patients who received triple treatment once has decreased (4). In addition, antibiotics can seriously disturb the microbiome, resulting in other diseases (5). Therefore, alternative therapeutic methods should be explored in clinical treatment.
The motility and adhesion of H. pylori are essential factors influencing its colonization. To avoid gastric acid and search for a suitable proliferation environment, the flagella of H. pylori, consisting of FlaA and FlaB proteins, provide strong motility to penetrate gastric mucus (6, 7). During this process, some adhesive proteins from the H. pylori membrane are affected and form a strong attachment to gastric epithelial cells (8). Outer membrane proteins, including blood group antigen-binding adhesion (BabA), adherence-associated lipoprotein A (AlpA), and adherence-associated lipoprotein B (AlpB), reportedly contribute to this process (9). Therefore, H. pylori could be eradicated by suppressing its motility or adhesion.
Pogostemonis Herba, the dried aerial part of Pogostemon cablin (Blanco) Benth. (Labiatae), has been used to treat gastrointestinal diseases for thousands of years in many Asian countries (10). The major active ingredient in Pogostemonis Herba is patchouli alcohol (PA) (structure shown in Fig. 1). Modern research revealed that Pogostemonis Herba and its extract exhibit antibacterial, anti-inflammatory, gastroprotective, and antiemetic effects (11–15). In our previous study, PA exerted gastroprotective and H. pylori urease inhibitory effects (16, 17). Besides, PA protects against urease-induced cytotoxicity in gastric epithelial cells (18).
FIG 1.

Chemical structure of PA.
In this follow-up study, we endeavored to further illustrate the anti-H. pylori property and the potential mechanism of PA from other aspects. First, MIC, minimum bactericidal concentration (MBC), and killing kinetics experiments were undertaken to evaluate the anti-H. pylori effect of PA. Second, the possible effects of PA on the motility, adhesion, and ultrastructure of H. pylori were investigated. Third, the bacterial resistance to and postantibiotic effect (PAE) of PA on H. pylori were examined. Finally, the bacterial eradication rate and effect of PA on H. pylori-induced gastritis were investigated in vivo.
RESULTS
MIC and MBC of PA against H. pylori.
The MICs of PA against three standard H. pylori strains, NCTC11637, NCTC26695, and Sydney strain 1 (SS1), were 25 to 75 μg/ml at pH 5.3 to 9. Twelve clinical strains were obtained from three sites in China, and the MICs of PA to these strains were 12.5 to 50 μg/ml. Furthermore, the MBCs of PA were 50 μg/ml against the three standard strains and 25 to 75 μg/ml against 11 clinical strains (Tables 1 and 2). The effective bacterial inhibitory effect of PA was also observed in isolates with CLR resistance (Hp1870 and Hp1876) and MET resistance (Hp1869, Hp1870, Hp1871 Hp1872, and Hp1876).
TABLE 1.
MICs and MBCs of PA against H. pylori standard strains
| Strain | MIC (μg/ml) of PA |
MBC (μg/ml) (pH 7) | MBC/MIC (pH 7) | ||
|---|---|---|---|---|---|
| pH 5.3 | pH 7 | pH 9 | |||
| NCTC11637 | 25 | 25 | 50 | 50 | 2 |
| NCTC26695 | 50 | 25 | 25 | 50 | 2 |
| SS1 | 25 | 25 | 75 | 50 | 2 |
TABLE 2.
MICs and MBCs of PA against H. pylori clinical isolatesa
| Strain | MIC of CLR | MIC of MET | MIC of PA | MBC | MBC/MIC |
|---|---|---|---|---|---|
| AH-258 | — | — | 25 | — | — |
| ICDC111001 | 0.0156 | 4 | 25 | 50 | 2 |
| Hp1868 | 0.0156 | 0.5 | 50 | 75 | 1.5 |
| Hp1869 | 0.0156 | 20 | 50 | 75 | 1.5 |
| Hp1870 | >2 | >50 | 50 | 75 | 1.5 |
| Hp1871 | 0.5 | 20 | 50 | 75 | 1.5 |
| Hp1872 | 0.0156 | 8 | 12.5 | 25 | 2 |
| Hp1873 | 0.0156 | 0.5 | 25 | 75 | 3 |
| Hp1874 | 0.0156 | 0.5 | 40 | 50 | 1.25 |
| Hp1875 | 0.0156 | 0.5 | 40 | 50 | 1.25 |
| Hp1876 | >2 | 20 | 25 | 75 | 3 |
| Hp1877 | 0.0156 | 1 | 20 | 50 | 2.5 |
MICs and MBCs are given in μg/ml at pH 7. —, the MBC experiment of AH-258 was not processed.
Killing kinetics analysis of PA against H. pylori.
As shown in Fig. 2, time- and dose-dependent killing kinetics of PA were observed in two standard H. pylori strains (NCTC11637 and SS1). Under both weakly acidic and neutral conditions, PA at 2 to 5 times the MIC showed a reliable bactericidal ability. For NCTC11637, PA at 5 times the MIC cleared all H. pylori bacteria in only 15 min at pH 5.3 and 7. For SS1, PA at 5 times the MIC killed H. pylori in 15 min at pH 7. The time required to kill H. pylori decreased with increasing PA concentrations. These data suggest that PA was efficaciously bactericidal against H. pylori in a dose- and time-dependent manner under different pHs.
FIG 2.
Killing kinetics curve for PA against strains NCTC11637 and SS1 at different concentrations and two pHs (7 and 5.3). The experiment was monitored for 6 h in the presence or absence of 50, 75, 100, and 125 μg/ml of PA, and the surviving bacteria were enumerated (CFU/ml) at the indicated times by plating. (A) NCTC11637 at pH 7; (B) NCTC11637 at pH 5.3; (C) SS1 at pH 7; (D) SS1 at pH 5.3.
Effect of PA on H. pylori adhesive capacity.
An antiadhesive ability experiment was carried out in three different ways, including use of H. pylori pretreatment with PA, use of gastric epithelial (GES-1) cell pretreatment with PA, and use of the three above-mentioned cocultures (H. pylori, GES-1 cell, and PA) simultaneously (see Fig. S2, point 5, in the supplemental material). The adhesive bacteria markedly decreased with the first and third incubation methods, indicating that the effect of PA against H. pylori adhesion might be closely associated with H. pylori itself. The results of H. pylori pretreatment with PA are shown in Fig. 3A to D, and green fluorescence indicates fluorescein isothiocyanate (FITC)-labeled H. pylori. Compared with the those of the control, the fluorescent area/cell area values were significantly decreased with PA treatment at 5, 10, and 20 μg/ml for 1 h (P < 0.01 or P < 0.05), indicating that PA could remarkably inhibit the adhesion of H. pylori to GES-1 cells (Fig. 3E), while CLR and MET exerted no significant effects on the adhesive capacity of H. pylori.
FIG 3.
Effect of PA on the adhesive capacity of H. pylori NCTC11637. The areas of FITC-labeled bacteria (green) and GES-1 cells were measured by ImageJ. Adhesive indexes were calculated as fluorescent H. pylori area/cell area. (A) Control; (B) CLR (0.0125 μg/ml); (C) MET (0.4 μg/ml); (D) PA (5 μg/ml); (E) PA (10 μg/ml); (F) PA (20 μg/ml); (G) quantitative result of H. pylori adhesive capacity. Data are expressed as the mean ± SEM (n = 6). *, P < 0.05, and **, P < 0.01 (compared with the results for the control).
Effect of PA on H. pylori motility.
In 3 days of cultivation, H. pylori could use its flagella to move in the swarm agar plate. In the control group, obvious diffusion traces of H. pylori were observed (13.42 ± 1.44 mm2). In contrast, PA treatment (10 or 20 μg/ml) significantly decreased the diffusion in a concentration-dependent manner, with diffusion areas of 6.12 ± 0.80 mm2 and 5.65 ± 0.32 mm2 (P < 0.05), respectively (Fig. 4). CLR and MET both showed remarkable antimotility capacity on H. pylori (P < 0.01), which was in accord with a previous report (19).
FIG 4.
Effect of PA on H. pylori NCTC11637 motility. H. pylori was pretreated with DMSO (control), CLR (0.0125 μg/ml), MET (0.4 μg/ml), and PA (5, 10, and 20 μg/ml) for 4 h and inoculated in swarm agar plates (BHI supplied with 10% FBS and 0.3% agar). After 3 days, H. pylori diffusion areas were photographed and analyzed by ImageJ, and each photo contained the same scale to regulate the size. Data are expressed as the mean ± SEM (n = 6). *, P < 0.05, and **, P < 0.01 (compared with the results for the control).
Effect of PA on H. pylori flagellar formation.
As shown in Fig. 5, most H. pylori cells displayed the normal morphology of long flagella and a spiral shape. However, treatment with 10 μg/ml PA decreased the number of H. pylori flagella. Meanwhile, 20 μg/ml PA significantly decreased the formation of H. pylori flagella, and the flagella formed were obviously shorter than the normal ones. The result suggested that PA can suppress the flagellar formation of H. pylori.
FIG 5.
Effect of PA on H. pylori NCTC11637 flagellation based on scanning electron microscopy. H. pylori colonies were formed on agar plates containing PA (5, 10, and 20 μg/ml) and DMSO. After 3 days of incubation, bacterial cells were fixed with 2.5% glutaraldehyde and investigated by SEM (×10,000). Arrows indicate the presence of H. pylori flagella.
Effect of PA on H. pylori ultrastructure.
As shown in Fig. 6, H. pylori displayed normal spiral and coccoid morphology after exposure to dimethyl sulfoxide (DMSO; control) for 1 or 2 h (panels A-1 to A-4). However, treatment with 25 μg/ml PA for 1 h clearly reduced the numbers of normal spiral rod isoforms and led to bacterial cell lysis and bleb formation (panels B-1 and B-2). Furthermore, after 2 h, bacterial cell lysis was aggravated and most H. pylori cells became coccoid (panels B-3 and B-4). Treatment with 50 μg/ml PA for 1 and 2 h induced considerable conversion from a spiral to a coccoid morphology. Thus, spiral H. pylori cells were rarely observed. Most H. pylori cells became swollen, and a separation between the cell wall and the inner membrane was also observed (panels C-1 and C-3). Meanwhile, some bacterial cells with cell wall damage and lysis of the cytoplasmic membrane were evident (panels C-2 and C-4).
FIG 6.
(A1 to C4) Effect of PA on H. pylori NCTC11637 ultrastructure based on transmission electron microscopy. PA was used at 25 and 50 μg/ml to interfere with H. pylori cells for 1 or 2 h. Bacterial cells were then fixed with 2.5% glutaraldehyde and investigated by TEM (×10,000). Each representative result is shown at two different scales. Arrows indicate cell lysis, bleb formation, cell wall damage, or separation between cell wall and inner membrane.
Effect of PA on H. pylori adhesion and motility-related gene expression.
As shown in Fig. 7A to C, treatment with PA at 5, 10, or 20 μg/ml significantly downregulated the expression levels of alpA and alpB, two important H. pylori adhesion-related genes (all, P < 0.01). Nevertheless, PA exerted no significant effect on babA gene expression (P > 0.05). Besides, as shown in Fig. 7D and E, treatment with PA at 10 and 20 μg/ml significantly decreased the expression levels of H. pylori motility-related genes flaA and flaB (P < 0.01). However, CLR and MET exerted no significant effects on the expression levels of adhesion- and motility-related genes of H. pylori.
FIG 7.
Effect of PA on H. pylori NCTC11637 alpA (A), alpB (B), babA (C), flaA (D), and flab (E) gene expression by qPCR. H. pylori was treated with DMSO (control), CLR (0.0125 μg/ml), MET (0.4 μg/ml), and PA (5, 10, and 20 μg/ml) for 1 h. The 16S gene was defined as the internal reference. Data are expressed as the mean ± SEM (n = 6). **, P < 0.01 (compared with the results for the control).
H. pylori resistance against PA.
The MICs of MET, CLR, and PA for the three standard original strains are shown in Table 3, row 1. The MICs of MET, CLR, and PA against three control groups remained constant (data not shown). The MICs of MET against NCTC11637 and SS1 both increased from 0.5 to 512 μg/ml after 30 passages. The MICs of CLR against NCTC11637 and SS1 increased from 0.0156 to 0.2496 μg/ml after 12 passages. In addition, the MICs of MET and CLR against NCTC26695 increased from 0.5 to 256 μg/ml and 0.0156 to 7.9872 μg/ml, respectively, after 27 passages. However, the MICs of PA against all tested strains remained the same after 9 passages at 12.5 μg/ml (1/2 the MIC), indicating that PA carries a small risk of inducing bacterial resistance.
TABLE 3.
H. pylori resistance to MET, CLR, and PAa
| Passage no. (3×) | MIC (μg/ml) of drug to strain: |
||||||||
|---|---|---|---|---|---|---|---|---|---|
| NCTC26695 |
NCTC11637 |
SS1 |
|||||||
| MET | CLR | PA | MET | CLR | PA | MET | CLR | PA | |
| 0 | 0.5 | 0.0156 | 25 | 0.5 | 0.0156 | 25 | 0.5 | 0.0156 | 25 |
| 1 | 1 | 0.0312 | 25 | 1 | 0.0312 | 25 | 1 | 0.0312 | 25 |
| 2 | 2 | 0.0624 | 25 | 2 | 0.0624 | 25 | 2 | 0.0624 | 25 |
| 3 | 4 | 0.1248 | 25 | 4 | 0.1248 | 25 | 4 | 0.1248 | 25 |
| 4 | 8 | 0.2496 | — | 8 | 0.2496 | — | 8 | 0.2496 | — |
| 5 | 16 | 0.4992 | — | 16 | — | — | 16 | — | — |
| 6 | 32 | 0.9984 | — | 32 | — | — | 32 | — | — |
| 7 | 64 | 1.9968 | — | 64 | — | — | 64 | — | — |
| 8 | 128 | 3.9936 | — | 128 | — | — | 128 | — | — |
| 9 | 256 | 7.9872 | — | 256 | — | — | 256 | — | — |
| 10 | — | — | — | 512 | — | — | 512 | — | — |
MET, metronidazole; CLR, clarithromycin. The MICs of MET, CLR, and PA for the original strains before passage are shown in the first row, and the MICs for three control groups remained constant (data not shown). Every three passages in antibiotic plates meant one-step induction, and 3× means three successive passages were cultured in the plate with the same antibiotic concentration. —, end of induction. The end of the resistance induction experiment was indicated by the absence of any change in MIC after nine passages at the same concentration or when the MICs were more than 1,024 times the original values.
PAE of PA against H. pylori.
As shown in Fig. 8, pretreatment with the three drugs for 2 h clearly delayed the logarithmic phases of H. pylori. In addition, the times of the PAE for 2 times the MIC of MET and CLR were 6.3 and 12.4 h, respectively. For PA, at 1.5 times the MIC, the PAE time was 7.5 h. However, when the concentration was raised to 2 times the MIC, H. pylori lost its proliferation ability after 2 h of PA treatment, indicating the prolonged PAE induced by PA.
FIG 8.
PAE of PA on H. pylori SS1. Bacteria were pretreated with CLR (2 times the MIC, 0.0312 μg/ml), MET (2 times the MIC, 1 μg/ml), and PA (1.5 and 2 times the MIC, 37.5 and 50 μg/ml, respectively) for 2 h, respectively. The proliferation abilities were analyzed by using the bacterial counting method. The moment after the bacteria were treated with drugs for 2 h was defined as 0 h. Data presentations were terminated when the increments reached 1,000-fold compared with that at 0 h.
Effect of PA on H. pylori eradication.
Establishment of H. pylori infection was also confirmed by PCR assay using DNA isolated from H. pylori-infected stomach tissues and in vitro culture in blood agar plates (Fig. S3). As shown in Table 4, the results of the rapid urease test (RUT) showed that the clearing rates of triple therapy and PA (5 mg/kg) were 100% and 80%, respectively (P < 0.01 and P < 0.05, chi-square test), while the results of boracic acid methylene blue (BAMB) staining indicated that the clearing rates of the triple therapy and PA (5 mg/kg) were both 40%, suggesting that the H. pylori detection sensitivity of histologic section staining was higher than that of the RUT (Fig. S4). Therefore, PA could effectively attenuate H. pylori colonization in C57BL/6 mice.
TABLE 4.
H. pylori clearing rate in vivoa
| Group | No. of mice |
||
|---|---|---|---|
| Total | Positive by RUT | Positive by BAMB stain | |
| Control | 9 | — | — |
| Model | 10 | 10 | 10 |
| Triple therapy | 10 | 0** | 6 |
| PA | |||
| 5 mg/kg | 10 | 2* | 6 |
| 2.5 mg/kg | 10 | 6 | 8 |
| 1.25 mg/kg | 10 | 5 | 7 |
Compared with the model, results are significant at a P of <0.01 (**) or a P of <0.05 (*). RUT, rapid urease test; BAMB, boracic acid methylene blue. Comparison was made by the chi-square test. —, none of the mice were infected in the control group. Positive results determined by RUT or BAMB staining indicate that the mice were infected with H. pylori.
Quantitative analysis of cytokine gene expression.
As shown in Fig. 9, the expression levels of COX-2, inducible nitric oxide synthase (iNOS), interleukin 1β (IL-1β), and tumor necrosis factor alpha (TNF-α) inflammatory genes were significantly upregulated in the model group compared with that of the control (P < 0.01). Administration of three drugs (triple therapy) and PA for 2 weeks significantly decreased iNOS, IL-1β, and TNF-α gene expression (P < 0.01) in the stomach mucosa. In addition, PA remarkably downregulated the COX-2 gene expression (P < 0.01). The effect of PA on the gene expression of the tested cytokines was stronger than that of the positive control. Hence, PA can exert anti-inflammatory effects on H. pylori-induced gastritis in mice by suppressing inflammatory mediators.
FIG 9.
Effect of PA on cytokine gene expression in H. pylori-infected mice with gastritis. After H. pylori SS1 infection for 12 weeks, mice were orally administered poloxamer 407 (control and model), triple antibiotics (omeprazole at 400 μmol/kg/day, metronidazole at 14.2 mg/kg/day, and clarithromycin at 7.15 mg/kg/day), and PA (5 mg/kg/day) once a day, respectively. Two weeks later, the mouse stomachs were removed to isolate RNA, and qPCR was employed to analyze COX-2 (A), iNOS (B), IL-1β (C), and TNF-α (D) gene expression. The GADPH gene was defined as the internal reference. Data are expressed as the mean ± SEM (n = 8). ##, P < 0.01 (compared with the results for the control); **, P < 0.01 (compared with the model).
DISCUSSION
Owing to the antibiotic resistance and declining eradication rate of H. pylori in the clinic, more alternative therapeutic protocols are urgently necessary (20). In the present study, we aimed to investigate the anti-H. pylori activity and mechanism of PA. The results of MIC, MBC, and killing kinetic assays showed the effective anti-H. pylori abilities of PA and indicated the therapeutic effect of PA against clinical antibiotic-resistant strains. For the acid MIC experiment, pH 5.3 was employed, since H. pylori usually lives under mildly acidic conditions between gastric epithelial cells and the gastric mucosa with pH ranging from 5.3 to 6.9 (21, 22). A potent antibacterial activity of PA was found even in low-pH environments.
In our previous investigation, PA was shown to arrest the growth of H. pylori by inhibition of its urease (17). In continuation of our work, the potential effect of PA on two vital infection processes—motility and adherence of H. pylori—were analyzed. We determined the nontoxic concentration of PA for H. pylori and GES-1 cells and found that PA (5, 10, 20 μg/ml) exerted no significant effects on H. pylori and GES-1 cell proliferation (see Fig. S5 in the supplemental material). Adhesive proteins BabA and AlpAB are key factors in H. pylori adhesion that specifically bind to the cell surface proteins Lewis b and laminin, respectively (23, 24). Results showed that PA significantly suppressed the adherence of H. pylori to GES-1 cells and inhibited alpA and alpB gene expression. In addition, the results of swarm agar plate, quantitative PCR (qPCR), and scanning electron microscopy (SEM) assays showed that PA significantly decreased H. pylori motility and downregulated the expression of flaA and flaB. Flagellar movement is driven by the energy supplied by a [H+] gradient, which is triggered by urea hydrolysis (25). In this context, the significant inhibition by PA of H. pylori motility might be associated with the urease inhibitory effect of PA observed in our previous investigation. The inhibitory effect of PA on the docking process of H. pylori to the stomach tissue and bacterial motility could be important mechanisms against H. pylori infection and colonization, leading to a diminished incidence of infection.
The effect of PA on H. pylori ultrastructure was further investigated via transmission electron microscopy (TEM). Physiologically unfavorable conditions for H. pylori, such as avoidance of its metabolic pathways and/or a lack of an energy source, result in transformation from the spiral to the coccoid form (26). PA treatment reduced the spiral rods and promoted coccoid formation, bleb formation, bacterial lysis, and cell wall damage of H. pylori in a time-dependent manner. This phenomenon was possibly responsible for the decline in viability. The obvious increase in swollen bacteria and cell debris indicated the progressive cellular destruction of H. pylori, suggesting that PA exerted an antibacterial effect against H. pylori by disrupting the bacterial cell envelope, causing cell metabolism disruption and alternations of osmotic pressure and thus bleb formation and cell lysis.
The increased resistance of H. pylori and other pathogenic bacteria to antibiotics (27) is an important problem worldwide. Therefore, a highly effective and safe agent must be developed to eradicate antibiotic-resistant strains of H. pylori. In the present study, we compared the resistances of H. pylori to PA, MET, and CLR. The resistances of the three standard H. pylori strains to MET and CLR were easily induced, especially that to MET. This phenomenon may correspond with the fact that the efficiency of triple therapy has decreased (4). In contrast, exposure to PA resulted in no obvious bacterial resistance, as evidenced by the consistent MIC of PA even after nine transfers.
PAE is a favorable property of drugs because it allows prolonged drug efficacy even if the concentration is lower than the MIC. A long PAE indicates less-frequent drug administration in the clinic. In this research, PA was observed to prolong the PAE, indicating the possible influence of PA on bacterial DNA synthesis or protein translation (28).
With the explicit anti-H. pylori effect of PA in vitro, the H. pylori SS1-infected mouse model was established to evaluate the effect of PA on H. pylori eradication in vivo (29). Our results indicate that PA treatment effectively eradicated H. pylori from infected mouse stomachs. And the decrease in the colonizing numbers of H. pylori organisms might contribute to the attenuation of H. pylori-associated gastritis. H. pylori major toxic factors CagA and VacA could induce an increment in many proinflammatory cytokines, such as IL-1β, TNF-α, and COX-2 (30–32). In addition, the activation of iNOS, which occurs mainly in macrophages, triggers the generation of a large amount of nitric oxide and thus induces chronic gastritis (33). The present study showed that PA could effectively inhibit gastritis induced by H. pylori by inhibiting IL-1β, TNF-α, COX-2, and iNOS gene expression. These observations not only indicated the direct anti-H. pylori activity of PA but also highlighted the importance of the anti-inflammatory effect through suppression of mediators in the attenuation of H. pylori-associated gastritis.
Considering these findings together, PA might effectively inhibit H. pylori motility and adherence to gastric epithelial cells in addition to inhibiting it on urease. This phenomenon possibly contributed to its antibacterial activity in vivo. Also, PA showed immense therapeutic potential against H. pylori infection in the effective eradication of H. pylori from infected mice and the reduction of H. pylori-induced gastric damage. Notably, in our previous investigation, we observed that PA, unlike wide-spectrum antibiotics, is highly selective toward H. pylori but not toward other common aerobic and anaerobic intestinal bacterial species (17). Hence, PA might act through mechanisms distinctly different from the mode of action of antibiotics for H. pylori growth inhibition. These results provided novel insights into the polyvalent therapeutic effect of PA, which could act synergistically against H. pylori, suggesting its potential as an alternative therapy, and opens the way for further studies on the identification of novel antimicrobial targets of PA.
MATERIALS AND METHODS
Chemicals and reagents.
Campylobacter agar base, brain heart infusion (BHI), and Mueller-Hinton (MH) agar were obtained from Oxoid, USA. Dulbecco's modified Eagle's medium (DMEM) and fetal bovine serum (FBS) were purchased from Gibco Rockville, MD, USA. Sheep blood was procured from Pingrui Biotechnology, China. Poloxamer 407 was purchased from BASF Chemical Ltd., Germany. Vancomycin HCl, trimethoprim, cefsulodin sodium, amphotericin, MET, and CLR were obtained from Toku-E, Japan. TRIzol reagent was from Life Technologies, Carlsbad, CA, USA. A FastQuant reverse transcription (RT) kit (with genomic DNase [gDNase]) and Super Real premix (SYBR green) were obtained from Qiagen, Germany. FITC was from Sigma, USA. All other reagents used were of analytical grade.
H. pylori strains and growth condition.
Fifteen H. pylori strains were used in this study. NCTC11637 and NCTC26695 were purchased from the American Type Culture Collection (ATCC). Sydney strain 1 (SS1) was kindly provided by Richard Ferrero from Monash University, Australia. Clinical isolates, including ICDC111001 and AH-258, were provided by Zhang Jian-zhong of the Chinese Center for Disease Control and Prevention, China. Ten clinical isolates, Hp1868, Hp1869, Hp1870, Hp1871, Hp1872, Hp1873, Hp1874, Hp1875, Hp1876, and Hp1877, were obtained from Renji Hospital, Shanghai Jiaotong University.
All strains were stored at −80°C in BHI containing 30% glycerol. In this research, H. pylori was cultured in Campylobacter agar base (Karmali) supplemented with 7% sheep blood (FBS was used in some experiments) at 37°C in a tri-gas incubator (Nuaire Nu-5831E, USA) containing 10% CO2, 5% O2, and 85% N2 for 48 to 72 h. MH agar was used as the standard agar for the MIC experiment. For liquid proliferation, H. pylori was inoculated in BHI supplemented with 10% FBS under the same air environment as described above. Dent's medium (10 mg/liter vancomycin, 5 mg/liter trimethoprim, 5 mg/liter cefclidine, 5 mg/liter amphotericin B) was added to avoid contamination. H. pylori was subcultured twice in solid plates before each experiment to obtain accurate and stable results. DNA (16S) sequencing technology was used to confirm the strains (see Tables S1 to S4 in the supplemental material).
Cell culture and growth.
Gastric epithelial (GES-1) cells were kindly provided by the First Affiliated Hospital of Guangzhou University of Chinese Medicine. The cell line was authenticated by short-tandem-repeat analysis in 2014, initially expanded and cryopreserved within 1 month of receipt, and typically used for 3 months. The cells were cultured in high-glucose DMEM supplemented with 10% FBS at 37°C in a 5% CO2 humidified incubator and were passaged when they spread to more than 80% of the bottom of the culture bottle.
Animals.
C57BL/6 mice (5 to 6 weeks old, half males and half females) were obtained from Charles River (Beijing, China). The laboratory animal production license for the mice was SCXK (JING) 2012-0001. Mice were housed in environmentally controlled conditions (22 ± 2°C; relative humidity, 50% ± 5%) under a 12-h light/12-h dark cycle and given free access to food and water. Experimental protocols were approved by the Animal Experimental Ethics Committee of Guangzhou University of Chinese Medicine (Guangzhou, China).
Preparation of PA.
PA (purity, >99%) was prepared and further confirmed by melting point, infrared (IR), 1H and 13C nuclear magnetic resonance (NMR), and mass spectrometry (MS) analyses as previously described (34). In the in vitro study, DMSO was used to dissolve PA and served as a control (DMSO, <0.5% in all experiments). In the in vivo study, poloxamer 407 was used to prepare a PA solid dispersion by a melting method as previously described (35). The doses of PA in this study were adopted based on our pilot trial and the antiulcer experiment in vivo (16).
MIC assay.
The MICs for PA against 15 H. pylori strains were evaluated by using the agar dilution method. A series of PA concentrations (12.5, 25, 50, and 100 μg/ml) were employed. H. pylori strains were harvested and resuspended in phosphate-buffered saline (PBS) (a 1.0 to 2.0 McFarland standard was defined based on the strain properties). A 0.1-ml H. pylori suspension was then inoculated and flooded on the PA-containing or DMSO-containing (control) MH agar plate. After 72 h, the MIC was determined as the lowest concentration at which no strain growth could be observed by visual examination. The MIC experiments for the three standard strains were performed under different pH conditions (pH 5.3, 7, and 9), and the blood was replaced with 7% FBS. In brief, 37% HCl or 40% NaOH was mixed with the medium to adjust the pH before plate solidification. The experiments were repeated twice, and CLR and MET were employed in the test.
MBC assay.
The broth dilution method was used to define the MBC values of PA against 14 H. pylori strains. In brief, bacterial suspensions at a McFarland standard of almost 1 were exposed to DMSO (control) and PA at 2 to 4 times MIC in BHI supplemented with 10% FBS. After shaking at 120 rpm in the tri-gas incubator for 6 h, 100 μl of each sample was removed and cultured in Campylobacter agar. MBC values were defined as a 99.9% decrease in viability compared with the untreated control. The experiment was repeated twice.
Killing kinetics assay.
Killing kinetics curves of PA were measured by exposing H. pylori to high concentrations of PA (2 to 5 times the MIC). In brief, H. pylori NCTC11637 and SS1 were inoculated in BHI (10% FBS, 0.1 McFarland standard). After treatment with DMSO (control) or various concentrations of PA for 15, 30, 60, 90, 180, and 360 min, 130 μl of each sample was removed for dilution series (1:1 to 1:10,000). Then, 100-μl dilutions were plated on solid agar for 3 days to form single colonies. The colonies were counted, and results were expressed as number of CFU/ml. This experiment was carried out in both neutral (pH 7.0) and weakly acidic (pH 5.3) conditions and was repeated twice.
Anti-H. pylori adhesive capacity assay.
In the anti-H. pylori adhesive capacity assay, GES-1 cells were cultured in a glass-bottom cell culture disk for 24 h. For H. pylori, NCTC11637 was resuspended in BHI supplemented with 10% FBS and then pretreated with CLR (0.0125 μg/ml), MET (0.4 μg/ml), and PA (5, 10, and 20 μg/ml). DMSO (0.1%, vol/vol) served as the control. After incubation for 1 h, H. pylori was washed twice and resuspended in PBS (McFarland standard = 4.0). Subsequently, 1% FITC (dissolved in DMSO) was added at a ratio of 1:100 for 1 h in the dark at room temperature to stain H. pylori bacteria. Then, H. pylori bacteria were washed twice and resuspended with the same volume of DMEM (10% FBS). After coculture of GES-1 cells with H. pylori for 1 h, nonadhesive bacteria were washed, and images were taken under a laser confocal microscope (Leica TCS SP8, Germany). Results are presented as fluorescent area/cell area calculated by ImageJ (National Institutes of Health, USA).
Anti-H. pylori motility ability assay.
The anti-H. pylori motility effect of PA was investigated using the swarm agar plate method (36). In brief, NCTC11637 was resuspended in PBS and adjusted to a McFarland standard of 1. Then, the bacterial suspension was added to BHI supplemented with 10% FBS and pretreated with CLR (0.0125 μg/ml), MET (0.4 μg/ml), and PA (5, 10 and 20 μg/ml). DMSO (1‰, vol/vol) served as the control. After shaking at 120 rpm for 4 h, the bacteria were inoculated into a BHI base swarm agar plate (0.3% agar). After 4 days, the diffusion areas were photographed and analyzed by ImageJ.
Assay of PA effect on H. pylori ultrastructure and flagellation.
The effect of PA on H. pylori ultrastructure was assessed using transmission electron microscopy (TEM; JEM-1400, Japan). NCTC11637 was resuspended in BHI supplemented with 10% FBS. After shaking for 16 h in the tri-gas incubator, PA (25 or 50 μg/ml) and DMSO (control) were added. The bacteria were obtained at 0, 1, and 2 h after treatment by centrifugation at 1,500 rpm for 5 min. The samples were washed twice with PBS and then fixed with 2.5% glutaraldehyde for 4 h. The specimens were fixed with 1% osmium tetroxide, dehydrated through a graduated ethanol series, and then embedded in Epon 812. Ultraslices with a thickness of 50 to 70 nm were obtained, stained with both uranyl acetate and lead citrate, and then subsequently examined by TEM.
Scanning electron microscopy (SEM; Hitachi S-3400N, Japan) was employed to analyze H. pylori flagellation. H. pylori was adjusted to a McFarland standard of 1 and then subcultured onto a blood plate containing different PA concentrations (5, 10, and 20 μg/ml) or DMSO (control). Samples were harvested 3 days later, fixed with 2.5% glutaraldehyde for 4 h, postfixed with 1% osmium tetroxide, and then dehydrated in a graded series of acetone. The specimens were then treated with isoamyl acetate, subjected to CO2 critical point drying and gold plating, and subsequently observed by SEM.
Measurement of PA effect on H. pylori adhesion and motility-related gene expression.
Strain NCTC11637 was resuspended in BHI supplemented with 10% FBS and then pretreated with CLR (0.0125 μg/ml), MET (0.4 μg/ml), and PA (5, 10 and 20 μg/ml) for 1 h in the tri-gas incubator. After centrifugation at 2,500 rpm for 5 min, the supernatant was discarded, and TRIzol was added to isolate the RNA. The purity of RNA was determined using the A260/A280 values, and the concentration of RNA was confirmed using the A260 values (Shimadzu BioSpec-nano, Japan). cDNA was generated from 1 μg total RNA using a reverse transcription reagent kit with a gDNA eraser. A qPCR assay was performed in accordance with the manufacturer's instructions for Super Real premix (SYBR green). An Applied Biosystems 7500 real-time PCR system (Life Technologies, USA) was used to analyze the data in accordance with the method of Pfaffl, and the 16S gene served as the internal reference (37). The cycling protocol was set at 1 cycle at 95°C for 15 min and 40 cycles at 95°C for 5 s and 60°C for 30 s. qPCR was conducted strictly in accordance with the minimum information for publication of quantitative real-time PCR experiment guidelines (38). The primers used are listed in Table 5.
TABLE 5.
Primer sequences
| Genea | Forward primer (5′-3′) | Reverse primer (5′-3′) |
|---|---|---|
| alpA | GGTAGGCTCTGGGACTTGTG | TGGTGTTCGTGCCGTAGTTA |
| alpB | ACGAAATGGTTGGCTCTATCA | CGCTTGGTTATTGGCGTTTA |
| babA | GGTGGGGTTTTGGAATGTCTTA | AAAGAACAGGTGATGGAAGTGGA |
| flaA | TTCTATCGGCTCTACCACTTCA | TCACGCCATCCACTTGTTTA |
| flaB | CGCGCACGCAATTAGACA | TCGCACTCTCTTCAGCAAAATC |
| 16S gene | CGATGGATGCTAGTTGTTGGAG | GTCCCCGTCTATTCCTTTGAGTT |
| TNF-α gene | GCACCACCATCAAGGACTCA | TCGAGGCTCCAGTGAATTCG |
| IL-1β gene | ACACTCCTTAGTCCTCGGCCA | TGGTTTCTTGTGACCCTGAGC |
| COX-2 gene | CAGGAAGTCTTTGGTCTGGTGCC | GCTGGTTTGGAATAGTTGCTCATCA |
| iNOS gene | GGCAGCCTGTGAGACCTTTG | CGTTTCGGGATCTGAATGTGA |
| GAPDH gene | AGGTTGTCTCCTGCGACTTCA | CCAGGAAATGAGCTTGACAAAG |
alpA, adherence-associated lipoprotein A gene; alpB, adherence-associated lipoprotein B gene; babA, blood group antigen-binding adhesion gene; flaA, flagellin A gene; flaB, flagellin B gene; TNF-α, tumor necrosis factor alpha; IL-1β, interleukin 1β; COX-2, cyclooxygenase-2; iNOS, inducible nitric oxide synthase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
Assay of resistance development.
The MICs of MET, CLR, and PA against NCTC11637, NCTC26695, and SS1 were determined as described above. H. pylori inoculum was replicated on the serial antibiotic-containing agar dilution plates starting with an antibiotic concentration of 1/2 the MIC, followed by a 2 times concentration stepwise increase until 256 times the MIC was reached. After three passages at the same concentration, the MIC of each strain was redetermined to find any variation. The end of resistance induction was indicated by the absence of any change in MIC after nine passages at the same concentration or when the MICs were more than 1,024 times the original values (before passages). The propensities of resistance defined by a change in MIC were analyzed after exposure to a gradient increase in antibiotic concentration (39). Strains were subcultured in MH plates, and the groups without drugs were defined as controls.
Assay for the PAE of PA.
The PAE of PA on H. pylori was determined based on the regime of Hassan et al. and Minami et al. with some modifications (40, 41). In brief, after 2 days of growth of strain SS1 on a solid plate, bacteria were harvested and adjusted with PBS to 1 × 1010 CFU/ml. The bacterial suspension was inoculated into BHI supplemented with 10% FBS at ratio of 1:10 and then pretreated with different concentrations of PA (1.5 and 2 times the MIC, 37.5 and 50 μg/ml, respectively), CLR (2 times the MIC, 0.0312 μg/ml), MET (2 times the MIC, 1 μg/ml), and DMSO for 2 h. The drug-exposed cultures were then diluted 1,000 times in the same liquid medium to remove the drugs (42). After the drug was removed for 0, 16, 24, 32, 40, and 48 h, 130 μl of the samples was removed for the dilution series (1:1 to 1:10,000). One-hundred-microliter dilutions were then plated on solid agar for 3 days to form single colonies. The colonies were counted, and results were expressed as log10 CFU/ml. The PAE values of PA, CLR, and MET were calculated from the regrowth curves of H. pylori SS1 by the using equation PAE = T − C, where T is the time required for the number of bacteria in the drug culture to increase 1,000-fold and C is the time required for the number of bacteria in the control culture to increase 1,000-fold.
H. pylori inoculation and detection in mice.
H. pylori SS1 was resuspended in PBS and adjusted to a McFarland standard of 1. The bacterial suspension was transferred to BHI (1:10) supplied with 10% FBS. The bacteria grew to the early to-mid logarithmic phase with shaking at 120 rpm for 16 to 20 h (43).
Mice were fasted for 12 h, and then 0.25 ml of an H. pylori (1 × 107 CFU/ml) suspension was orally administered by gavage using a 24-gauge needle three times at 2-day intervals over 5 days. Moreover, 3% salt was added to the drinking water to enhance H. pylori colonization (44, 45). After 2 weeks, PCR, RUT, and bacterial culture experiments were carried out to examine the infection status of H. pylori. In brief, some mice were euthanized, and their stomachs were isolated, cut off along the greater curvature, and then rinsed with PBS. Subsequently, the forestomachs were removed, and two small pieces of the pylorus were immersed in PCR buffer or RUT reagent (see point 2 in the supplemental material). The rest was homogenized in BHI, and serial dilutions of homogenates (1:1 to 1:105) were cultured in agar plates supplemented with Dent's medium.
Assay of PA effect on H. pylori eradication.
After H. pylori infection for 2 weeks, mice were randomly divided into the following six groups (n = 10, half males and half females): control group (poloxamer 407), model group (H. pylori plus poloxamer 407), triple-therapy group (H. pylori plus omeprazole at 400 μmol/kg/day, MET at 14.2 mg/kg/day, and CLR at 7.15 mg/kg/day) (46), and PA groups (H. pylori plus 5, 2.5, and 1.25 mg/kg PA). After 14 days of oral administration by using a 24-gauge needle, the mice were sacrificed and their stomachs were removed. RUT and histological examination were employed to verify the effect. Half of the gastric tissues were immersed in formalin and prepared for boracic acid methylene blue (BAMB) staining.
Assay of PA effect on gastritis induced by H. pylori.
After H. pylori infection for 12 weeks, mice were randomly divided into the following four groups (n = 8, half males and half females): control (poloxamer 407), model (H. pylor plus poloxamer 407), triple therapy (H. pylori plus omeprazole, MET, and CLR as described above), and PA (H. pylori plus 5 mg/kg PA). After 14 days of oral administration, mice were sacrificed and their stomachs were divided into two parts. One part was fixed in formalin and then stained with hematoxylin and eosin for histological evaluation based on the standard (47) by two pathologists (Fig. S1). The other part was used to isolate RNA, and the COX-1, IL-1β, TNF-α, and iNOS gene expression levels were tested by qPCR to reflect the gastritis level. The cycling protocol was set at 1 cycle at 95°C for 10 min and 40 cycles at 95°C for 15 s and 60°C for 60 s. The PCR data were analyzed using the 2−ΔΔCT method with the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene as the internal reference. The primers used are listed in Table 5, and the other experimental details were the same as those described above.
Statistical analysis.
Results were expressed as means ± standard errors of the means and analyzed using SPSS 19.0. The least significant difference (LSD) test or Dunnett's test was used for multiple groups based on homogeneity of variance. The chi-square test was adopted for enumeration of data. A P of <0.05 was considered significant.
Supplementary Material
ACKNOWLEDGMENTS
This research was supported by the National Science Foundation of China (no. 81374043 and 81503202), the Science and Technology Planning Project of Guangdong Province (no. 2013A022100001, 2016A020217019, and 2014A020221042), the Science and Technology Program of Guangzhou (no. 201607010336), the Guangdong Natural Science Foundation (no. 2015A030310217), Ph.D. Programs Foundation of Ministry of Education of China (no. 20134425110009), and the Science and Technology Innovation Project of Guangdong Provincial Department of Education (no. 2013KJCX0045).
We appreciate the vital help of Zhang Jian-zhong (Chinese Center for Disease Control and Prevention, China) and Richard Ferrero (Monash University, Australia).
Footnotes
Supplemental material for this article may be found at https://doi.org/10.1128/AAC.00122-17.
REFERENCES
- 1.Marshall B, Warren J. 1984. Unidentified curved bacilli in the stomach of patients with gastritis and peptic ulceration. Lancet i:1311–1315. [DOI] [PubMed] [Google Scholar]
- 2.Marshall B. 1991. Virulence and pathogenicity of Helicobacter pylori. J Gastroenterol Hepatol 6:121–124. doi: 10.1111/j.1440-1746.1991.tb01450.x. [DOI] [PubMed] [Google Scholar]
- 3.De Francesco V, Giorgio F, Hassan C, Manes G, Vannella L, Panella C, Ierardi E, Zullo A. 2010. Worldwide H. pylori antibiotic resistance: a systematic review. J Gastrointestin Liver Dis 19:409–414. [PubMed] [Google Scholar]
- 4.O'Connor A, Vaira D, Gisbert J, Morain C. 2014. Treatment of Helicobacter pylori infection 2014. Helicobacter 19(Suppl 1):38–45. doi: 10.1111/hel.12163. [DOI] [PubMed] [Google Scholar]
- 5.Ng K, Ferreyra J, Higginbottom S, Lynch J, Kashyap P, Gopinath S, Naidu N, Choudhury B, Weimer B, Monack D, Sonnenburg J. 2013. Microbiota-liberated host sugars facilitate post-antibiotic expansion of enteric pathogens. Nature 502:96–99. doi: 10.1038/nature12503. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Menard R, Schoenhofen I, Tao L, Aubry A, Bouchard P, Reid C, Lachance P, Twine S, Fulton K, Cui Q, Hogues H, Purisima E, Sulea T, Logan S. 2014. Small-molecule inhibitors of the pseudaminic acid biosynthetic pathway: targeting motility as a key bacterial virulence factor. Antimicrob Agents Chemother 58:7430–7440. doi: 10.1128/AAC.03858-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Eaton K, Suerbaum S, Josenhans C, Krakowka S. 1996. Colonization of gnotobiotic piglets by Helicobacter pylori deficient in two flagellin genes. Infect Immun 64:2445–2448. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Aspholm-Hurtig M, Dailide G, Lahmann M, Kalia A, Ilver D, Roche N, Vikstrom S, Sjostrom R, Linden S, Backstrom A, Lundberg C, Arnqvist A, Mahdavi J, Nilsson U, Velapatino B, Gilman R, Gerhard M, Alarcon T, Lopez-Brea M, Nakazawa T, Fox J, Correa P, Dominguez-Bello M, Perez-Perez G, Blaser M, Normark S, Carlstedt I, Oscarson S, Teneberg S, Berg D, Boren T. 2004. Functional adaptation of babA, the H. pylori ABO blood group antigen binding adhesin. Science 305:519–522. doi: 10.1126/science.1098801. [DOI] [PubMed] [Google Scholar]
- 9.Odenbreit S. 2005. Adherence properties of Helicobacter pylori: impact on pathogenesis and adaptation to the host. Int J Med Microbiol 295:317–324. doi: 10.1016/j.ijmm.2005.06.003. [DOI] [PubMed] [Google Scholar]
- 10.Swamy M, Sinniah U. 2015. A comprehensive review on the phytochemical constituents and pharmacological activities of Pogostemon cablin Benth: an aromatic medicinal plant of industrial importance. Molecules 20:8521–8547. doi: 10.3390/molecules20058521. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Lu T, Liao J, Huang T, Lin Y, Liu C, Chiu Y, Peng W. 2011. Analgesic and anti-inflammatory activities of the methanol extract from the methanol extract from Pogostemon cablin. Evid Based Complement Alternat Med 2011:671741. doi: 10.1093/ecam/nep183. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Yang Y, Kinoshita K, Koyama K, Takahashi K, Tai T, Nunoura Y, Watanabe K. 1999. Anti-emetic principles of Pogostemon cablin (Blanco) Benth. Phytomedicine 6:89–93. doi: 10.1016/S0944-7113(99)80041-5. [DOI] [PubMed] [Google Scholar]
- 13.Kim K, Beemelmanns C, Clardy J, Cao S. 2015. A new antibacterial octaketide and cytotoxic phenylethanoid glycosides from Pogostemon cablin (Blanco) Benth. Bioorg Med Chem Lett 25:2834–2836. doi: 10.1016/j.bmcl.2015.04.094. [DOI] [PubMed] [Google Scholar]
- 14.Park S, Neupane G, Lee S, Lee J, Kim M, Kim S, Park B, Park Y, Kim J. 2014. Protective effects of Pogostemon cablin Bentham water extract on inflammatory cytokine expression in TNBS-induced colitis in rats. Arch Pharm Res 37:253–262. doi: 10.1007/s12272-013-0260-x. [DOI] [PubMed] [Google Scholar]
- 15.Peng F, Wan F, Xiong L, Peng C, Dai M, Chen J. 2014. In vitro and in vivo antibacterial activity of Pogostone. Chin Med J 127:4001–4005. [PubMed] [Google Scholar]
- 16.Zheng Y, Xie J, Xu Y, Liang Y, Mo Z, Jiang W, Chen X, Liu Y, Yu X, Huang P, Su Z. 2014. Gastroprotective effect and mechanism of patchouli alcohol against ethanol, indomethacin and stress-induced ulcer in rats. Chem Biol Interact 222:27–36. doi: 10.1016/j.cbi.2014.08.008. [DOI] [PubMed] [Google Scholar]
- 17.Yu X, Xie J, Wang Y, Li Y, Mo Z, Zheng Y, Su J, Liang Y, Liang J, Su Z, Huang P. 2015. Selective antibacterial activity of patchouli alcohol against Helicobacter pylori based on inhibition of urease. Phytother Res 29:67–72. doi: 10.1002/ptr.5227. [DOI] [PubMed] [Google Scholar]
- 18.Xie J, Lin Z, Xian Y, Kong S, Lai Z, Ip S, Chen H, Guo H, Su Z, Yang X, Xu Y, Su Z. 2016. (−)-Patchouli alcohol protects against Helicobacter pylori urease-induced apoptosis, oxidative stress and inflammatory response in human gastric epithelial cells. Int Immunopharmacol 35:43–52. doi: 10.1016/j.intimp.2016.02.022. [DOI] [PubMed] [Google Scholar]
- 19.Nobata K, Ina K, Ohta M, Kawamura-Sato K, Tsuzuki T, Ando T, Kusugami K. 2002. Lower concentrations of clarithromycin suppress urease activity, motility, and binding to gastric epithelial cells in Helicobacter pylori isolates. Dig Liver Dis 34:489–497. doi: 10.1016/S1590-8658(02)80107-4. [DOI] [PubMed] [Google Scholar]
- 20.Hu Y, Zhang M, Lu B, Dai J. 2016. Helicobacter pylori and antibiotic resistance, a continuing and intractable problem. Helicobacter 21:349–363. doi: 10.1111/hel.12299. [DOI] [PubMed] [Google Scholar]
- 21.Schade C, Flemstrom G, Holm L. 1994. Hydrogen ion concentration in the mucus layer on top of acid-stimulated and -inhibited rat gastric mucosa. Gastroenterology 107:180–188. doi: 10.1016/0016-5085(94)90075-2. [DOI] [PubMed] [Google Scholar]
- 22.Midolo P, Lambert J, Hull R, Luo F, Grayson M. 1995. In vitro inhibition of Helicobacter pylori NCTC 11637 by organic acids and lactic acid bacteria. J Appl Bacteriol 79:475–479. doi: 10.1111/j.1365-2672.1995.tb03164.x. [DOI] [PubMed] [Google Scholar]
- 23.Hage N, Howard T, Phillips C, Brassington C, Overman R, Debreczeni J, Gellert P, Stolnik S, Winkler G, Falcone F. 2015. Structural basis of Lewis (b) antigen binding by the Helicobacter pylori adhesin babA. Sci Adv 1:e1500315. doi: 10.1126/sciadv.1500315. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Senkovich O, Yin J, Ekshyyan V, Conant C, Traylor J, Adegboyega P, McGee D, Rhoads R, Slepenkov S, Testerman T. 2011. Helicobacter pylori AlpA and AlpB bind host laminin and influence gastric inflammation in gerbils. Infect Immun 79:3106–3116. doi: 10.1128/IAI.01275-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Yoshiyama H, Nakazawa T. 2000. Unique mechanism of Helicobacter pylori for colonizing the gastric mucus. Microbes Infect 2:55–60. doi: 10.1016/S1286-4579(00)00285-9. [DOI] [PubMed] [Google Scholar]
- 26.Nakamura A, Park A, Nagata K, Sato E, Kashiba M, Tamura T, Inoue M. 2000. Oxidative cellular damage associated with transformation of Helicobacter pylori from a bacillary to a coccoid form. Free Radic Biol Med 28:1611–1618. doi: 10.1016/S0891-5849(00)00284-7. [DOI] [PubMed] [Google Scholar]
- 27.Kaakoush N, Asencio C, Megraud F, Mendz G. 2009. A redox basis for metronidazole resistance in Helicobacter pylori. Antimicrob Agents Chemother 53:1884–1891. doi: 10.1128/AAC.01449-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Gottfredsson M, Erlendsdottir H, Gudmundsson A, Gudmundsson S. 1995. Different patterns of bacterial DNA synthesis during postantibiotic effect. Antimicrob Agents Chemother 39:1314–1319. doi: 10.1128/AAC.39.6.1314. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Lee A, Rourke JO, Ungria MD, Robertson B, Daskalopoulos G, Dixon M. 1997. A standardized mouse model of Helicobacter pylori infection: introducing the Sydney strain. Gastroenterology 112:1386–1397. doi: 10.1016/S0016-5085(97)70155-0. [DOI] [PubMed] [Google Scholar]
- 30.Huang F, Chan A, Lo R, Rashid A, Wong D, Cho C, Lai C, Yuen M. 2013. Characterization of interleukin-1beta in Helicobacter pylori-induced gastric inflammation and DNA methylation in interleukin-1 receptor type 1 knockout (IL-1R1−/−) mice. Eur J Cancer 49:2760–2770. doi: 10.1016/j.ejca.2013.03.031. [DOI] [PubMed] [Google Scholar]
- 31.Dunne C, Dolan B, Clyne M. 2014. Factors that mediate colonization of the human stomach by Helicobacter pylori. World J Gastroenterol 20:5610–5624. doi: 10.3748/wjg.v20.i19.5610. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Kim I, Blanke S. 2012. Remodeling the host environment: modulation of the gastric epithelium by the Helicobacter pylori vacuolating toxin (VacA). Front Cell Infect Microbiol 2:37. doi: 10.3389/fcimb.2012.00037. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Yeo M, Park H, Kim D, Cho S, Kim Y, Cho S, Paik Y, Hahm K. 2004. Restoration of heat shock protein70 suppresses gastric mucosal inducible nitric oxide synthase expression induced by Helicobacter pylori. Proteomics 4:3335–3342. doi: 10.1002/pmic.200400951. [DOI] [PubMed] [Google Scholar]
- 34.Qing SZ, Li WX, Jia BM, Wen LC, Zhi KS, Ren SZ, Ping LX, Cui LY, Nan CJ. 2014. Isolation of (−)-patchouli alcohol from patchouli oil by fractional distillation and crystallization. Trop J Pharm Res 13:359–363. doi: 10.4314/tjpr.v13i3.7. [DOI] [Google Scholar]
- 35.Liao J, Liang Y, Chen Y, Xie J, Liu W, Chen J, Lai X, Su Z. 2015. Novel patchouli alcohol ternary solid dispersion pellets prepared by poloxamers. Iran J Pharm Res 14:15–26. doi: 10.18579/jpcrkc/2015/14/1/78370. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Kao C-Y, Sheu B-S, Wu J-J. 2014. CsrA regulates Helicobacter pylori J99 motility and adhesion by controlling flagella formation. Helicobacter 19:443–454. doi: 10.1111/hel.12148. [DOI] [PubMed] [Google Scholar]
- 37.Pfaffl MW. 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 29:e45. doi: 10.1093/nar/29.9.e45. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Bustin S, Benes V, Garson J, Hellemans J, Huggett J, Kubista M, Mueller R, Nolan T, Pfaffl M, Shipley G, Vandesompele J, Wittwer C. 2009. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem 55:611–622. doi: 10.1373/clinchem.2008.112797. [DOI] [PubMed] [Google Scholar]
- 39.Aldana L, Kato M, Kondo T, Nakagawa S, Zheng R, Sugiyama T, Asaka M, Kwon D. 2005. In vitro induction of resistance to metronidazole, and analysis of mutations in rdxA and frxA genes from Helicobacter pylori isolates. J Infect Chemother 11:59–63. doi: 10.1007/s10156-004-0370-Y. [DOI] [PubMed] [Google Scholar]
- 40.Hassan IJ, Stark RM, Greenman J, Millar MR. 1998. Absence of a post-antibiotic effect (PAE) of beta lactams against Helicobacter pylori NCTC 11637. J Antimicrob Chemother 42:661–663. doi: 10.1093/jac/42.5.661. [DOI] [PubMed] [Google Scholar]
- 41.Minami M, Ando T, Hashikawa SN, Torii K, Hasegawa T, Israel DA, Ina K, Kusugami K, Goto H, Ohta M. 2004. Effect of glycine on Helicobacter pylori in vitro. Antimicrob Agents Chemother 48:3782–3788. doi: 10.1128/AAC.48.10.3782-3788.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Sorberg M, Hanberger H, Nilsson M, Nilsson LE. 1997. Pharmacodynamic effects of antibiotics and acid pump inhibitors on Helicobacter pylori. Antimicrob Agents Chemother 41:2218–2223. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Ferrero R, Wilson J, Sutton P. 2012. Mouse models of Helicobacter-induced gastric cancer: use of cocarcinogens. Methods Mol Biol 921:157–173. doi: 10.1007/978-1-62703-005-2_20. [DOI] [PubMed] [Google Scholar]
- 44.Xu Y, Jing J, Gong Y, Xu Q, Zhang W, Piao Y, Wang Y, Yuan Y. 2011. Changes in biological and virulent characteristics of Helicobacter pylori exposed to high salt. Asian Pac J Cancer Prev 12:2637–2641. [PubMed] [Google Scholar]
- 45.Loh J, Gaddy J, Algood H, Gaudieri S, Mallal S, Cover T. 2015. Helicobacter pylori adaptation in vivo in response to a high-salt diet. Infect Immun 83:4871–4883. doi: 10.1128/IAI.00918-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Suk K, Baik S, Kim H, Park S, Paeng K, Uh Y, Jang I, Cho M, Choi E, Kim M, Ham Y. 2011. Antibacterial effects of the urushiol component in the sap of the lacquer tree. Helicobacter 16:434–443. doi: 10.1111/j.1523-5378.2011.00864.x. [DOI] [PubMed] [Google Scholar]
- 47.Aydin O, Egilmez R, Karabacak T, Kanik A. 2003. Interobserver variation in histopathological assessment of Helicobacter pylori gastritis. World J Gastroenterol 9:2232–2235. doi: 10.3748/wjg.v9.i10.2232. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.








