Skip to main content
PLOS One logoLink to PLOS One
. 2017 Jun 1;12(6):e0178628. doi: 10.1371/journal.pone.0178628

Aspects of the ecology of phlebotomine sand flies (Diptera: Psychodidae) in the Private Natural Heritage Reserve Sanctuary Caraça

Gabriel Barbosa Tonelli 1, Aline Tanure 1, Felipe Dutra Rêgo 1, Gustavo Mayr de Lima Carvalho 1, Taynãna César Simões 2, José Dilermando Andrade Filho 1,*
Editor: Gautam Chaudhuri3
PMCID: PMC5453570  PMID: 28570640

Abstract

Leishmaniases are a set of parasitic diseases of zoonotic origin that are transmitted by sandfly vectors in wild, rural and urban environments. Their distribution is dependent not only the distribution of vectors, but also on the distribution of mammalian reservoirs. Only by understanding the transmission cycle of these diseases, such as knowing the participating vectors and reservoirs, can one can understand the epidemiology and ecological relationships of leishmaniases. Ecotourism has become an important area of economic growth in Brazil. One of the most visited tourist attractions in the state of Minas Gerais, the Reserva Particular do Patrimônio Natural Santuário do Caraça (RPPNSC) is located in the Quadrilátero Ferrífero. The aim of this study was to contribute to the control of leishmaniasis among tourists of the RPPNPC by surveying its sand fly fauna and testing for the presence of Leishmania DNA in females. Twenty-five CDC light traps were exposed on 7 trails of the RPPNPC where samples were collected bimonthly for a year, starting in June 2013. A total of 376 specimens of 18 species and 10 genera of sandflies were captured. The predominant species were Psychodopygus lloydi (72.34%) and Pintomyia monticola (5.59%). HaeIII restriction enzyme detected and characterized Leishmania braziliensis DNA in 2 of the samples for an infection rate of 0.7% (2/266). Recent studies found specimens of Ps. lloyd infected with Leishmania braziliensis elsewhere in Minas Gerais, which may be an indication that this species is involved in the transmission of Leishmania in this state.

Introduction

Leishmaniases occur in about 100 countries in subtropical or tropical climates, and in anthroponotic and zoonotic cycles [1,2,3].

Leishmaniases are caused by 21 species of Leishmania and their epidemiology is known to involve several species of mammals, which act as reservoirs, and various species of sand flies, which act as vectors, of these protozoa, and so they are considered the most complex set of diseases transmitted by vectors [4,5,6]. The epidemiology of leishmaniases are only understood through knowledge of the links that make up their transmission cycle, such as the vectors and reservoirs involved and their ecological relationships [7]. Lutzomyia longipalpis (Lutz & Neiva, 1912), the main vector of Leishmania infantum in Brazil [8,9,10] is closely associated with birds and several species of domestic and synanthropic mammals, including humans who act as hosts and reservoirs. Other species, such as Nyssomyia intermedia (Lutz & Neiva, 1912) and Nyssomyia whitmani (Antunes & Coutinho, 1939) are important insect vector of Leishmania braziliensis, the etiological agent of cutaneous leishmaniasis (CL) in southeastern of Brazil. These three species of sand flies show a considerable degree of adaptation to altered environments and anthropophilic behavior regarding their food [11,12,13,14,15,16]. Other species of sand flies have been suspected of being vectors of Leishmania, for example, Nyssomyia neivai Pinto, 1926; Evandromyia sallesi Galvão & Coutinho, 1939; and Psychodopygus lloydi Antunes, 1937 [15].

The region of the Reserva Particular do Patrimônio Natural Santuário do Caraça (hereafter RPPNSC or Caraça Sanctuary) has experienced environmental pressure from neighboring municipalities where there have been autochthonous cases of human and canine leishmaniasis. The heavy movement of people and animals facilitates contact between vector and reservoir, and vector and humans, which could result in an increase in the incidence of infection and the consequent increase in the number of cases of disease. Caraça Sanctuary receives an average of 60,000 visitors per year, of which at least 17,500 are guests in their facilities, making it one of the most important and most visited Conservation Units in the state of Minas Gerais [17].

This paper aims to describe the patterns of species richness and diversity of sandflies among areas of Caraça Sanctuary and to investigate their seasonal variation. It also aims to assess the presence of Leishmania DNA among these insects.

Materials and methods

Study area

Caraça Sanctuary is located in the municipalities of Santa Barbara, Barão de Cocais and Catas Altas (Fig 1), in the state of Minas Gerais, Brazil (20°0′51″ S, 43°29′28″ W). It encompasses an area of 10,187.89 hectares with a maximum altitude of 2,072 meters above the sea level at “Pico do Sol” [17].

Fig 1. Location of the RPPN Santuário do Caraça on the state of Minas Gerais, Brazil and distribution of sample sites among the RPPN area.

Fig 1

Black dots represents the sample sites and the black cross it’s the location of the head office of the RPPN.

Caraça Sanctuary is situated on the slopes of the “Serra do Espinhaço”, mountain range and possesses a variety of floras including semideciduous forests (Atlantic Forest), savannah (Cerrado), and open areas such as high-altitude and rocky (rupestrian) fields. The annual minimum and maximum temperatures are 7°C and 30°C, respectively, although on rare occasions it gets below 0°C [18].

Collection of sand flies

All the collection was carried out in accordance with the Permanent License to Collect Zoologic Materials n° 15237–2 of Ministério do Meio Ambiente–MMA (File 1).

We used 25 CDC light traps distributed among seven trails in the RPPNSC. Trails 1 and 2 were placed in forested areas; trails 3 and 4 in rupestrian fields (ecotope of Cerrado biome) and in one cave; trails 5 and 6 in peridomestic and intradomestic areas (house provided for researchers); and trail 7 in the peridomicile area of the hotel (Fig 2). Bimonthly systematic sampling was performed between June 2013 and June 2014. The temperature and relative humidity were measured during the weeks of trapping with the aid of an analog thermometer.

Fig 2. Sand fly sample sites and location site where DNA of Le. braziliensis was detected by PCR CYTb in two specimens of Ps. lloydi on the RPPN Santuário do Caraça.

Fig 2

The red border in the yellow dot represents the location where the specimens of Ps. lloydi sand flies where detected with Le. braziliensis DNA.

Sand flies were stored in labeled tubes containing 70% alcohol for subsequent analysis and identification. In the lab, males were mounted in Berlese liquid for species identification while females, which were identified by the structure of the cibarium and presence of spermathecae, were dissected for subsequent molecular analysis. The classification used was that proposed by Galati [19]. Voucher species were deposited in the “Coleção de Flebotomíneosb do Centro de Pesquisas René Rachou/Fiocruz (FIOCRUZ-COLFLEB” (Anexo 2).

Dna extraction and Leishmania identification

DNA extraction was performed for individual female sand flies using Genra Puregene Kit (Qiagen, USA) following the manufacturer's protocol.

The extracted DNA was subjected to molecular analysis for the 300–350 bp amplification fragment of the intergenic region of Leishmania DNA (Internal Transcribed Spacer q—ITS1) using the primers LITSR: 5´ CTGGATCATTTTCCGATG 3´ and L5.8S: 5´ TGATACCACTTATCGCACTT 3.

DNA extracted from the strains of Leishmania amazonensis (IFLA/BR/67/PH8), Le. braziliensis (MHOM/BR/75/M2903), Le. infantum (MHOM/BR/74/PP75) and Le. guyanensis (MHOM/BR/75/M4147) were used as positive controls for the PCR. The amplified product was subjected to electrophoresis in a 2% agarose gel, which was then stained with ethidium bromide (7mg / mL) with molecular weight of 100pb.

For identification of Leishmania species, the amplified product of PCR ITS1 (10-15uL) was digested using HaeIII enzyme (10U / uL), according to the manufacturer's recommendations (New England Biolabs, Ipswich, MA, USA). The restriction patterns were analyzed on a 4% agarose gel stained with ethidium bromide (7mg / mL) in comparison with the reference strains of Leishmania mentioned above.

Statistical analysis

We use the index of species abundance (ISA) and, in sequence, the standardized index of species abundance [20] to assess species abundance in the study area. The values for SISA vary from 0 to 1, with 1 representing the highest abundance. To assess the diversity of species and the uniformity of abundance among collection sites we used the indices of Shannon (H) and Evenness (J) [21] respectively. To assess temporal variation and any association between the number of sandflies collected and climatic variables at RPPNSC between June 2013 and June 2014 we used generalized linear models (GLM) in which the probability distribution was the Binomial Negative, in order to consider the overdispersion of the number of sand flies. The offset term was the natural logarithm of the number of traps observed at each collection time. The temporal tendency was evaluated by a linear temporal term in the model. Descriptive analysis of the data was performed using Microsoft Excel (Office 2010). Statistical analyses were performed with the aid of the statistical software R (R Development Core Team, 2015).

Results

A total of 376 sand flies were collected, of which 300 were females and 76 males, representing 18 species of 10 genera. The most representative genera were Evandromyia and Psychodopygus, with four species each. The species with the highest prevalence was Psychodopygus lloydi (Antunes, 1937) (72.79%), followed by Brumptomyia troglodytes (Lutz, 1922) (5.25%), Nyssomyia whitmani (4.01%) and Pintomyia monticola (Costa Lima, 1932) (4.30%). The indices of Shannon (H) and Evenness (J) were low (H’ = 1.23; J’ = 0.43). According to the SISA, the most abundant species were Br. troglodytes (0.52) Ps. lloydi (0.39) and Mi. ferreirana (0.35), whereas the least abundant species were Ev. termitophila (0.03) and Lu. longipalpis (0.07). Except in Gruta da Bocaina, Ps. lloydi was captured among all trails. The most productive sampling points were Engenho (27.19%), Casa das Sampaias (24.27%) and Mata Cascatinha (24.27%) (Table 1).

Table 1. Sand Flies collected on RPPN Santuário do Caraça.

Trail 1 –Mata da Cascatinha, Trail 2 –Cascatinha, Trail 3 –Pedra da Paciência, Trail 4 –Gruta da Bocaina, Trail 5 –Casa dos Pesquisadores, Trail 6 –Casa das Sampaias, Trail 7 –Engenho.

Species/Trails 1 2 3 4 5 6 7 TOTAL %
  ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀ ♂ ♀  
Brumptomyia troglodytes 7 4 3 0 1 0 0 0 1 1 2 1 0 0 14 6 5,25%
Evandromyia evandroi 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0,27%
Evandromyia lenti 0 0 1 0 0 0 0 0 0 0 0 0 8 3 9 3 3,21%
Evandromyia termitophila 0 0 0 0 0 0 0 0 0 0 0 0 0 4 0 4 1,07%
Evandromyia tupynambai 0 2 0 0 0 0 0 0 0 0 0 1 0 0 0 3 0,80%
Lutzomyia ischyracanta 0 0 1 0 0 0 0 0 0 0 0 0 0 0 1 0 0,27%
Lutzomyia longipalpis 0 0 0 0 0 0 0 0 0 0 0 0 0 2 0 2 0,53%
Micropigomyia ferreirana 0 2 1 0 0 0 0 0 0 0 1 0 0 0 2 2 0,80%
Nyssomyia whitmani 0 0 0 0 2 1 2 4 1 0 0 0 1 5 6 10 4,01%
Pintomyia misionensis 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0,27%
Pintomyia monticola 6 4 0 1 0 0 0 0 0 0 0 0 0 5 6 10 4,30%
Psathyromyia pestanai 1 0 6 0 0 0 0 0 0 0 0 0 0 0 7 0 1,87%
Psychodopygus ayrozai 1 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0,27%
Psychodopygus carrerai 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0,27%
Psychodopygus lloydi 5 37 4 20 1 9 0 0 3 44 4 78 0 67 17 255 72,79%
Psychodopygus pascalei 9 3 0 0 0 0 0 0 0 0 1 0 0 0 10 3 3,48%
Sciopemyia sordellii 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0,27%
Trichopygomyia longispina 0 0 0 0 0 0 0 0 0 0 0 0 1 0 1 0 0,27%
TOTAL 82
(24,27%)
37
(9,36%)
14
(3,22%)
6
(1,75%)
50
(9,94%)
88
(24,27%)
99
(27,19%)
76 300  
                376  

The months with the greatest sampling success were August 2013 (12%), December 2013 (48%) and February 2014 (17%), whereas those with the least success were June 2013 (7%), October 2013 (2%) and April 2014 (5%). However, the model did not show significant variability in the linear temporal term, thus, the number of sand flies was considered constant over time (p-value = 0.862). Local temperatures demonstrated low values during the collection and the average of the coldest months 14.7°C on June 2013 and 13.23°C on October 2013 and the average of the hottest months was 20.75°C on December 2013 and 19.76°C on February 2014. The model showed a significant variation of 1.2 in the average number of sand flies with the increase of 1 degrees of Celsius in the temperature (p-value < 0.01). Monthly averages of relative humidity remained above 60%, with the highest being in December 2013 (84.38%), followed by February 2014 (79.8%), whereas those with the lowest were August 2013 (69.13%) and April 2014 (76.8%), so that variation was not significant (p-value = 0.460) (Fig 3).

Fig 3. Sazonality of Sand Flies caught in the RPPN Santuário do Caraça between June 2013 to July 2014.

Fig 3

The red line represents the variation of the relative humidity during the collection period and the blue line represents the variation of the temperature during the sampling period.

Two of the 300 samples analyzed had 300–350 bp fragments detected by PCR of DNA ITS1 extracted from sand flies, indicating a positive result for the presence Leishmania DNA. Species identification using PCR-RFLP indicated the profile of Le. braziliensis in both of the positive samples (Fig 4). Both samples were from individuals of Ps. lloydi.

Fig 4. Electrophoresis 4% agarose gel of the RFLP ITS1 of positive DNA samples of sand flies collected in RPPNSC.

Fig 4

MW = Molecular Weight, 19.3 and 19.7 = samples, CN = Negative Control, La, Lb, Lc and Lg = Positive Controls strains of Leishmania amazonensis, Le. braziliensis, Le. infantum and Le. guyanensis respectively.

Discussion

Leishmaniases have complex relationships with their vectors and reservoirs, and so their ecology makes understanding these diseases challenging. Several mammalian species with different behaviors can act as reservoirs, as is also true for sandfly vectors and vector competence [22,23]. Furthermore, different parasites use different defense mechanisms against the immune system of reservoirs and vectors, which favor infection [24].

It is important to point out that the municipalities surrounding the RPPNSC possess high densities of Lu. longipalis and Ny. Whitmani, such as has been found in Barão de Cocais and Catas Altas (unpublished data). Furthermore, surveys done in collaboration with the health departments of each municipality detected autochthonous cases of human and canine leishmaniasis at three sites, including human cases of visceral and cutaneous leishmaniasis and one death.

Despite there never having been a diagnosed case of leishmaniasis in RPPNSC, it is possible that it exerts pressure on nearby locations with regard to parasitic diseases that depend on vectors and reservoirs that are present in its extensive preserved forest and among the diversity of its fauna. Some mammalian species have been reported in the study area [18] that may have an important role in the maintenance of the Leishmania transmission cycle, since they can serve as reservoirs for this multi-reservoir parasite [25,26,7,27].

The sand fly species observed in this study comprise a fauna similar to that found in other studies carried out in nature reserves as well as in wild areas. The great diversity of species collected in these environments represent a different profile than that observed in urban areas [28,29,30].

In Ibitipoca State Park, a region with climatic and topographic characteristics similar to those of RPPNSC (high humidity, high altitudes and low temperatures), Carvalho [31] sampled some of the same species as the present study, including Ps. lloydi, Psychodopygus pascalei (Coutinho & Barretto, 1940), Pi. monticola, Evandromyia Lenti (Mangabeira, 1938) and Br. Troglodytes. These local climatic factors may explain the lower number of individuals collected in relation to other that found in other studies of sandfly faunas [32,33].

Some of species found in this study at RPPNSC have been incriminated as potential vectors of Leishmania, such as Lu. longipalpis and Ny. whitmani [34,35,36,37,38,39,4,40,41,42,43,44,45,46,47]. Others have been detected with Leishmania DNA, such as Evandromyia Lenti, Evandromyia termitophila (Martins, Falcão & Silva, 1964), Micropygomyia ferreirana (Barreto, Martin & Pellegrino, 1956) and Ps. Lloydi [48,49,50,51,52,36,53,54,55,56,57], which may suggest they play a role in maintaining the parasite transmission cycle in wild environments.

The most abundant species captured in the present study was Ps. lloydi, which possesses a wide geographical distribution that encompasses the states of Minas Gerais, Maranhão, Paraná, Rio de Janeiro and São Paulo [58,59,60]. According to Santos [59], most species of the genus Psychondopygus occur only in wild habitats, and Rangel & Lainson [61], explain that some species of the genus are important in the transmission of cutaneous leishmaniasis, such as Psychodopygus wellcomei (Fraiha, Shaw & Lainson 1971), complex Psychodopygus (Mangabeira, 1941), Psychodopygus paraensis (Costa Lima, 1941) and Psychodopygus ayrozai (Barretto & Coutinho, 1940).

Two approaches have been used to diagnose Leishmania infection of, or the presence of Leishmania DNA in, vectors. The traditional gold standard for diagnosing this disease has been the dissection of female sand flies. This technique has the advantage of permitting the observation of the parasites flagella and its shape and position in the insect's digestive tract, however, skilled labor is necessary and yet it is still time consuming, with a lot of specimens needing to be analyzed in order to obtain meaningful data (as discussed by Brazil and Brazil [62]. Moreover, this method does not permit the identification to genus and species, which requires isolation or molecular analysis of the parasite for identification, because trypanosomatides other than Leishmania may be found in sandflies [63,64,65,66].

The second approach for diagnosis of infection or DNA detection is the use of molecular techniques, such as PCR, with different targets because it is very sensitive and highly specific, which is important with Leishmania because the infection rate of vectors is relatively low [67]. Some targets used to analyze infection in sandflies are kDNA-PCR [68], Real Time PCR [69] and ITS1 [54].

In our study, two females of the species Ps. lloydi tested positive for DNA of Le. braziliensis ITS1 by RFLP-PCR, for an infection rate of 0.6% (2/300). These two specimens were captured in December 2013. This species was also found infected by Quaresma [54], who suggests that it may play a role as a vector in the sylvatic cycle of Le. braziliensis in this environment since this is the most abundant species found in the work and it was captured in every month of sampling. The species Ps. lloydi and Pintomyia monticola (Costa Lima, 1932) were the most abundant species in a collection carried out with Shannon traps (unpublished data), which reinforces the epidemiological importance of these species in relation to maintaining the sylvatic cycle of Le. braziliensis.

It is useful to highlight the importance of additional data since this species can feed on several mammals (rodents / marsupials) [54], which have been found to play important roles as hosts / Leishmania reservoirs in other studies [27,70,71]. The mammal fauna of Caraça Sanctuary is considered to be diverse [18], and so several species could act as reservoirs and parasite hosts and maintaining the sylvatic cycL.

Both sand flies infected with Le. braziliensis DNA were captured on the trail of the Casa das Sampaias, a place with a high frequency of tourist visits. In environments where vectors are found that may have anthropophilic behavior, potential reservoirs and etiological agents are deserving of special attention in relation to risk of ACL transmission. In the case of RPPNSC, which receives many visitors from various locations around the world each year, the possibility exists that leishmaniasis could migrate through travelers, an issue already mentioned by Antinori et al [72] and of increasing concern to travelers visiting environments where there is a focus.

Based on the criteria for incriminating a vector of Killick-Kendrick & Ward [23], which consider the distribution of the analyzed species and its abundance in the place of study are important. The months of December to February at Caraça Sanctuary exhibited climatic conditions with high temperature and humidity, and are also the months in which we observed higher abundances of sand flies. This illustrates the direct relationship between temperature and the number of captured sandflies, as seen in Fig 1, since every 1°C increase the average of individuals caught per trap according to temporal analysis negative binomial. The individual sandflies of Ps. lloydi that tested positive in the ITS PCR—RFLP were captured on December 2013, based on it’s local abundance and distribution, suggesting that this period may be wild infection and that this time occurs cycle maintain on this environment making this period of most epidemiological attention regarding the transmission of leishmaniasis in place.

The data here, combined with vector control efforts, can strengthen the sandfly management plan of Santuário do Caraça. Studies of infection in local mammals, and other fauna, are of great importance for determining hosts / reservoirs and understanding Leishmania circulation.

Supporting information

S1 File. Permanent License to Collect Zoologic Materials n° 15237–2 of Ministério do Meio Ambiente–MMA.

(PDF)

Acknowledgments

We would like to thank all collaborators for their work and also to those responsible for RPPN Santuário do Caraça as well as their employees and friends won for giving us support. We thank Fundação de Amparo a Pesquisa do Estado de Minas Gerais/FAPEMIG (RDP-00149-10 and PPM-00438-14) and Conselho Nacional de Desenvolvimento Científico e Tecnológico/CNPq (301421/2013-7) for the awarded grant.

Data Availability

All relevant data are within the paper and its Supporting Information files.

Funding Statement

Fundação de Amparo a Pesquisa do Estado de Minas Gerais/FAPEMIG (RDP-00149-10 and PPM-00438-14). Conselho Nacional de Desenvolvimento Científico e Tecnológico/CNPq (301421/2013-7).

References

  • 1.Ashford R. The leishmaniases as emerging and reemerging zoonoses. Int J Parasitol. 2000;30: 1269–1281. [DOI] [PubMed] [Google Scholar]
  • 2.Cattand P, Desjeux P, Guzmán MG, Jannin J, Kroeger A, Medici A, et al. Tropical Diseases Lacking Adequate Control Measures: Dengue, Leishmaniasis, and African Trypanosomiasis [Internet]. Disease Control Priorities in Developing Countries. 2006. Available: http://www.ncbi.nlm.nih.gov/pubmed/21250331 [PubMed]
  • 3.Lainson R, Shaw JJ. Evolution, classification and geographical distribution In the leishmaniasis. London, Peters W. & Killick Kendrick R; V.1, p.1–128, 1987. [Google Scholar]
  • 4.Lainson R, Shaw JJ. The role of animals in the epidemiology of South American leishmaniasis In Biology of the Kinetoplastida. W. H. R. Lumsden and D. A. Evans (Editors). London and New York: Academic Press; 1979; 2: 1–116. [Google Scholar]
  • 5.Ashford D. A., David J. R., Freire M., David R., Sherlock I., Eulalio M. C., et al. Studies on control of visceral leishmaniasis: impact of dog control on canine and human visceral leishmaniasis in Jacobina, Bahia, Brazil. Am J Trop Med Hyg. 1998; 59: 53–57. [DOI] [PubMed] [Google Scholar]
  • 6.Ashford R. The leishmaniases as emerging and reemerging zoonoses. Int J Par asitol. 2000; 30: 1269–1281. [DOI] [PubMed] [Google Scholar]
  • 7.Ferreira EC, Cruz I, Cañavate C, Melo LA, Pereira AAS, Madeira FAM, et al. Mixed infection of Leishmania infantum and Leishmania braziliensis in rodents from endemic urban area of the New World. BMC Veterinary Research, 2015; 11: 1–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Cunha AM, Chagas E. Nova espécie de protozoário do gênero Leishmania patogênico para o homem. Leishmania chagasi n.sp. Nota Prévia. Hospital (Rio de Janeiro) 1937; 11: 3–9. [Google Scholar]
  • 9.Deane LM. Leishmaniose visceral no Brasil. Estudos sobre reservatórios e transmissores realizados no Estado do Ceará. Tese de Livre Docência. Faculdade de Medicina 1956; USP, 162 p.
  • 10.Lainson R, Rangel EF. Lutzomyia longipalpis and the eco-epidemiology of American visceral leishmaniasis, with particular reference to Brazil: a review. Mem Inst Oswaldo Cruz. 2005;100: 811–827. [DOI] [PubMed] [Google Scholar]
  • 11.Gomes AC, Neves VLFC. Estratégia e perspectivas de controle da leishmaniose tegumentar no Estado de São Paulo. Rev Soc Bras Med Trop. 1998;31: 549–552. [DOI] [PubMed] [Google Scholar]
  • 12.Rangel EF, Souza NA, Wermelinger ED, Barbosa AF. Infecção natural de Lutzomyia intermedia (Lutz & Neiva, 1912), em área endêmica de leishmaniose tegumentar no Estado do Rio de Janeiro. Mem Inst Oswaldo Cruz. 1984;79: 395–396. [DOI] [PubMed] [Google Scholar]
  • 13.Gontijo CMF, da Silva ES, de Fuccio MB, de Sousa MCA, Pacheco RS, Dias ES, et al. Epidemiological studies of an outbreak of cutaneous leishmaniasis in the Rio Jequitinhonha Valley, Minas Gerais, Brazil. Acta Trop. 2002;81: 143–150. [DOI] [PubMed] [Google Scholar]
  • 14.Oliveira CI de, Bafica ALB, Oliveira F, Favali CBF, Correa T, Freitas LAR de, et al. Clinical utility of polymerase chain reaction-based detection of Leishmania in the diagnosis of American cutaneous leishmaniasis Infectious Diseases Society of America; 2003. [DOI] [PubMed] [Google Scholar]
  • 15.Andrade Filho JD, Galati EAB, Falcão AL. Nyssomyia intermedia (Lutz & Neiva, 1912) and Nyssomyia neivai (Pinto, 1926) (Diptera: Psychodidae: Phlebotominae) geographical distribution and epidemiological importance. Mem Inst Oswaldo Cruz. Fundação Oswaldo Cruz; 2007;102: 481–487. [DOI] [PubMed] [Google Scholar]
  • 16.Carvalho GML, Filho JDA, Falcao AL, Lima ACVMR, Gontijo CMF. Naturally Infected Lutzomyia Sand Flies in a Leishmania -Endemic Area of Brazil. 2008;8: 407–14. doi: 10.1089/vbz.2007.0180 [DOI] [PubMed] [Google Scholar]
  • 17.PSC–Portal do Santuário do Caraça, 2012. Disponível em: http://www.santuariodocaraca.com.br/. Acessado em: 10/11/2012.
  • 18.Talamoni S, Amaro B, Cordeiro-Júnior D, Maciel C. Mammals of Reserva Particular do Patrimônio Natural Santuário do Caraça, state of Minas Gerais, Brazil. Check List. 2014;10: 1005–1013. [Google Scholar]
  • 19.Galati EAB. Classificação de Phlebotominae. In EF Rangel, R Lainson, Flebotomíneos do Brasil, Fiocruz 2003; 23–51.
  • 20.Roberts DR, Hsi BP. An Index of Species Abundance for Use with Mosquito Surveillance Data. Environ Entomol. 1979;8. [Google Scholar]
  • 21.Hayek LAC, Buzas MA. Surveying Natural Populations. New York, Columbia University Press; 1997;347–389. [Google Scholar]
  • 22.Killick-Kendrick R. Phlebotomine vectors of the leishmaniases: a review. Med Vet Entomol. Blackwell Publishing Ltd; 1990;4: 1–24. [DOI] [PubMed] [Google Scholar]
  • 23.Killick-Kendrick R & WARD RD. Ecology of Leishmania. Workshop no 11. Parasitology, 1981;82: 143–152. [Google Scholar]
  • 24.Olivier M, Gregory DJ, Forget G. Subversion Mechanisms by Which Leishmania Parasites Can Escape the Host Immune Response: a Signaling Point of View Subversion Mechanisms by Which Leishmania Parasites Can Escape the Host Immune Response: a Signaling Point of View. Clin Microbiol Rev. 2005;18: 293–305. doi: 10.1128/CMR.18.2.293-305.2005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Andrade MS, Courtenay O, F. Brito ME, Carvalho FG, Carvalho AWS, Soares F, et al. Infectiousness of Sylvatic and Synanthropic Small Rodents Implicates a Multi-host Reservoir of Leishmania (Viannia) braziliensis. PLoS Negl Trop Dis 2015;9(10): e0004137 doi: 10.1371/journal.pntd.0004137 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Lima BS, Dantas-Torres F, Carvalho MR de, Marinho-Junior JF, Almeida EL de, Brito MEF, et al. Small mammals as hosts of Leishmania spp. in a highly endemic area for zoonotic leishmaniasis in North-Eastern Brazil. 2013;107 doi: 10.1093/trstmh/trt062 [DOI] [PubMed] [Google Scholar]
  • 27.Brandão-Filho SP, Brito ME, Carvalho FG, Ishikaw EA, Cupolillo E, Floeter-Winter L, et al. Wild and synanthropic hosts of Leishmania (Viannia) braziliensis in the endemic cutaneous leishmaniasis locality of Amaraji, Pernambuco State, Brazil. Trans R Soc Trop Med Hyg. 2003; 97: 291–296. [DOI] [PubMed] [Google Scholar]
  • 28.Massafera R, da Silva AM, de Carvalho AP, dos Santos DR, Galati EAB, Teodoro U. Fauna de flebotomíneos do município de Bandeirantes, no Estado do Paraná. Rev Saude Publica. 2005; 571–7. [DOI] [PubMed] [Google Scholar]
  • 29.Mestre GL da C, Ribeiro ALM, Miyazaki RD, Rodrigues JSV, Almeida A do BPF de, Sousa VRF, et al. Phlebotomine sand flies and canine infection in areas of human visceral leishmaniasis, Cuiabá, Mato Grosso. Rev Bras Parasitol Veterinária. Colégio Brasileiro de Parasitologia Veterinária; 2011;20: 228–234. [DOI] [PubMed] [Google Scholar]
  • 30.Souza CF, Borges MAZ, Andrade AJ. Contribution to the Knowledge of the Phlebotomine Sand Flies Fauna (Diptera: Psychodidae) of Timóteo Municipality, Minas Gerais, Brazil. Neotrop Entomol. Sociedade Entomológica do Brasil; 2009;38: 267–271. [DOI] [PubMed] [Google Scholar]
  • 31.De Lima Carvalho GM, De Vasconcelos FB, Da Silva DG, Botelho HA, Andrade Filho JD. Diversity of Phlebotomine Sand Flies (Diptera: Psychodidae) in Ibitipoca State Park, Minas Gerais, Brazil. J Med Entomol. Entomological Society of America; 2011;48: 764–769. [DOI] [PubMed] [Google Scholar]
  • 32.Campos AM, Matavelli R, dos Santos CLC, Moraes LS, Rebêlo JMM. Ecology of Phlebotomines (Diptera: Psychodidae) in a Transitional Area Between the Amazon and the Cerrado in the State of Maranhão, Brazil. J Med Entomol. 2013;50. [DOI] [PubMed] [Google Scholar]
  • 33.Rêgo F, Shimabukuro PH, Quaresma P, Coelho I, Tonelli G, Silva KM, et al. Ecological aspects of the Phlebotominae fauna (Diptera: Psychodidae) in the Xakriabá Indigenous Reserve, Brazil. Parasit Vectors. BioMed Central; 2014;7: 220 doi: 10.1186/1756-3305-7-220 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Lainson R, Shaw JJ, Ryan L, Ribeiro RSM, Silveira FT. Leishmaniasis in Brazil. XXI. visceral leishmaniasis in the Amazon Region and further observations on the role of Lutzomyia longipalpis (Lutz & Neiva, 1912) as the vector. Trans R Soc Trop Med Hyg. No longer published by Elsevier; 1985;79: 223–226. [DOI] [PubMed] [Google Scholar]
  • 35.Sherlock IA. Ecological interactions of visceral leishmaniasis in the state of Bahia, Brazil. Mem Inst Oswaldo Cruz. Fundação Oswaldo Cruz; 1996;91: 671–683. [DOI] [PubMed] [Google Scholar]
  • 36.Nascimento JC do, Paiva BR de, Malafronte R dos S, Fernandes WD, Galati EAB. Natural infection of phlebotomines (Diptera: Psychodidae) in a visceral-leishmaniasis focus in Mato Grosso do Sul, Brazil. Rev Inst Med Trop Sao Paulo. Instituto de Medicina Tropical de São Paulo; 2007;49: 119–122. [DOI] [PubMed] [Google Scholar]
  • 37.Ryan L, Brazil RP, Ryan L, Brazil RP. Leishmania infections in Lutzomyia longipalpis (Diptera: Psychodidae) on the Island of Sao Luis, Maranhao State, Brazil. Mem Inst Oswaldo Cruz. Fundação Oswaldo Cruz; 1984;79: 383–384. [DOI] [PubMed] [Google Scholar]
  • 38.Silva EA, Andreotti R, Honer MR. Comportamento de Lutzomyia longipalpis, vetor principal da leishmaniose visceral americana, em Campo Grande, Estado do Mato Grosso do Sul. Rev Soc Bras Med Trop. 2007;40: 420–425. [DOI] [PubMed] [Google Scholar]
  • 39.Felipe IMA, Aquino DMC de, Kuppinger O, Santos MDC, Rangel MES, Barbosa DS, et al. Leishmania infection in humans, dogs and sandflies in a visceral leishmaniasis endemic area in Maranhão, Brazil. Mem Inst Oswaldo Cruz. Fundação Oswaldo Cruz; 2011;106: 207–211. [DOI] [PubMed] [Google Scholar]
  • 40.Hock A, Ryan L, Vexenat JA, Rosa AC, Barreto AC. Isolation of Leishmania braziliensis braziliensis and other trypanosomatids from Phlebotomine in a mucocutaneous leishmaniasis endemic area, Bahia, Brazil. Mem. Inst.Osvaldo Cruz, Rio de Janeiro, 81 (Supl.):62, November, 1986. [Google Scholar]
  • 41.Arias JR, Miles MA, Naiff RD, Povoa MM, de Freitas RA, Biancardi CB, et al. Flagellate infections of Brazilian sand flies (Diptera: Psychodidae): Isolation in vitro and biochemical identification of Endotrypanum and Leishmania. Am J Trop Med Hyg. 1985;34: 1098–1108. [DOI] [PubMed] [Google Scholar]
  • 42.Ryan L, Vexenat A, Marsden PD, Lainson R, Shaw JJ. The importance of rapid diagnosis of new cases of cutane- ous leishmaniasis in pin-pointing the sandfly vector. Trans R Soc Trop Med Hyg 1990;84: 786 [DOI] [PubMed] [Google Scholar]
  • 43.Azevedo ACR, Rangel EF, Azevedo ACR, Rangel EF. A study of sandfly species (Diptera: Psychodidae: Phlebotominae) in a focus of cutaneous leishmaniasis in the municipality of Baturité, Ceará, Brazil. Mem Inst Oswaldo Cruz. Fundação Oswaldo Cruz; 1991;86: 405–410. [DOI] [PubMed] [Google Scholar]
  • 44.Queiroz RG de, Vasconcelos I de A, Vasconcelos A, Pessoa FAC, Sousa RN de, David JR. Cutaneous leishmaniasis in Ceará State in Northeastern Brazil: incrimination of Lutzomyia whitmani (Diptera: Psychodidae) as vector of Leishmania braziliensis in Baturité municipality. 1994;50: 693–8. [DOI] [PubMed] [Google Scholar]
  • 45.Luz BYE, Castro EA, Dereure J, Pratlong F, Medicale E, Broussonet RA. Lutzomyia whitmani (Diptera: Psychodidae) as vector of Leishmania (V.) braziliensis in Parana. 2000;94 [DOI] [PubMed] [Google Scholar]
  • 46.Miranda JC, Reis E, Schriefer A, Gonçalves M, Reis MG, Carvalho L, et al. Frequency of infection of Lutzomyia phlebotomines with Leishmania braziliensis in a Brazilian endemic area as assessed by pinpoint capture and polymerase chain reaction. Mem Inst Oswaldo Cruz. 2002;97: 185–188. [DOI] [PubMed] [Google Scholar]
  • 47.Galati EAB, Nunes VLB, Dorval MEC, Oshiro ET, Cristaldo G, Espíndola MA, et al. Estudo dos flebotomíneos (Diptera, Pychodidae), em área de leishmaniose tegumentar, no Estado de Mato Grosso do Sul, Brasil. Rev Saude Publica. Faculdade de Saúde Pública da Universidade de São Paulo; 1996;30: 115–128. [DOI] [PubMed] [Google Scholar]
  • 48.Lana RS, Michalsky ÉM, Fortes-Dias CL, França-Silva JC, Lara-Silva F de O, Rocha Lima ACVM da, et al. Phlebotomine Sand Fly Fauna and Leishmania Infection in the Vicinity of the Serra do Cipó National Park, a Natural Brazilian Heritage Site. Biomed Res Int. Hindawi Publishing Corporation; 2015;2015: 1–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Paiva BR, Oliveira AG, Dorval MEMC, Galati EAB, Malafronte RS. Species-specific identification of Leishmania in naturally infected sand flies captured in Mato Grosso do Sul State, Brazil. Acta Trop. 2010;115: 126–130. doi: 10.1016/j.actatropica.2010.02.013 [DOI] [PubMed] [Google Scholar]
  • 50.Rocha LS, Falqueto A, Santos CB dos, Ferreira AL, Graça GC da, Grimaldi G, et al. Survey of natural infection by Leishmania in sand fly species collected in southeastern Brazil. Trans R Soc Trop Med Hyg. Oxford University Press; 2010;104: 461–466. doi: 10.1016/j.trstmh.2010.02.005 [DOI] [PubMed] [Google Scholar]
  • 51.Margonari C, Soares RP, Andrade-Filho JD, Xavier DC, Saraiva L, Fonseca AL, et al. Phlebotomine Sand Flies (Diptera: Psychodidae) and Leishmania Infection in Gafanhoto Park, Divinópolis, Brazil. J Med Entomol. Entomological Society of America; 2010;47: 1212–1219. [DOI] [PubMed] [Google Scholar]
  • 52.Paiva BR, Secundino NFC, Nascimento JC, Pimenta PFP, Galati EAB, Junior HFA, et al. Detection and identification of Leishmania species in field-captured phlebotomine sandflies based on mini-exon gene PCR. Acta Trop. 2006;99: 252–259. doi: 10.1016/j.actatropica.2006.08.009 [DOI] [PubMed] [Google Scholar]
  • 53.Michalsky ÉM, Guedes K de S, Lara e Silva F de O, França-Silva JC, Dias CLF, Barata RA, et al. Infecção natural de Lutzomyia (Lutzomyia) longipalpis (Diptera: Psychodidae) por Leishmania infantum chagasi em flebotomíneos capturados no município de Janaúba, Estado de Minas Gerais, Brasil. Rev Soc Bras Med Trop. SBMT; 2011;44: 58–62. [DOI] [PubMed] [Google Scholar]
  • 54.Quaresma PF, Carvalho GM de L, Ramos MC das NF, Andrade Filho JD. Natural Leishmania sp. reservoirs and phlebotomine sandfly food source identification in Ibitipoca State Park, Minas Gerais, Brazil. Mem Inst Oswaldo Cruz. Fundação Oswaldo Cruz; 2012;107: 480–485. [DOI] [PubMed] [Google Scholar]
  • 55.Rêgo FD, Rugani JMN, Shimabukuro PHF, Tonelli GB, Quaresma PF, Gontijo CMF. Molecular Detection of Leishmania in Phlebotomine Sand Flies (Diptera: Psychodidae) from a Cutaneous Leishmaniasis Focus at Xakriabá Indigenous Reserve, Brazil. PLoS One. 2015;10: e0122038 doi: 10.1371/journal.pone.0122038 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Lara-Silva F de O, Michalsky ÉM, Fortes-Dias CL, Fiuza V de OP, Pessanha JEM, Regina-Silva S, et al. Epidemiological aspects of vector, parasite, and domestic reservoir in areas of recent transmission and no reported human cases of visceral leishmaniasis in Brazil. Acta Trop. 2015;148: 128–136. doi: 10.1016/j.actatropica.2015.04.002 [DOI] [PubMed] [Google Scholar]
  • 57.Savani ESMM Nunes VLB, Galati EAB Castilho TM, Zampieri RA Floeter-Winter LM. The finding of Lutzomyia almerioi and Lutzomyia longipalpis naturally infected by Leishmania spp. in a cutaneous and canine visceral leishmaniases focus in Serra da Bodoquena, Brazil. Vet Parasitol. 2009;160: 18–24. doi: 10.1016/j.vetpar.2008.10.090 [DOI] [PubMed] [Google Scholar]
  • 58.Andrade Fo JD, Brazil RP, Falcão AL. Nota sobre a distribuição geográfica de Lutzomyia (Psychodopygus) arthuri (Fonseca) e Lutzomyia (Psychodopygus) lloydi (Antunes) (Diptera: Psychodidae). An da Soc Entomológica do Bras. Sociedade Entomológica do Brasil; 1997;26: 403–405. [Google Scholar]
  • 59.Santos DR, Santos AR, Oliveira O, Poiani LP, da Silva AM. First report of Psychodopygus lloydi (Antunes) (Diptera: Psychodidae) in Paraná state, southern of Brazil. Rev Bras Entomol 2007;51: 524–525. [Google Scholar]
  • 60.Rebêlo JMM, Rocha RV da, Moraes JLP, Silva CRM da, Leonardo FS, Alves GA. The fauna of phlebotomines (Diptera, Psychodidae) in different phytogeographic regions of the state of Maranhão, Brazil. Rev Bras Entomol. Sociedade Brasileira De Entomologia; 2010;54: 494–500. [Google Scholar]
  • 61.Lainson R, Rangel EF. Ecologia das Leishmanioses In Rangel EF, Lainson R,Flebotomíneos do Brasil, Fiocruz, Rio de Janeiro, 2003, p. 291–309. [Google Scholar]
  • 62.Brazil Reginaldo Peçanha, and Brazil Beatriz Gomes. "Biologia de flebotomíneos neotropicais" Flebotomíneos no Brasil. Fiocruz, 2003. 257–274. [Google Scholar]
  • 63.Forattini OP. Phlebotominae–Leishmanioses–Bartonelose In: Entomologia Médica, São Paulo: Edgard Blucher; 1973, vol. 4. [Google Scholar]
  • 64.Miles MA, Arias JR, Valente SAS, Naiff RD, Souza AA de, Povoa MM, et al. Vertebrate Hosts and Vectors of Trypanosoma Rangeli in the Amazon Basin of Brazil. Am J Trop Med Hyg. American Society of Tropical Medicine and Hygiene; 1983;32: 1251–1259. [DOI] [PubMed] [Google Scholar]
  • 65.Shaw J, Rosa AT, Souza A & Cruz AC. Transmissão de outros agentes: os flebotomíneos brasileiros como hospedeiros e vetores de determinadas espécies In: Rangel E.F. & Lainson R. (Orgs.) Flebotomíneos do Brasil. Rio de Janeiro: Fiocruz; 2003, p. 337–351. [Google Scholar]
  • 66.Saraiva L, Reis AS, Rugani JMN, Pereira AAS, Rêgo FD, Lima ACVM da R, et al. Survey of Sand Flies (Diptera: Psychodidae) in an Environmentally Protected Area in Brazil. 2015;10: e0134845 doi: 10.1371/journal.pone.0134845 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Rocha LS, Falqueto A, dos Santos CB, Ferreira AL, da Graça GC, Grimaldi G, et al. Survey of natural infection by Leishmania in sand fly species collected in southeastern Brazil. Trans R Soc Trop Med Hyg. 2010;104: 461–466. doi: 10.1016/j.trstmh.2010.02.005 [DOI] [PubMed] [Google Scholar]
  • 68.Alvar J, Cañavate C, Molina R, Moreno J, Nieto J. Canine Leishmaniasis. Adv Parasitol. 2004;57: 1–88. doi: 10.1016/S0065-308X(04)57001-X [DOI] [PubMed] [Google Scholar]
  • 69.Ranasinghe S, Rogers ME, Hamilton JGC, Bates PA, Maingon RDC. A real-time PCR assay to estimate Leishmania chagasi load in its natural sand fly vector Lutzomyia longipalpis. Trans R Soc Trop Med Hyg. 2008;102: 875–882. doi: 10.1016/j.trstmh.2008.04.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70.Schallig HDFH, Silva ES da, Meide WF van der, Schoone GJ, Gontijo CMF. Didelphis marsupialis (Common Opossum): A Potential Reservoir Host for Zoonotic Leishmaniasis in the Metropolitan Region of Belo Horizonte (Minas Gerais, Brazil). 2007;7: 387–93. doi: 10.1089/vbz.2006.0651 [DOI] [PubMed] [Google Scholar]
  • 71.Pereira AAS. Avaliação da infecção por Leishmania spp. em pequenos mamíferos de áreas endêmicas de Minas Gerais, Brasil. M.Sc. Thesis, Centro de Pesquisas René Rachou, Programa de Pós-Graduação em Ciências da Saúde. 2015. Available from: http://www.cpqrr.fiocruz.br/texto-completo/D_139.pdf.
  • 72.Antinori S, Gianelli E, Calattini S, Longhi E, Gramiccia M, Corbellino M. Cutaneous leishmaniasis: An increasing threat for travellers. Clin Microbiol Infect. 2005;11: 343–346. doi: 10.1111/j.1469-0691.2004.01046.x [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

S1 File. Permanent License to Collect Zoologic Materials n° 15237–2 of Ministério do Meio Ambiente–MMA.

(PDF)

Data Availability Statement

All relevant data are within the paper and its Supporting Information files.


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES