Skip to main content
International Journal of Molecular Sciences logoLink to International Journal of Molecular Sciences
. 2017 May 5;18(5):996. doi: 10.3390/ijms18050996

First Mitochondrial Genome from Nemouridae (Plecoptera) Reveals Novel Features of the Elongated Control Region and Phylogenetic Implications

Zhi-Teng Chen 1, Yu-Zhou Du 1,2,*
Editor: Stephen A Bustin
PMCID: PMC5454909  PMID: 28475163

Abstract

The complete mitochondrial genome (mitogenome) of Nemoura nankinensis (Plecoptera: Nemouridae) was sequenced as the first reported mitogenome from the family Nemouridae. The N. nankinensis mitogenome was the longest (16,602 bp) among reported plecopteran mitogenomes, and it contains 37 genes including 13 protein-coding genes (PCGs), 22 transfer RNA (tRNA) genes and two ribosomal RNA (rRNA) genes. Most PCGs used standard ATN as start codons, and TAN as termination codons. All tRNA genes of N. nankinensis could fold into the cloverleaf secondary structures except for trnSer (AGN), whose dihydrouridine (DHU) arm was reduced to a small loop. There was also a large non-coding region (control region, CR) in the N. nankinensis mitogenome. The 1751 bp CR was the longest and had the highest A+T content (81.8%) among stoneflies. A large tandem repeat region, five potential stem-loop (SL) structures, four tRNA-like structures and four conserved sequence blocks (CSBs) were detected in the elongated CR. The presence of these tRNA-like structures in the CR has never been reported in other plecopteran mitogenomes. These novel features of the elongated CR in N. nankinensis may have functions associated with the process of replication and transcription. Finally, phylogenetic reconstruction suggested that Nemouridae was the sister-group of Capniidae.

Keywords: Plecoptera, stoneflies, mitochondrial genome, control region, phylogeny

1. Introduction

Nowadays, mitochondrial genome (mitogenome) has been one of the most popular molecules widely used in insect taxonomy, population genetics, evolutionary biology and phylogenetics [1]. Generally, an insect mitogenome is a double strand circular molecule, ranging from 14–20 kb in length. It usually contains a typical set of 37 genes: 13 protein-coding genes (PCGs), 22 transfer RNA (tRNA) genes and two ribosomal RNA (rRNA) genes [2,3]. There is also a non-coding control region (CR) in mitogenomes, which is involved in the initiation and regulation of transcription and replication of the mitogenome [4,5,6]. The CR is the most variable region concerning A+T content and length, and some structural elements are expected to be present in a CR: (1) a poly-T stretch near the 5′ end of the CR; (2) a poly-[TA(A)]n stretch following the poly-T stretch; (3) conserved stem-loop (SL) structures with a 5′ flanking TATA and a 3’ flanking G(A)nT motif; and (4) a G+A-rich region located downstream of the CR [7]. Functional information on replication derived from these structures has been well discussed, but the transcription features of insect mitogenomes are still little known [6,7,8,9].

The Plecoptera (stoneflies) are a group of ancient insects, which are vital in the reconstruction of the evolutionary history of insects, and they are important bioindicators of water quality [10]. To date, 15 complete or near complete plecopteran mitogenomes have been reported, and relevant attempts have been made to rebuild the phylogeny of Plecoptera based on the increasing mitogenomic data [11,12,13,14,15,16,17,18,19,20,21,22,23,24]. However, the phylogenetic position of Plecoptera in Insecta and the phylogenetic relationship among stoneflies are still controversial.

To facilitate the study of mitogenome phylogeny in Plecoptera, we report the complete mitogenome of Nemoura nankinensis, which was the first sequenced mitogenome from Nemouridae. In this study, the organization, nucleotide composition, codon usage, secondary tRNA structures, and novel features of the elongated CR in the N. nankinensis mitogenome were analyzed. Finally, the phylogenetic relationships of N. nankinensis and other stoneflies were reconstructed based on PCG sequences.

2. Results and Discussion

2.1. Genome Annotation and Base Composition

The complete mitogenome of N. nankinensis was 16,602 bp in length, which was larger than any other reported stonefly mitogenomes. It contained the 37 typical mitochondrial genes (13 PCGs, 22 tRNAs and two rRNAs) and a large noncoding control region; 23 genes (nine PCGs and 14 tRNAs) were located on the majority strand (J-strand) and 14 genes (four PCGs, eight tRNAs, and two rRNAs) were on the minority strand (N-strand) (Figure 1, Table 1). The highly-conserved gene arrangement of the N. nankinensis mitogenome was identical with other stoneflies as well as the model insect, Drosophila yakuba, which had the putative ancestral arthropod mitogenome [25]. The N. nankinensis mitogenome contained 36 overlapping nucleotides that were 1–8 bp in length and located in 11 pairs of neighboring genes. The longest overlap (8 bp) was located between trnCys and trnTrp. Except for the large control region, a total of 72 intergenic nucleotides (IGN) were found in 13 locations, ranging in size from 1 to 31 bp.

Figure 1.

Figure 1

Mitochondrial map of Nemoura nankinensis. Genes outside the map are transcribed in a clockwise direction, whereas those inside the map are transcribed counterclockwise. The second circle shows the GC content and the third shows the GC skew. GC content and GC skew are plotted as the deviation from the average value of the entire sequence.

Table 1.

Mitochondrial genome structure of Nemoura nankinensis.

Gene Position (bp) Size (bp) Direction Intergenic Nucleotides (IGN) Anti- or Start/Stop Codons AT%
trnIle (I) 1–66 66 Forward 0 GAT 66.7
trnGln (Q) 64–132 69 Reverse −3 TTG 78.3
trnMet (M) 146–214 69 Forward 13 CAT 62.3
nad2 215–1249 1035 Forward 0 ATG/TAA 70.8
trnTrp (W) 1259–1327 69 Forward 9 TCA 69.6
trnCys (C) 1320–1382 63 Reverse −8 GCA 68.3
trnTyr (Y) 1388–1453 66 Reverse 5 GTA 60.6
cox1 1450–2983 1534 Forward −2 CCG/T- 64.1
trnLeu2 (UUR) 2986–3052 67 Forward 0 TAA 68.7
cox2 3056–3743 688 Forward 3 ATG/T- 67.2
trnLys (K) 3745–3815 71 Forward 1 CTT 64.8
trnAsp (D) 3817–3885 69 Forward 1 GTC 73.9
atp8 3886–4044 159 Forward 0 ATT/TAA 76.7
atp6 4038–4715 678 Forward −7 ATG/TAA 67.7
cox3 4715–5503 789 Forward −1 ATG/TAA 64.9
trnGly (G) 5504–5569 66 Forward 0 TCC 72.7
nad3 5570–5923 354 Forward 0 ATT/TAG 72.0
trnAla (A) 5922–5985 64 Forward −2 TGC 70.3
trnArg (R) 5986–6049 64 Forward 0 TCG 64.1
trnAsn (N) 6052–6117 66 Forward 2 GTT 72.7
trnSer1 (AGN) 6118–6184 67 Forward 0 GCT 67.2
trnGlu (E) 6185–6250 66 Forward 0 TTC 90.9
trnPhe (F) 6249–6315 67 Reverse −2 GAA 67.2
nad5 6316–8050 1735 Reverse 0 ATG/T- 70.7
trnHis (H) 8051–8117 67 Reverse 0 GTG 79.1
nad4 8119–9459 1341 Reverse 1 ATG/TAA 71.5
nad4l 9453–9749 297 Reverse −7 ATG/TAA 74.7
trnThr (T) 9752–9817 66 Forward 2 TGT 80.3
trnPro (P) 9817–9882 66 Reverse −1 TGG 71.2
nad6 9884–10408 525 Forward 1 ATT/TAA 73.3
Cytb 10408–11544 1137 Forward −1 ATG/TAG 66.8
trnSer2 (UCN) 11543–11612 70 Forward −2 TGA 74.3
nad1 11644–12594 951 Reverse 31 TTG/TAA 69.4
trnLeu1 (CUN) 12596–12661 66 Reverse 1 TAG 75.8
rrnL 12664–13990 1327 Reverse 2 74.9
trnVal (V) 13991–14061 71 Reverse 0 TAC 69.0
rrnS 14062–14851 790 Reverse 0 71.3
Control region 14852–16602 1751 0 81.8

In the N. nankinensis mitogenome, the A+T content of the whole mitogenome, PCGs, tRNAs, rRNAs and the control region was 71.2%, 69.0%, 71.4%, 73.5% and 81.9%, respectively (Table 2). For the 37 genes, the A+T content ranged from 60.6% in trnTyr to 90.9% in trnGlu, showing a bias for the A and T nucleotides. The AT skew and GC skew of the N. nankinensis mitogenome were calculated and showed a biased use of A and C nucleotides (Table 2). For the J-strand, the AT skew of PCGs was negative and the GC skew of tRNA genes was positive, which was inconsistent with the strand bias of most other insects (positive AT skew and negative GC skew for the J-strand) [26].

Table 2.

Nucleotide composition of the Nemoura nankinensis mitogenome.

Regions Nucleotides Proportions (%) AT Skew GC Skew
A T G C A+T G+C
Whole genome 37.2 34.0 11.8 17.0 71.2 28.8 0.04 −0.18
Protein coding genes 35.7 33.3 12.9 18.1 69.0 31.0 0.03 −0.17
1st codon position 40.5 29.3 14.4 15.8 69.8 30.2 0.16 −0.05
2nd codon position 31.5 32.2 15.3 21.0 63.7 36.3 −0.01 −0.16
3rd codon position 35.1 38.3 9.1 17.5 73.4 26.6 −0.04 −0.32
Protein coding genes-J 29.7 38.0 14.1 18.2 67.7 32.3 −0.12 −0.13
1st codon position 30.5 35.0 17.6 16.9 65.5 34.5 −0.07 0.02
2nd codon position 26.4 40.5 12.5 20.6 66.9 33.1 −0.21 −0.24
3rd codon position 32.2 38.5 12.2 17.1 70.7 29.3 −0.09 −0.17
Protein coding genes-N 45.3 25.6 11.1 18.0 70.9 29.1 0.28 −0.24
1st codon position 46.9 26.2 9.7 17.2 73.1 26.9 0.28 −0.28
2nd codon position 45.7 25.5 11.0 17.8 71.2 28.8 0.28 −0.24
3rd codon position 43.2 25.2 12.6 19.0 68.4 31.6 0.26 −0.20
tRNA genes 36.8 34.6 12.8 15.8 71.4 28.6 0.03 −0.10
tRNA genes-J 36.4 34.9 14.7 14.0 71.3 28.7 0.02 0.02
tRNA genes-N 37.7 33.8 9.1 19.4 71.5 28.5 0.05 −0.36
rRNA genes 40.3 33.2 9.6 16.9 73.5 26.5 0.10 −0.28
Control region 43.2 38.7 6.4 11.7 81.9 18.1 0.05 −0.29

2.2. Protein-Coding Genes, Transfer RNA and Ribosomal RNA Genes

The 13 PCGs of N. nankinensis were similar in length and arrangement to other sequenced stonefly mitogenomes. Eleven PCGs initiated with the standard start codon ATN (ATT and ATG), while cox1 used CCG, and nad1 used TTG as a start codon. Ten PCGs had complete termination codons (TAA or TAG), whereas cox1, cox2 and nad5 ended with the incomplete termination codon T, which could be completed by post-transcriptional polyadenylation [27]. The relative synonymous codon usage (RSCU) values of the N. nankinensis mitogenome were calculated and illustrated, indicating the five most frequently used codons: TTA (Leu), CGA (Arg), GTA (Val), AAA (Lys) and CAA (Gln) (Figure 2).

Figure 2.

Figure 2

Relative synonymous codon usage (RSCU) in the Nemoura nankinensis mitogenome. Codon families are indicated below the X-axis.

The total length of the 22 tRNA genes was 1404 bp, and individual genes ranged from 63 to 71 bp with an average A+T content of 71.4%. All tRNA genes of N. nankinensis were predicted to fold into typical cloverleaf secondary structures (Figure 3). However, in trnSer (AGN), the dihydrouridine (DHU) arm was reduced to a small loop, which was common in many other metazoan mitogenomes [28]. In addition, 30 mismatched base pairs were identified in the tRNA genes, and these were all G-U pairs. In N. nankinensis, the anticodons of the 22 tRNAs were identical with other stoneflies, and the AGG codon was translated as Lys instead of Ser, which indicated the utilization of a variant of the invertebrate mitochondrial genetic code in this mitogenome (Table 1). This phenomenon has been well discussed by Abascal et al., and the shifts between alternative genetic codes were concluded to occur frequently within arthropod main lineages [29,30].

Figure 3.

Figure 3

Inferred secondary structures of tRNAs from the Nemoura nankinensis mitogenome. The tRNAs are labelled with the abbreviations of their corresponding amino acids. Structural elements in tRNA arms and loops are illustrated as for trnV. Dashes (–) indicate Watson–Crick bonds, dots (·) indicate mistaken bonds, and circles (°) indicate loops in arms.

The large ribosomal RNA (rrnL) gene of N. nankinensis was 1327 bp in length with an A+T content of 74.9%, and the small ribosomal RNA (rrnS) gene was 790 bp with an A+T content of 71.3% (Table 1). The two rRNA genes were mapped between trnLeu (CUN) and the control region, which was consistent with other stonefly species.

2.3. The Control Region

The control region (CR) of the N. nankinensis mitogenome is currently the longest known CR (1751 bp) with the highest A+T content (81.8%) among stoneflies, and was located at the conserved position between rrnS and trnIle (Figure 1, Table 1 and Table 3). Firstly, a large repeat region (15021–16049) was identified, which was 1029 bp and contained 3.1 tandem repeats (Figure 4). Each of the three repeated sequences could be folded into a same trnAsn-like structure encoded on the N-strand. These long tandem repeats might explain the large size of the CR in N. nankinensis.

Table 3.

Comparison of mitogenome size and control region size with A+T content among stoneflies.

Species Mitogenome Size (bp) Control Region Size (bp) A+T Content of Control Region (%) Accession Number
N. nankinensis 16,602 1751 81.8 KY940360
C. zijinshana 16,310 1513 62.0 KX094942
M. arizonensis 14,921 N/A N/A KP642637
A. tikumana 15,564 N/A N/A KR604721
Styloperla sp. 15,416 N/A N/A KR088971
S. spinicercia 16,129 1259 77.3 KX845569
Cryptoperla sp. 15,633 777 80.2 KC952026
S. longistyla 16,151 1107 80.1 KM216826
P. princeps 16,004 1158 81.3 AY687866
P. badia 15,586 687 68.9 KU182360
D. cephalotes 15,666 711 74.5 KF484757
A. hainana 15,804 899 73.3 KM199685
Togoperla sp. 15,723 780 78.0 KM409708
K. wangi 16,179 1251 78.2 KC894944
K. chungnanshana 15,943 1062 79.1 KT186102
Peltoperla arcuata N/A 1072 N/A AY142073

N/A: data not available.

Figure 4.

Figure 4

Predicted structural elements in the control region of Nemoura nankinensis. Tandem repeat units are indicated by orange ellipses. Stem-loop (SL) and tRNA-like structures are demarcated by blue lines. Other A+T-rich sequences are shown as red lines.

Then five SL structures were predicted in the CR: SL-1 (14,982–15,022), SL-2 (16,064–16,088), SL-3 (16,089–16,110), SL-4 (16,368–16,407) and SL-5 (16,552–16,572). The proposed “G(A)nT” motif was detected after SL-1 and SL-4, but it was modified as “GTA” after SL-2 and SL-3, and “TGA” after SL-5. These SL structures were considered to be associated with the initiation of mitogenome replication and transcription [31]. Interestingly, a trnGln-like structure was found between SL-4 and SL-5, and it was encoded on the majority strand. The presence of tRNA-like structures in the CR has never been reported in other plecopteran mitogenomes, and its underlying mechanisms are unclear. These tRNA-like structures may have signaling functions in the process of transcription [32]. When compared with the available 11 CRs of the other stoneflies, four conserved sequence blocks (CSBs) were identified in N. nankinensis (Figure 5). These CBSs ranged in size from 35 to 100 bp, and their sequence identity among species was generally over 50% (Figure 5). However, the function of these CSBs is still unclear.

Figure 5.

Figure 5

The alignment of conserved structural elements of CRs among stoneflies. Sequence identity among species was indicated by colored boxes. CSB1-4 indicates four conserved sequence blocks in the CRs.

In the past, the sequenced stonefly mitogenomes were mainly from the superfamily group Systellognatha, only N. nankinensis and the three Capniidae species are from the group Euholognatha. The CR of the Capnia zijinshana (Plecoptera: Capniidae) mitogenome was completely reported, and was 1513 bp in length, the second longest in stoneflies. Accordingly, we speculate that with more mitogenomes sequenced from Plecoptera, especially from the group Euholognatha, highly varied mitogenome sizes with more novel structural features will be found, and their functions and phylogenetic implications will be clear.

2.4. Phylogenetic Analyses

The phylogenetic analyses were performed based on the concatenated nucleotide sequences of 13 PCGs derived from 14 available stonefly mitogenomes, and one Ephemeroptera species was included as the outgroup (Table 3). BI and ML analyses generated similar tree topologies (Figure 6 and Figure 7). In both analyses, N. nankinensis was recovered as the sister group of the three species from Capniidae, and the species from other five families were grouped together. This corresponds with the taxonomical knowledge that both Nemouridae and Capniidae are members in the superfamily group Euholognatha, while other five families are from Systellognatha in Plecoptera. In addition to the Capniidae, the clade containing species from Perlidae was well supported on both trees. However, the phylogenetic positions of the four families, Pteronarcyidae, Choloroperlidae, Styloperlidae and Peltoperlidae, were still unclear. These results were generally identical to the recent study made by Chen and Du [12]. The uncertainty and inconsistency of recent mitogenomic phylogenetic studies in Plecoptera may result from the limited mitogenomic data, and more sequencing work is necessary to resolve this problem.

Figure 6.

Figure 6

Phylogenetic relationships among stoneflies inferred by Bayesian inference. Numbers at the nodes are posterior probabilities. The family names are listed after the species. The tree was rooted with one outgroup, Parafronurus youi.

Figure 7.

Figure 7

Phylogenetic relationships among stoneflies inferred by maximum likelihood analysis. Numbers at the nodes are bootstrap values. Family names are shown after the species. The tree was rooted with one outgroup, Parafronurus youi.

3. Materials and Methods

3.1. Sample Preparation and DNA Extraction

Specimens of N. nankinensis were collected in February 2016 from Zijin Mountain of Jiangsu Province, China. Our research activities were not banned by any organization or individual and did not involve endangered or protected species. Specimens used in this study were identified and preserved in 100% ethanol and stored at −20 °C. Genomic DNA was extracted from adults using the Column mtDNAout kit (Tianda, Beijing, China) and stored at −20 °C until used for PCR.

3.2. PCR Amplification and Sequencing

Five pairs of LA-PCR primers were used to amplify segments of the N. nankinensis mitogenome (Table A1). Conditions for LA-PCR amplification were as follows: initial denaturation at 93 °C for 2 min, followed by 40 cycles at 92 °C for 10 s; annealing at 54 °C for 30 s; and elongation at 68 °C for 8 min (20 cycles), which increased 20 s/cycle in the final 20 cycles; and final elongation at 68 °C for 10 min. PCR products were separated by 1.0% agarose gel electrophoresis and purified with an Axygen DNA Gel Extraction Kit (Axygen Biotechnology, Hangzhou, China). All PCR fragments were sent to Map Biotech Company (Shanghai, China) for sequencing. Firstly, the LA-PCR fragments were partially sequenced by Shotgun sequencing in combination with the primer walking strategy (Table A1). Then 15 specifically designed primer pairs were used for the remaining gaps including the CR (Table A1).

3.3. Mitogenome Assembly, Annotation and Analyses

The software CodonCode Aligner (http://www.codoncode.com/aligner/) was used for sequence assembly. PCGs and rRNA genes were identified by comparison with the previously sequenced stonefly mitogenomes, and the gene boundaries were confirmed with ORF finder (https://www.ncbi.nlm.nih.gov/orffinder/). The mitogenomic map was depicted with CGView Server (http://stothard.afns.ualberta.ca/cgview_server/) [33]. The tRNAs were identified by the online server MITOS combined with ARWEN (http://mbio-serv2.mbioekol.lu.se/ARWEN/) [34,35]. The secondary structure of tRNA genes was also obtained from MITOS. The nucleotide composition was analyzed by MEGA v. 6.0 [36]. Composition skew analysis was performed using the formulas AT-skew = [A–T]/[A+T] and GC-skew = [G–C]/[G+C] [37]. The tandem repeats in the putative control region were analyzed with the Tandem Repeats Finder program (http://tandem.bu.edu/trf/trf.advanced.submit.html) and the stem-loop structures were predicted by Quikfold (http://unafold.rna.albany.edu/?q=DINAMelt/Quickfold) [38]. Sequence data were deposited into GenBank under accession number KY940360.

3.4. Phylogenetic Analyses

Phylogenetic analyses were based on nucleotide sequence data of 13 PCGs derived from N. nankinensis and 13 other stonefly mitogenomes available from GenBank (Table 3). Parafronurus youi (Accession No. EU349015) from the insect order Ephemeroptera was used as the outgroup. The nucleotide sequences of the 13 PCGs were aligned with Clustal X as implemented in MEGA v. 6.0 using default settings before concatenation excluding the stop codon [39]. The length of the alignment was 11,154 nucleotides in the final dataset. The best nucleotide substitution model was determined with MEGA v. 6.0 using the Bayesian Information Criterion (BIC) and the GTR+G+I model was predetermined for analyses. Bayesian inferences (BI) and maximum likelihood (ML) analysis were respectively performed using MrBayes v. 3.1.2 [40] and the RAxML Web-Server (http://embnet.vital-it.ch/raxml-bb/index.php) [41]. The BI analyses were performed under the following conditions: 3 million generations with sampling every 100 generations, four chains (one cold chain and three hot chains) and a burn-in of 25% trees. After 3 million generations, all runs reached in stationarity were examined by Tracer v. 1.5 (effective sample sizes exceed 200) [42]. The confidence values of the BI tree were shown as Bayesian posterior probabilities. One thousand bootstrap replicates were performed with the GTRGAMMA substitution model in ML analyses. Finally, the phylogenetic trees were drawn with the software FigTree v. 1.4.2 [43].

4. Conclusions

The mitogenome of N. nankinensis was the longest among reported stonefly mitogenomes. The gene arrangement of the N. nankinensis mitogenome was highly-conserved and identical with other stoneflies. In the elongated CR, novel features were found, including a large tandem repeat region, five SL structures, four tRNA-like structures and four CSBs. These structural elements may have functions associated with the process of replication and transcription. Phylogenetic analyses supported that Nemouridae was the sister-group of Capniidae, which was consistent with former researches.

Acknowledgments

We express our deep gratitude to the Testing Center of Yangzhou University. This research was supported by the National Natural Science Foundation of China (31572295), the Scientific Innovation Research of the Graduate College in Jiangsu Province, China (KYZZ16_0494), and Key Laboratory of Prevention and Control of Biological Hazard Factors (Animal Origin) for Agrifood Safety and Quality, Ministry of Agriculture of China, Yangzhou University (26116120).

Abbreviations

IGN Intergenic Nucleotide
PCG Protein-Coding Gene
tRNA Transfer RNA
rRNA Ribosomal RNA
CR Control Region
SL Stem-Loop
CSB Conserved Sequence Block
BI Bayesian inferences
ML Maximum likelihood

Appendix A

Table A1.

Sequencing strategy and primers used in this study.

Regions Strategy LA-PCR Primers (5′–3′) Specific Primers (5′–3′)
cox1–cytb Shotgun COI-1F: GAAAATGGGGCTGGGACCG
Cytb-1R: TTCGGGTTGAATATGAACAGGG
YP01200761-1F: AGAAGACCGACGAACGCC
YP01200765-1F: CAGCAAAAGGCCCCCACG
YP01200769-1F: CGGTTTACAGCAGCACTTCA
YP01200786-1F: CCCTTTTAGACACCACCCTT
YP01200797-1F: TACAGCTGGTAAAAATAGTTCAAA
YP01200760-1R: TTCACACAAGCTGCACGAT
YP01200772-1R: TGTTGGGAAGAGGAATCTAAGA
YP01200773-1R: AACTGCCTGTGGGTATCGT
YP01200783-1R: GCCGAAACCCCCCTCCTG
YP01200786-2F: TTGCCATTCCAAACCCAT
YP01200783-1F: TGCGTTTCGGCAAGGTAT
YP01200797-1R: GGTTGATGCTACCCCTGG
NJCJ-COI-3F: GATTTATGCCATCACGATACTCA
NJCJ-COI-5F: ATGCTTTATCCCATTTTTCG
NJCJ-Cytb-4R: TTTGGGTTGTGATGTTATTTCTT
NJCJ-COI-5R: TGTTGGGGAAAGTCTTCTATGGA
NJCJ-COI-6F: AAAAGCGGCATATCACTGTT
NJCJ-Cytb-5R: TTGATTGCTTACTCTTCGGTTG
NJCJ-COI-7F: ACCCCAATCAGCCTCCTAA
NJCJ-Cytb-6R: GTTGTTTTTACATTGATTTCCTTT
Primer walking COI-2F: GGTTGATGCTACCCCTGGACG
COI-4F: TTGATTTCACCCAATATAGAACTAA
Cytb-3R: GGGGATGTGTTATTTGGGTG
Cytb-2R: GAAAGCTAAGTCAATATGGGCA
Cytb-4F: GCCTAATGCCCCCTCACA
COI-5R: TGTTGGGGAAAGTCTTCTATGGA
cytb–cox1 Shotgun Cytb-1F: TTCATCTCCTATTCCTTCACCAAA
COI-1R: GTGATTGCTACGGCTCAAACGAA
YP01190217-1F: TGGTCGGGGTTGCTTTCT
YP01190203-1R: ATAATTTCCCGATTTAAAGAGAG
YP01190233-1R: TTCGTAAGCTACACCTTGACC
YP01190202-1F: GGCACTTCTGCTCTTCCCG
YP01190227-1F: AAAGTCTTCGATCTGTCAGTTGT
YP01190213-2R: CGTAAGAAAAACAATGTTAATATA
YP01190213-3R: ATATATTATATCTATATGGATATTATGTTT
NJCJ-control-1F: TATGGTTCTATATGCAATTTCCTCCC
YP01190213-1R: TAGAGAGAAGAGGGGTAAAAC

Author Contributions

Zhi-Teng Chen and Yu-Zhou Du designed the experiments; Zhi-Teng Chen performed the experiments, analyzed the data and wrote the paper.

Conflicts of Interest

The authors declare no conflict of interest. The founding sponsors had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, and in the decision to publish the results.

References

  • 1.Cameron S.L. Insect mitochondrial genomics: Implications for evolution and phylogeny. Annu. Rev. Entomol. 2014;59:95–117. doi: 10.1146/annurev-ento-011613-162007. [DOI] [PubMed] [Google Scholar]
  • 2.Simon C., Frati F., Beckenbach A., Crespi B., Liu H., Flook P. Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Ann. Entomol. Soc. Am. 1994;87:651–701. doi: 10.1093/aesa/87.6.651. [DOI] [Google Scholar]
  • 3.Simon C., Buckley T.R., Frati F., Stewart J.B., Beckenbach A.T. Incorporating molecular evolution into phylogenetic analysis, and a new compilation of conserved polymerase chain reaction primers for animal mitochondrial DNA. Annu. Rev. Ecol. Evol. Syst. 2006;37:545–579. doi: 10.1146/annurev.ecolsys.37.091305.110018. [DOI] [Google Scholar]
  • 4.Da Silva N.M., de Souza Dias A., da Silva Valente V.L., Valiati V.H. Characterization of mitochondrial control region, two intergenic spacers and tRNAs of Zaprionus indianus (Diptera: Drosophilidae) Genetica. 2009;137:325–332. doi: 10.1007/s10709-009-9396-5. [DOI] [PubMed] [Google Scholar]
  • 5.Wolstenholme D.R. Animal mitochondrial DNA: Structure and evolution. Int. Rev. Cytol. 1992;141:173–216. doi: 10.1016/s0074-7696(08)62066-5. [DOI] [PubMed] [Google Scholar]
  • 6.Zhang D.X., Szymura J.M., Hewitt G.M. Evolution and structure conservation of the control region of insect mitochondrial DNA. J. Mol. Evol. 1995;40:382–391. doi: 10.1007/BF00164024. [DOI] [PubMed] [Google Scholar]
  • 7.Zhang D.X., Hewitt G.M. Insect mitochondrial control region: A review of its structure, evolution and usefulness in evolutionary studies. Biochem. Syst. Ecol. 1997;25:99–120. doi: 10.1016/S0305-1978(96)00042-7. [DOI] [Google Scholar]
  • 8.Beckenbach A.T., Stewart J.B. Insect mitochondrial genomics 3: The complete mitochondrial genome sequences of representatives from two neuropteroid orders: A dobsonfly (order Megaloptera) and a giant lacewing and an owlfly (order Neuroptera) Genome. 2009;52:31–38. doi: 10.1139/G08-098. [DOI] [PubMed] [Google Scholar]
  • 9.Saito S., Tamura K., Aotsuka T. Replication origin of mitochondrial DNA in insects. Genetics. 2005;171:1695–1705. doi: 10.1534/genetics.105.046243. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Karr J.R. Defining and measuring river health. Freshw. Biol. 1999;41:221–234. doi: 10.1046/j.1365-2427.1999.00427.x. [DOI] [Google Scholar]
  • 11.Chen Z.T., Du Y.Z. Comparison of the complete mitochondrial genome of the stonefly Sweltsa longistyla (Plecoptera: Chloroperlidae) with mitogenomes of three other stoneflies. Gene. 2015;558:82–87. doi: 10.1016/j.gene.2014.12.049. [DOI] [PubMed] [Google Scholar]
  • 12.Chen Z.T., Du Y.Z. Complete mitochondrial genome of Capnia zijinshana (Plecoptera: Capniidae) and phylogenetic analysis among stoneflies. J. Asia Pac. Entomol. 2017;20:305–312. doi: 10.1016/j.aspen.2017.01.013. [DOI] [Google Scholar]
  • 13.Chen Z.T., Wu H.Y., Du Y.Z. The nearly complete mitochondrial genome of a stonefly species, Styloperla sp. (Plecoptera: Styloperlidae) Mitochondrial DNA Part A. 2016;27:2728–2729. doi: 10.3109/19401736.2015.1046166. [DOI] [PubMed] [Google Scholar]
  • 14.Elbrecht V., Poettker L., John U., Leese F. The complete mitochondrial genome of the stonefly Dinocras cephalotes (Plecoptera, Perlidae) Mitochondrial DNA. 2015;26:469–470. doi: 10.3109/19401736.2013.830301. [DOI] [PubMed] [Google Scholar]
  • 15.Huang M., Wang Y., Liu X., Li W., Kang Z., Wang K., Li X., Yang D. The complete mitochondrial genome and its remarkable secondary structure for a stonefly Acroneuria hainana Wu (Insecta: Plecoptera, Perlidae) Gene. 2015;557:52–60. doi: 10.1016/j.gene.2014.12.009. [DOI] [PubMed] [Google Scholar]
  • 16.Stewart J.B., Beckenbach A.T. Insect mitochondrial genomics 2: The complete mitochondrial genome sequence of a giant stonefly, Pteronarcys princeps, asymmetric directional mutation bias, and conserved plecopteran A+T-region elements. Genome. 2006;49:815–824. doi: 10.1139/G06-037. [DOI] [PubMed] [Google Scholar]
  • 17.Qian Y.H., Wu H.Y., Ji X.Y., Yu W.W., Du Y.Z. Mitochondrial genome of the stonefly Kamimuria wangi (Plecoptera: Perlidae) and phylogenetic position of Plecoptera based on mitogenomes. PLoS ONE. 2014;9:e86328. doi: 10.1371/journal.pone.0086328. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Sproul J.S., Houston D.D., Nelson C.R., Evans R.P., Crandall K.A., Shiozawa D.K. Climate oscillations, glacial refugia, and dispersal ability: Factors influencing the genetic structure of the least salmonfly, Pteronarcella badia (Plecoptera), in western North America. BMC Evol. Biol. 2015;15:279. doi: 10.1186/s12862-015-0553-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Vasco E., Florian L. The mitochondrial genome of the Arizona Snowfly Mesocapnia arizonensis (Plecoptera, Capniidae) Mitochondrial DNA Part A. 2016;27:3365–3366. doi: 10.3109/19401736.2015.1018223. [DOI] [PubMed] [Google Scholar]
  • 20.Wu H.Y., Ji X.Y., Yu W.W., Du Y.Z. Complete mitochondrial genome of the stonefly Cryptoperla stilifera Sivec (Plecoptera: Peltoperlidae) and the phylogeny of Polyneopteran insects. Gene. 2014;537:177–183. doi: 10.1016/j.gene.2013.12.044. [DOI] [PubMed] [Google Scholar]
  • 21.Wang K., Ding S., Yang D. The complete mitochondrial genome of a stonefly species, Kamimuria chungnanshana Wu, 1948 (Plecoptera: Perlidae) Mitochondrial DNA Part A. 2016;27:3810–3811. doi: 10.3109/19401736.2015.1082088. [DOI] [PubMed] [Google Scholar]
  • 22.Wang K., Wang Y., Yang D. The complete mitochondrial genome of a stonefly species, Togoperla sp. (Plecoptera: Perlidae) Mitochondrial DNA Part A. 2016;27:1703–1704. doi: 10.3109/19401736.2014.961130. [DOI] [PubMed] [Google Scholar]
  • 23.Wang Y., Cao J., Li W. The complete mitochondrial genome of the styloperlid stonefly species Styloperla spinicercia Wu (Insecta: Plecoptera) with family-level phylogenetic analyses of the Pteronarcyoidea. Zootaxa. 2017;4243:125–138. doi: 10.11646/zootaxa.4243.1.5. [DOI] [PubMed] [Google Scholar]
  • 24.Zhou C., Tan M., Du S., Zhang R., Machida R., Zhou X. The mitochondrial genome of the winter stonefly Apteroperla tikumana (Plecoptera, Capniidae) Mitochondrial DNA Part A. 2016;27:3030–3032. doi: 10.3109/19401736.2015.1063120. [DOI] [PubMed] [Google Scholar]
  • 25.Clary D.O., Wolstenholme D.R. The ribosomal RNA genes of Drosophila mitochondrial DNA. Nucleic Acids Res. 1985;13:4029–4045. doi: 10.1093/nar/13.11.4029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Wei S.J., Shi M., Chen X.X., Sharkey M.J., van Achterberg C., Ye G.Y., He J.H. New views on strand asymmetry in insect mitochondrial genomes. PLoS ONE. 2010;5:e12708. doi: 10.1371/journal.pone.0012708. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Ojala D., Montoya J., Attardi G. tRNA punctuation model of RNA processing in human mitochondria. Nature. 1981;290:470–474. doi: 10.1038/290470a0. [DOI] [PubMed] [Google Scholar]
  • 28.Garey J.R., Wolstenholme D.R. Platyhelminth mitochondrial DNA: Evidence for early evolutionary origin of a tRNAserAGN that contains a dihydrouridine arm replacement loop, and of serine-specifying AGA and AGG codons. J. Mol. Evol. 1989;28:374–387. doi: 10.1007/BF02603072. [DOI] [PubMed] [Google Scholar]
  • 29.Abascal F., Posada D., Knight R.D., Zardoya R. Parallel evolution of the genetic code in arthropod mitochondrial genomes. PLoS Biol. 2006;4:711–718. doi: 10.1371/journal.pbio.0040127. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Abascal F., Posada D., Zardoya R. The evolution of the mitochondrial genetic code in arthropods revisited. Mitochondrial DNA. 2012;23:84–91. doi: 10.3109/19401736.2011.653801. [DOI] [PubMed] [Google Scholar]
  • 31.Crozier R.H., Crozier Y.C. The mitochondrial genome of the honeybee Apis mellifera: Complete sequence and genome organization. Genetics. 1993;133:97–117. doi: 10.1093/genetics/133.1.97. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Korkmaz E.M., Budak M., Ördek M.N., Başıbüyük H.H. The complete mitogenomes of Calameuta filiformis (Eversmann, 1847) and Calameuta idolon (Rossi, 1794) (Hymenoptera: Cephidae): The remarkable features of the elongated A+T rich region in Cephini. Gene. 2016;576:404–411. doi: 10.1016/j.gene.2015.10.050. [DOI] [PubMed] [Google Scholar]
  • 33.Grant J.R., Stothard P. The CGView Server: A comparative genomics tool for circular genomes. Nucleic Acids Res. 2008;36:181–184. doi: 10.1093/nar/gkn179. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Bernt M., Donath A., Jühling F., Externbrinka F., Florentz C., Fritzsch G., Pützh J., Middendorf M., Stadler P.F. MITOS: Improved de novo metazoan mitochondrial genome annotation. Mol. Phylogenet. Evol. 2013;69:313–319. doi: 10.1016/j.ympev.2012.08.023. [DOI] [PubMed] [Google Scholar]
  • 35.Laslett D., Canbäck B. ARWEN, a program to detect tRNA genes in metazoan mitochondrial nucleotide sequences. Bioinformatics. 2008;24:172–175. doi: 10.1093/bioinformatics/btm573. [DOI] [PubMed] [Google Scholar]
  • 36.Tamura K., Stecher G., Peterson D., Filipski A., Kumar S. MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 2013;30:2725–2729. doi: 10.1093/molbev/mst197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Perna N.T., Kocher T.D. Patterns of nucleotide composition at fourfold degenerate sites of animal mitochondrial genomes. J. Mol. Evol. 1995;41:353–358. doi: 10.1007/BF01215182. [DOI] [PubMed] [Google Scholar]
  • 38.Markham N.R., Zuker M. DINAMelt web server for nucleic acid melting prediction. Nucleic Acids Res. 2005;33:W577–W581. doi: 10.1093/nar/gki591. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Larkin M.A., Blackshields G., Brown N.P., Chenna R., McGettigan P.A., McWilliam H., Valentin F., Wallace I.M., Wilm A., Lopez R., et al. ClustalW and ClustalX version 2.0. Bioinformatics. 2007;23:2947–2948. doi: 10.1093/bioinformatics/btm404. [DOI] [PubMed] [Google Scholar]
  • 40.Huelsenbeck J.P., Ronquist F. Mrbayes: Bayesian inference of phylogenetic trees. Bioinformatics. 2001;17:754–755. doi: 10.1093/bioinformatics/17.8.754. [DOI] [PubMed] [Google Scholar]
  • 41.Stamatakis A. RAxML version 8: A tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics. 2014;30:1312–1313. doi: 10.1093/bioinformatics/btu033. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Rambaut A., Drummond A.J. Tracer Version 1.5 2009. [(accessed on 15 April 2017)]; Available online: http://tree.bio.ed.ac.uk/software/tracer.
  • 43.Rambaut A., Drummond A.J. FigTree Version 1.4.0 2012. [(accessed on 15 April 2017)]; Available online: http://tree.bio.ed.ac.uk/software/figtree.

Articles from International Journal of Molecular Sciences are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES