Skip to main content
3 Biotech logoLink to 3 Biotech
. 2017 May 30;7(2):103. doi: 10.1007/s13205-017-0734-5

Identification and characterization of microRNAs and their targets in high-altitude stress-adaptive plant maca (Lepidium meyenii Walp)

Sujay Paul 1,2,✉
PMCID: PMC5449282  PMID: 28560642

Abstract

MicroRNAs (miRNAs) are endogenous, short (~21-nucleotide), non-coding RNA molecules that play pivotal roles in plant growth, development, and stress response signaling. In this study using recently published draft genome sequence of a high-altitude plant maca (Lepidium meyenii Walp) and applying genome-wide computational-based approaches, a total of 62 potentially conserved miRNAs belonging to 28 families were identified and four (lme-miR160a, lme-miR164c, lme-miR 166a, and lme-miR 319a) of them further validated by RT-PCR. Deploying psRNATarget tool a total of 99 potential miRNA target transcripts were also identified in maca. Targets include a number of transcription factors like Squamosa promoter-binding, NAC, MYB, auxin response factor, APETALA, WRKY, and F-box protein. To the best of my knowledge, this is the first genome-based miRNA profiling of a high-altitude plant.

Keywords: Maca (Lepidium meyenii Walp), High-altitude plant, Stress, miRNA, MFEI, miRNA targets

Introduction

Maca (Lepidium meyenii Walp), belonging to the Brassicaceae family, is an economically important plant cultivated in the central Andean region at 4000–4450 m above sea level. Its tremendous health benefits, particularly to reproduction and fertility, have drawn great investments from pharmacological research in recent years (Piacente et al. 2002; Shin et al. 2010). Maca roots contain several secondary metabolites of interest including glucosinolates, fatty acid esters, phytosterols, alkaloids, and alkamides (macamides) (Piacente et al. 2002). Due to its restricted cultivation area at high altitude, maca manifests strong endurance to extreme environmental conditions such as low temperatures in combination with high irradiance, strong winds, and oxidizing air pollutants.

MicroRNAs are endogenous, non-coding, small RNAs ranging in length from 20 to 24 nucleotides (Huang et al. 2016). Post-transcriptional gene regulation mediated by endogenous miRNAs play a crucial role in various aspects of plant development as well as adaptation to biotic and abiotic stresses (Naya et al. 2014; Khraiwesh et al. 2012; Paul et al. 2011; Kundu et al. 2017). In plants, mature miRNAs are generated from longer stem-loop RNA precursors (Pre-miRNA) with the aid of ribonuclease III-like Dicer (DCL1) enzyme (Fukudome and Fukuhara 2017). Despite the fact that miRNAs have a great role in stress responses, till date no scientific initiative has been taken to study maca miRNAs. Moreover, very few reports are available on medicinal plants for miRNA regulation of their bioactive compounds or secondary metabolites. With the recent draft genome sequence available (http://www.herbal-genome.cn/) (Zhang et al. 2016), it is important to exploit this information for better understanding the physiological processes in maca.

Materials and methods

Computational prediction of maca miRNAs

A set of total of 811 mature Arabidopsis miRNAs (downloaded from miRbase 21) were BLASTn search against maca genome and sequences with exact match were chosen manually. It is well documented that during in silico miRNA prediction least number of allowed mismatches between putative miRNAs and known miRNAs produce more accurate results and that is why maca miRNAs which showed 0 mismatches with known Arabidopsis miRNAs were chosen in this study. The possible precursor (pre-miRNA) sequences of approximately 400-nt (200 nt upstream and 200 nt downstream to the BLAST hit region) were extracted and sequences coded for proteins were removed. Stable secondary structures of the remaining precursor sequences were predicted using mfold web server (http://unafold.rna.albany.edu/?q=mfold/mfold-references) following previously described filtering criteria (Zhang et al. 2008) as follows: (1) the secondary structure of the precursor sequences should have the stem‐loop structure that contains a mature miRNA sequence within one arm and no loop or break in the mature miRNA sequences; (2) the potential miRNA sequence should not be located on the terminal loop of the hairpin structure; (3) mature miRNAs should have fewer than nine mismatches with the opposite miRNA* sequence (Yang et al. 2010); and (4) the predicted stem‐loop candidates should have higher MFEIs and negative minimum folding free energies. The formula for calculating MFEI is as follows:

MFEI=(MFE/lengthofRNAsequence)×100%GCcontent

Analysis of miRNA expression

For the experimental validation of some predicted maca miRNAs such as lme-miR160a, lme-miR164c, lme-miR 166a, and lme-miR 319a by RT-PCR (reverse transcription), small RNA was first isolated from maca leaves using mir Premier microRNA Isolation Kit (Sigma-Aldrich). 1 µg of aforesaid maca small RNA was polyadenylated (using modified oligo dT primer) and reverse transcribed at 37 °C for 1 h in 10 µl reaction mixture using Mir-X miRNA First-Strand Synthesis kit (Clontech). The obtained cDNA was then amplified by GeneAmp PCR system 2400 (Perkin Elmer) using entire predicted miRNA sequence as sense primer and adapter-specific mRQ 3′ primer provided with Mir-X miRNA qRT-PCR SYBR kit (Clontech) as antisense primer. 100 ng cDNA was used as template for the PCR. The PCR was programed as follows: initial denaturation at 95 °C for 3 min, followed by 35 cycles of denaturation at 94 °C for 30 s, annealing at 60 °C for 30 s, extension at 72 °C for 25 s, and a final elongation step at 72 °C for 7 min. The resulting PCR products (~70 bp) were checked in 2% agarose gel with EtBr staining.

Prediction of miRNA targets and their functional annotation

The Plant Small RNA Target Analysis Server (psRNATarget) was used in this study to predict maca miRNA targets (http://plantgrn.noble.org/psRNATarget/). Due to non-availability of maca protein database in psRNATarget server target transcript search was performed against protein database of Arabidopsis thaliana. The following parameters were employed in prediction of miRNA targets in maca: (a) maximum exception of 3.0, length of complementarity score: 20. (b) Target accessibility—allowed maximum energy to unpair the target site (UPE): 25. (c) Flanking length around the target accessibility analysis: 17 bp upstream and 13 bp downstream. (d) Range of central mismatch leading to translation inhibition: 9–11 nt.

Gene ontology analysis of the identified target transcript was executed by AmiGo (http://amigo.geneontology.org/amigo) and three important components such as biological process, cellular component, and molecular function associated with each GO term were inferred.

Results and discussion

Characterization of maca miRNAs

With high stringent filtering approach, a total of 62 potential conserved miRNAs belonging to 28 families were identified in maca (Table 1). Among them, 28 miRNAs (~45%) were located in 5′ arm of the precursor while 34 (~55%) located in 3′ arm suggesting that maca miRNAs are located in both the arms of the precursor void any preference. Precursors of maca miRNAs also showed great variability in their size ranging from 76 to 227 with an average of 117 ± 33 (Table 1) which represent good agreement with those reported for other plant species such as soybean, cotton, and maize (Zhang et al. 2008; Wang et al. 2011, 2012). lme-miR 2111b-3p showed the shortest precursor length of 76 nt while vra lme-miR 169a showed the longest one of 227 nt. The MFEI is a useful criterion for distinguishing miRNAs from other types of coding or non-coding RNAs. In this study, the identified precursors have higher MFEI values (0.73–1.43) with an average of 1.00 ± 14.0 which is much higher than that of tRNAs (0.64), rRNAs (0.59), or mRNAs (0.62–0.66), respectively (Zhang et al. 2006). The secondary structure of the precursors with higher MFEI values is presented in Fig. 1 (Top 20). Previous reports suggested that uracil at the first position of the sequence of miRNA play an important role in miRNA-mediated regulations in plant (Zhang et al. 2008). In this study, uracil was observed to be predominant at the first position of ~60% mature miRNA sequences.

Table 1.

Potential conserved miRNAs in maca

Identified miRNAs LM (nt) miRNA sequences Input sequence Strand Location LP (nt) MFEs (ΔG) MFEI
lme-miR156a 20 UGACAGAAGAGAGUGAGCAC scaffold675 +/+ 5′ 91 −44.30 1.05
lme-miR156a-3p 22 GCUCACUGCUCUUUCUGUCAGA scaffold568 +/+ 3′ 128 −47.90 0.87
lme-miR156b-3p 23 UGCUCACCUCUCUUUCUGUCAGU scaffold236 +/+ 3′ 101 −45.50 0.97
lme-miR156c-3p 22 GCUCACUGCUCUAUCUGUCAGA scaffold675 +/+ 3′ 86 −43.80 1.07
lme-miR157a 21 UUGACAGAAGAUAGAGAGCAC scaffold344 +/+ 5′ 131 −49.40 1.01
lme-miR157a-3p 21 GCUCUCUAGCCUUCUGUCAUC scaffold78 +/+ 3′ 86 −44.40 1.35
lme-miR157c-3p 21 GCUCUCUAUACUUCUGUCACC scaffold344 +/+ 3′ 151 −54.90 0.96
lme-miR159c 21 UUUGGAUUGAAGGGAGCUCCU scaffold613 +/− 3′ 201 −66.60 0.89
lme-miR160a 21 UGCCUGGCUCCCUGUAUGCCA scaffold249 +/+ 5′ 81 −45.70 1.04
lme-miR160a-3p 21 GCGUAUGAGGAGCCAUGCAUA scaffold249 +/+ 3′ 96 −48.70 0.99
lme-miR160c-3p 21 CGUACAAGGAGUCAAGCAUGA scaffold468 +/− 3′ 90 −40.30 1.03
lme-miR161.2 21 UCAAUGCAUUGAAAGUGACUA scaffold216 +/+ 5′ 102 −40.20 0.91
lme-miR162a 22 UGGAGGCAGCGGUUCAUCGAUC scaffold1363 +/+ 5′ 116 −37.20 0.77
lme-miR162a-3p 21 UCGAUAAACCUCUGCAUCCAG scaffold1363 +/+ 3′ 131 −44.30 0.76
lme-miR164a 21 UGGAGAAGCAGGGCACGUGCA scaffold668 +/− 5′ 126 −45.20 0.92
lme-miR164c 21 UGGAGAAGCAGGGCACGUGCG scaffold369 +/+ 5′ 83 −38.90 0.97
lme-miR165a 22 UGGAGGCAGCGGUUCAUCGAUC scaffold1363 +/+ 5′ 117 −41.90 0.86
lme-miR165a-3p 21 UCGGACCAGGCUUCAUCCCCC scaffold830 +/+ 3′ 125 −45.40 1.05
lme-miR166a 21 GGACUGUUGUCUGGCUCGAGG scaffold316 +/+ 5′ 151 −64.30 1.07
lme-miR166a-3p 21 UCGGACCAGGCUUCAUUCCCC scaffold774 +/+ 3′ 92 −32.30 0.73
lme-miR167a 21 UGAAGCUGCCAGCAUGAUCUA scaffold785 +/+ 5′ 97 −50.70 1.24
lme-miR167c 21 UAAGCUGCCAGCAUGAUCUUG scaffold695 +/− 5′ 146 −68.00 1.26
lme-miR 168a 21 UCGCUUGGUGCAGGUCGGGAA scaffold468 +/− 5′ 101 −46.60 0.91
lme-miR 168a-3p 21 CCCGCCUUGCAUCAACUGAAU scaffold369 +/+ 3′ 101 −47.40 0.89
lme-miR 169a 21 CAGCCAAGGAUGACUUGCCGA scaffold191 +/+ 5′ 227 −67.80 1.09
lme-miR 169b 21 CAGCCAAGGAUGACUUGCCGG scaffold872 +/+ 5′ 216 −59.50 0.94
lme-miR 169d 21 UGAGCCAAGGAUGACUUGCCG scaffold792 +/+ 5′ 121 −45.90 0.90
lme-miR 169 h 21 UAGCCAAGGAUGACUUGCCUG scaffold1032 +/+ 5′ 131 −43.30 0.92
lme-miR 169b-3p 22 GGCAAGUUGUCCUUCGGCUACA scaffold467 +/+ 3′ 112 −58.60 1.43
lme-miR miR170 21 UAUUGGCCUGGUUCACUCAGA scaffold1132 +/+ 5′ 83 −33.60 0.96
lme-miR 170-3p 21 UGAUUGAGCCGUGUCAAUAUC scaffold1132 +/− 3′ 81 −27.40 0.78
lme-miR 171b 21 AGAUAUUAGUGCGGUUCAAUC scaffold490 +/− 5′ 91 −36.80 0.99
lme-miR 171a-3p 21 UGAUUGAGCCGCGCCAAUAUC scaffold299 +/+ 3′ 85 −33.60 0.93
lme-miR 171b-3p 21 UUGAGCCGUGCCAAUAUCACG scaffold433 +/+ 3′ 96 −40.30 1.01
lme-miR 172a 21 AGAAUCUUGAUGAUGCUGCAU scaffold981 +/+ 3′ 105 −35.90 1.12
lme-miR 172c 21 AGAAUCUUGAUGAUGCUGCAG scaffold997 +/+ 3′ 106 −40.70 1.13
lme-miR 319a 21 UUGGACUGAAGGGAGCUCCCU scaffold1047 +/+ 3′ 181 −76.20 1.14
lme-miR 319c 21 UUGGACUGAAGGGAGCUCCUU scaffold488 +/− 3′ 173 −69.60 0.98
lme-miR 390a 21 AAGCUCAGGAGGGAUAGCGCC scaffold237 +/+ 5′ 91 −43.40 1.11
lme-miR 391 21 UUCGCAGGAGAGAUAGCGCCA scaffold432 +/+ 5′ 82 −34.80 0.87
lme-miR 391-3p 21 ACGGUAUCUCUCCUACGUAGC scaffold432 +/+ 3′ 87 −36.30 0.84
lme-miR 393a 22 UCCAAAGGGAUCGCAUUGAUCC scaffold997 +/+ 5′ 156 −53.90 1.00
lme-miR 393b-3p 21 AUCAUGCGAUCUCUUUGGAUU scaffold997 +/+ 3′ 141 −50.90 1.04
lme-miR 394a 20 UUGGCAUUCUGUCCACCUCC scaffold420 +/+ 5′ 126 −47.00 0.85
lme-miR 394b-3p 21 AGGUGGGCAUACUGCCAAUAG scaffold356 +/+ 3′ 111 −48.70 1.08
lme-miR 395a 21 CUGAAGUGUUUGGGGGAACUC scaffold904 +/− 3′ 92 −44.30 1.10
lme-miR 395b 21 CUGAAGUGUUUGGGGGGACUC scaffold904 +/+ 3′ 106 −35.90 1.00
lme-miR 396a 21 UUCCACAGCUUUCUUGAACUG scaffold339 +/− 5′ 106 −34.50 0.88
lme-miR 396b 21 UUCCACAGCUUUCUUGAACUU scaffold127 +/+ 5′ 132 −43.70 1.15
lme-miR 396a-3p 21 GUUCAAUAAAGCUGUGGGAAG scaffold306 +/+ 3′ 117 −41.30 0.96
lme-miR 396b-3p 21 GCUCAAGAAAGCUGUGGGAAA scaffold127 +/+ 3′ 156 −55.50 1.13
lme-miR 397a 21 UCAUUGAGUGCAGCGUUGAUG scaffold299 +/− 5′ 96 −26.80 0.96
lme-miR 398a-3p 21 UGUGUUCUCAGGUCACCCCUU scaffold302 +/+ 3′ 101 −42.90 1.13
lme-miR 398b-3p 21 UGUGUUCUCAGGUCACCCCUG scaffold534 +/− 3′ 115 −42.80 0.82
lme-miR 399a 21 UGCCAAAGGAGAUUUGCCCUG scaffold904 +/− 3′ 126 −41.60 0.97
lme-miR 399b 21 UGCCAAAGGAGAGUUGCCCUG scaffold971 +/− 3′ 146 −51.80 1.01
lme-miR 399c-3p 21 UGCCAAAGGAGAGUUGCCCUG scaffold971 +/− 3′ 141 −51.20 1.04
lme-miR 408 21 ACAGGGAACAAGCAGAGCAUG scaffold613 +/+ 5′ 96 −39.50 0.90
lme-miR 408-3p 21 AUGCACUGCCUCUUCCCUGGC scaffold613 +/− 3′ 101 −39.60 0.84
lme-miR 828 22 UCUUGCUUAAAUGAGUAUUCCA scaffold236 +/+ 5′ 101 −35.80 1.02
lme-miR 2111a 21 UAAUCUGCAUCCUGAGGUUUA scaffold668 +/+ 5′ 101 −38.30 1.18
lme-miR 2111b-3p 21 AUCCUCGGGAUACAGUUUACC scaffold602 +/+ 3′ 76 −29.90 1.11

LM length of mature miRNAs, LP length of precursor

Fig. 1.

Fig. 1

Secondary structure (stem-loop) of the maca miRNA precursors with higher MFEI values (Top 20). Respective miRNAs are represented with red font

Experimental validation of putative maca miRNAs

The efficiency of the computational strategy was further verified by RT-PCR based experimental procedure. The randomly selected four miRNAs lme-miR160a, lme-miR164c, lme-miR 166a, and lme-miR 319a from maca were subjected to validation studies. All these maca miRNAs showed confirmation through experimental validation (Fig. 2).

Fig. 2.

Fig. 2

Validation of some maca miRNAs by RT-PCR. The resulting PCR products are checked in 2% agarose gel with EtBr staining. a Negative control, b lme-miR160a, c lme-miR164c, d lme-miR 166a and e lme-miR 319a

Potential targets of putative maca miRNAs and their function

A total of 99 potential targets were identified and most of them were functionally categorized as transcription factors. Important transcription factors targeted by maca miRNAs include Squamosa promoter-binding protein/SPB (miR156/157), Auxin-responsive factor (miR160), Cytochrome P-450 (miR162), NAM protein (miR164), Class III HD-Zip (miR165/166), MYB (miR172/319), F-box protein (miR394/399) (Table 2). These transcription factors are known to play a role in metabolic processes and stress response signaling in plants. Moreover, to improve the efficient understanding of miRNA regulation in maca, gene ontology analysis of the identified target transcript was executed by AmiGo (http://amigo.geneontology.org/amigo), and high involvement of the target transcripts in the biological, molecular, and cellular process was observed (Fig. 3).

Table 2.

Potential targets of identified maca miRNAs

miRNA Targeted proteins (number)
156/157 Squamosa promoter-binding-like protein (24)
159 MYB (4)
Pectin acetylesterase (1)
Pyruvate orthophosphate dikinase (5)
160 Auxin response factor (4)
162 Cytochrome P450-like protein (1)
164 CUP-SHAPED COTYLEDON/CUC (3)
NAM protein-like (6)
165 HD-Zip protein (2)
166 HD-Zip protein (2)
168 Glutathione transferase (1)
171 Scarecrow-like protein (2)
Protein kinase (2)
172 APETALA 2 (8)
MYB (2)
319 MYB (3)
390 Protein kinase (1)
Glutamate dehydrogenase (1)
391 Protein kinase (2)
393 WRKY transcription factor (1)
394 F-box only protein (1)
Lipase-like protein (1)
Loricrin-like protein (1)
395 ATP sulfurylase (9)
Transcription factor bZIP (2)
397 Laccase precursor (3)
399 F-box protein (1)
Cytochrome P450-like protein (1)
408 Ethylene-responsive transcription factor (1)
828 Kinesin 2 (2)
2111 Flavanone 3-hydroxylase-like protein (2)

Fig. 3.

Fig. 3

GO analysis of target transcripts regulated by identified miRNAs: a biological process, b molecular function and c cellular component

Surrounding environment is the key factor for proper growth and development of plants. Stress-sensitive plants often show limited growth during environmental stresses while stress-tolerant plants employ several complex defense mechanisms including miRNA-mediated post-transcriptional gene silencing (Sunkar et al. 2007). Although few discrete studies have been performed to check the alterations of miRNAs during cold and irradiance stresses in tolerant plants, the exact molecular mechanism is still unclear. Zhang et al. (2014) reported that during cold stress 31 miRNAs were up-regulated and 43 were down-regulated in cold tolerant tea variety ‘Yingshuang’ while 46 miRNAs were up-regulated and 45 down-regulated in sensitive variety ‘Baiye 1’. Casadevall et al. (2013) showed that up-regulation of miR396 enhances survival of Arabidopsis thaliana under UV-B radiation. Nevertheless, regulation of plant miRNAs at high-altitude environment (combined effect of extreme cold, strong wind, and oxidizing air pollutants) has been poorly studied and hence maca could provide new insights into the understanding of stress-responsive miRNAs at higher altitude. On the other hand, few workers also reported that miRNAs can influence the production of bioactive compounds/secondary metabolites in the medicinal plants (Robert-Seilaniantz et al. 2011; Singh et al. 2016). Nonetheless, identification of miRNAs and their targets is the key step to initiate a miRNA-related study in a plant. This study can be of immensely helpful for future research on miRNA-mediated stress response signaling as well as the production of bioactive compounds/secondary metabolites in medicinal plants.

Conclusion

In this study a total of 62 conserved miRNAs belonging to 28 families were first time identified in a high-altitude plant such as maca. To validate the expression of potential miRNAs in maca, a RT-PCR approach was performed and 4 miRNA families were detected. Moreover, a total of 63 potential targets were predicted and they were found to be involved in development, metabolism and stress responses.

Acknowledgements

Author is thankful to Prof. Amita Pal, Bose Institute for valuable guidance and help.

Abbreviations

miRNA

MicroRNA

MFE

Minimum folding free energy

MFEI

Minimum folding free energy index

Compliance with ethical standards

Conflict of interest

The author declares that he has no conflict of interest.

References

  1. Casadevall R, Rodriguez RE, Debernardi JM, et al. Repression of growth regulating factors by the microRNA396 inhibits cell proliferation by UV-B radiation in Arabidopsis leaves. Plant Cell. 2013;25:3570–3583. doi: 10.1105/tpc.113.117473. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Fukudome A, Fukuhara T. Plant dicer-like proteins: double-stranded RNA-cleaving enzymes for small RNA biogenesis. J Plant Res. 2017;130:33–34. doi: 10.1007/s10265-016-0877-1. [DOI] [PubMed] [Google Scholar]
  3. Huang Y, Cheng J, Luo F, et al. Genome-wide identification and characterization of microRNA genes and their targets in large yellow croaker (Larimichthys crocea) Gene. 2016;576:261–267. doi: 10.1016/j.gene.2015.10.044. [DOI] [PubMed] [Google Scholar]
  4. Khraiwesh B, Zhu J-K, Zhu J. Role of miRNAs and siRNAs in biotic and abiotic stress responses of plants. Biochim Biophys Acta Gene Regul Mech. 2012;1819:137–148. doi: 10.1016/j.bbagrm.2011.05.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Kundu A, Paul S, Dey A, Pal A. High throughput sequencing reveals modulation of microRNAs in Vigna mungo upon Mungbean Yellow Mosaic India Virus inoculation highlighting stress regulation. Plant Sci. 2017;257:96–105. doi: 10.1016/j.plantsci.2017.01.016. [DOI] [PubMed] [Google Scholar]
  6. Naya L, Paul S, Valdés-López O, et al. Regulation of copper homeostasis and biotic interactions by microRNA 398b in common bean. PLoS One. 2014 doi: 10.1371/journal.pone.0084416. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Paul S, Kundu A, Pal A. Identification and validation of conserved microRNAs along with their differential expression in roots of Vigna unguiculata grown under salt stress. Plant Cell Tissue Organ Cult. 2011;105:233–242. doi: 10.1007/s11240-010-9857-7. [DOI] [Google Scholar]
  8. Piacente S, Carbone V, Plaza A, et al. Investigation of the tuber constituents of maca (Lepidium meyenii Walp) J Agric Food Chem. 2002;50:5621–5625. doi: 10.1021/jf020280x. [DOI] [PubMed] [Google Scholar]
  9. Robert-Seilaniantz A, MacLean D, Jikumaru Y, et al. The microRNA miR393 re-directs secondary metabolite biosynthesis away from camalexin and towards glucosinolates. Plant J. 2011;67:218–231. doi: 10.1111/j.1365-313X.2011.04591.x. [DOI] [PubMed] [Google Scholar]
  10. Shin B-C, Lee MS, Yang EJ, et al. Maca (L. meyenii) for improving sexual function: a systematic review. BMC Complement Alt Med. 2010;10:44. doi: 10.1186/1472-6882-10-44. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Singh N, Srivastava S, Sharma A. Identification and analysis of miRNAs and their targets in ginger using bioinformatics approach. Gene. 2016;575:570–576. doi: 10.1016/j.gene.2015.09.036. [DOI] [PubMed] [Google Scholar]
  12. Sunkar R, Chinnusamy V, Zhu J, Zhu JK. Small RNAs as big players in plant abiotic stress responses and nutrient deprivation. Trends Plant Sci. 2007;12:301–309. doi: 10.1016/j.tplants.2007.05.001. [DOI] [PubMed] [Google Scholar]
  13. Wang L, Liu H, Li D, Chen H. Identification and characterization of maize microRNAs involved in the very early stage of seed germination. BMC Gen. 2011;12:154. doi: 10.1186/1471-2164-12-154. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Wang M, Wang Q, Wang B. Identification and characterization of microRNAs in asiatic cotton (Gossypium arboreum L.) PLoS One. 2012 doi: 10.1371/journal.pone.0033696. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Yang W, Liu X, Zhang J, et al. Prediction and validation of conservative microRNAs of Solanum tuberosum L. Mol Biol Rep. 2010;37:3081–3087. doi: 10.1007/s11033-009-9881-z. [DOI] [PubMed] [Google Scholar]
  16. Zhang B, Pan X, Cobb GP, Anderson TA. Plant microRNA: a small regulatory molecule with big impact. Dev Biol. 2006;289:3–16. doi: 10.1016/j.ydbio.2005.10.036. [DOI] [PubMed] [Google Scholar]
  17. Zhang B, Pan X, Stellwag EJ. Identification of soybean microRNAs and their targets. Planta. 2008;229:161–182. doi: 10.1007/s00425-008-0818-x. [DOI] [PubMed] [Google Scholar]
  18. Zhang Y, Zhu X, Chen X, et al. Identification and characterization of cold-responsive microRNAs in tea plant (Camellia sinensis) and their targets using high-throughput sequencing and degradome analysis. BMC Plant Biol. 2014;14:271. doi: 10.1186/s12870-014-0271-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Zhang J, Tian Y, Yan L, et al. Genome of plant maca (Lepidium meyenii) illuminates genomic basis for high-altitude adaptation in the central Andes. Mol Plant. 2016;9:1066–1077. doi: 10.1016/j.molp.2016.04.016. [DOI] [PubMed] [Google Scholar]

Articles from 3 Biotech are provided here courtesy of Springer

RESOURCES