Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2017 Aug 1.
Published in final edited form as: Appl Physiol Nutr Metab. 2016 Mar 28;41(8):832–841. doi: 10.1139/apnm-2015-0637

Short-term exercise training improves flow-mediated dilation and circulating angiogenic cell number in older sedentary adults

Rian Q Landers-Ramos 1, Kelsey J Corrigan 2, Lisa M Guth 3, Christine N Altom 4, Espen E Spangenburg 5, Steven J Prior 6, James M Hagberg 7
PMCID: PMC5456122  NIHMSID: NIHMS860389  PMID: 27441589

Abstract

Cardiovascular disease risk increases with age due, in part, to impaired endothelial function and decreased circulating angiogenic cell (CAC) number and function. We sought to determine if 10 days of aerobic exercise training improves endothelial function, CAC number, and intracellular redox balance in older sedentary adults. Eleven healthy subjects (4 men, 7 women), 61 ± 2 years of age participated in 60 min of aerobic exercise at 70% maximal oxygen consumption for 10 consecutive days while maintaining body weight. Before and after training, endothelial function was measured as flow-mediated dilation of the brachial artery and fasting blood was drawn to enumerate 3 CAC subtypes. Intracellular reactive oxygen species (ROS) and nitric oxide (NO) in CD34+ CACs were measured using fluorescent probes and reinforced via real-time quantitative polymerase chain reaction. Flow-mediated dilation improved significantly following training (10% ± 1.3% before vs. 16% ± 1.4% after training; P < 0.05). Likewise, CD34+/KDR+ number increased 104% and KDR+ number increased 151% (P < 0.05 for both), although CD34+ number was not significantly altered (P > 0.05). Intracellular NO and ROS levels in CD34+ CACs were not different after training (P > 0.05 for both). Messenger RNA expression of SOD1, endothelial nitric oxide synthase, and NADPH oxidase 2 and neutrophil cytosolic factor 1 in CD34+ CACs was not significantly altered with training (P > 0.05). In conclusion, 10 consecutive days of aerobic exercise increased flow-mediated dilation and CAC number in older, previously sedentary adults, but did not affect intracellular redox balance in CD34+ CACs. Overall, these data indicate that even short-term aerobic exercise training can have a significant impact on cardiovascular disease risk factors.

Keywords: short-term exercise, circulating angiogenic cells, aerobic exercise training, endothelial function

Introduction

Cardiovascular disease (CVD) is the leading cause of death in developed countries around the world and it is estimated that by 2030, over 40% of the population will have some form of CVD with direct medical costs tripling as a result (Heidenreich et al. 2011). Advancing age is a risk factor for the development of CVD due, in part, to impaired endothelial function (Seals et al. 2011). With aging, an imbalance occurs between inflammatory, oxidative stress, and vasodilatory factors that lead to vascular endothelial dysfunction and contribute to the increased risk of developing CVD (Seals et al. 2011).

Chronic aerobic exercise has been found to prevent the age-related dysfunction of the endothelium due, in part, to increased bioavailability of the vasodilator nitric oxide (NO) and improved intracellular redox balance. Our lab and others found that endurance exercise-trained older adults had greater endothelial function compared with sedentary older adults (Seals et al. 2008; Witkowski et al. 2010; DeVan and Seals 2012) and similar endothelial function compared with younger adults (Seals et al. 2008; DeVan and Seals 2012), emphasizing the importance of aerobic exercise training for the preservation of endothelial function with age. Additionally, several studies have reported significant improvements in endothelial function when patients with established coronary artery disease, type 2 diabetes, or other cardiometabolic diseases completed 6–12 weeks of aerobic exercise training, demonstrating that exercise training has the ability to improve endothelial function even in clinical populations (Kwon et al. 2011; Currie et al. 2013; Kim et al. 2014; Schreuder et al. 2015).

Several factors likely contribute to the age-related development of endothelial dysfunction. Circulating angiogenic cells (CACs) are involved in the repair and maintenance of the vascular endothelium, with the number and function of certain CACs being inversely related to CVD risk (Hill et al. 2003; Bielak et al. 2009; Bakogiannis et al. 2012). The term CAC is broad and refers to circulating cells with angiogenic potential. CD34 is the most commonly studied cell surface marker that has been studied and identifies cells with progenitor-like characteristics (Mackie and Losordo 2011). Higher CD34+ cell number is associated with lower prevalence of CVDs (Bielak et al. 2009; Fleissner and Thum 2011). Other CACs express the vascular endothelial growth factor receptor 2 (KDR) and it is believed that CD34+/KDR+ cells have greater angiogenic properties than cells with only the CD34+ marker. Indeed, Bonello et al. found that greater mobilization of CD34+ and CD34+/KDR+ CACs after percutaneous coronary intervention was predictive of target lesion revascularization and negatively predicted major cardiovascular events within 6 months of the procedure (Bonello et al. 2012). Even in the absence of traditional CVD risk factors, CAC number and function are significantly reduced in older compared with younger adults (Hoetzer et al. 2007; Koutroumpi 2012).

Aerobic exercise training in both younger and older adults is associated with increases in CAC number and function. Van Craenbroeck et al. (2010) found that CD34+/KDR+ CAC number increased significantly in a group of heart failure patients after 6 months of aerobic exercise training (Van Craenenbroeck et al. 2010). Regular aerobic exercise also improves intracellular endothelial nitric oxide synthase (eNOS) synthesis in CACs, which is believed to contribute to their role in enhancing endothelial repair (Hoetzer et al. 2007; Van Craenenbroeck and Conraads 2010). Our lab found that CD34+ CACs from endurance-trained younger adults had a more favorable redox balance (Jenkins et al. 2011a) and enhanced paracrine function (Landers-Ramos et al. 2015) compared with their sedentary counterparts. These studies emphasize the importance of regular physical activity for optimal CAC number and function, independent of other CVD risk factors, and they serve as a precedent for studying redox balance in CD34+ CACs.

Previous studies found that 3–12 weeks of exercise training improves both CAC and endothelial cell function (Hoetzer et al. 2007; Gatta et al. 2012; Currie et al. 2013; Grace et al. 2015). However, improvements in aerobic capacity and glucose tolerance have been observed after just 6–10 days of exercise training (Rogers et al. 1988a, 1988b; Baynard et al. 2009; Liu et al. 2015). It is currently unknown if short-term exercise training results in positive endothelial and CAC responses. Significant reductions in CAC number have been observed in our lab with just 10 days of exercise cessation in older athletes (Witkowski et al. 2010) and significant reductions in colony-forming unit (CFU) CAC number and intracellular NO have been observed within the same timeframe in younger adults (Guhanarayan et al. 2014). We hypothesized that 10 days of endurance exercise training would improve flow-mediated dilation (FMD) and increase CAC number and redox balance in CD34+ CACs of older, previously sedentary adults.

Materials and methods

Screening and standard assessments

Subjects were healthy, nonsmoking men and women aged 50–80 years. All subjects reported being generally sedentary for at least 5 years. Women were postmenopausal for >2 years and not prescribed hormone replacement therapy. Subjects were not taking any medications for hypertension or dyslipidemia, or those shown to affect CAC function (Everaert et al. 2010), and had no evidence of diabetes, CVD, or pulmonary disease. Exclusion criteria were as follows: systolic blood pressure, ≥130 mm Hg; diastolic blood pressure, ≥90 mm Hg; serum total cholesterol, ≥200 mg/dL; low-density lipoprotein-cholesterol (LDL-C), ≥130 mg/dL; high-density lipoprotein-cholesterol (HDL-C), ≤35 mg/dL; fasting glucose, ≥100 mg/dL. The University of Maryland College Park and the University of Maryland School of Medicine Institutional Review Boards approved all study procedures and subjects provided written informed consent.

Study design

Initial testing

Subjects reported to the laboratory at the Baltimore Veterans Affairs Medical Center Geriatric Research Education and Clinical Center (GRECC) in Baltimore the morning after an overnight (~12 h) fast. Subjects underwent FMD, maximal oxygen consumption (V̇O2max), and body composition tests were taken. Baseline blood sampling was taken on a separate day as part of the initial testing. Height, weight, seated blood pressure, and body mass index (BMI) were measured, and body composition was assessed using a dual-energy X-ray absorptiometry (DXA) scan.

Exercise training

Subjects participated in treadmill aerobic exercise training daily for 10 days at the Baltimore Veterans Affairs Medical Center GRECC exercise facility. Subjects exercised by walking or running at an intensity of ~70% V̇O2max (prescribed as 65%–75% heart rate reserve) for 60 min. Heart rates were monitored during all sessions and subjects were supervised for at least 9 of the 10 days. Subjects were weighed daily and instructed to maintain the same body weight throughout the 10-day training period by increasing daily caloric intake slightly to balance the increased caloric expenditure. Compliance to the exercise training prescription was 100%.

Final testing

After the 10-day aerobic exercise training program subjects returned to the laboratory and blood sampling and FMD tests were repeated. All tests were performed 24 h after the last bout of exercise, and following a 12-h fast to account for any residual effects of the last exercise bout or differences in food intake prior to blood sampling.

FMD

FMD of the brachial artery was assessed in subjects in the morning after a 12-h fast; subjects refrained from ingesting any vasoactive substances on the morning of the test. Lying in a supine position, an automatic blood pressure cuff was placed on the right arm for intermittent blood pressure and heart rate monitoring throughout the study. Electrodes were placed to monitor a 1 lead electrocardiogram (ECG) from the ultrasound system for ECG gating of measurements. Another blood pressure cuff was placed on the subject’s upper left arm well above the antecubital fossa. The brachial artery was imaged with 2D ultrasound (Philips HDI 5000) in a longitudinal orientation just above the antecubital fossa. Both 2D images of the artery and Doppler assessment of blood velocity through the artery were assessed at baseline. A blood pressure cuff was then inflated to 200 mm Hg and kept inflated for 5 min. The cuff was then deflated to induce a hyperemic stimulus. Longitudinal ultrasound images were recorded continuously from 30 s before to 2 min after cuff deflation. Mid-artery Doppler assessment of the hyperemic velocity was recorded 15 s after cuff deflation. After release of the cuff, the maximum artery dilation was imaged and recorded, typically occurring approximately 1 min after release. Ultrasound images of a standardized magnification were printed at baseline and maximal dilation for measurement. Images were ECG-gated to onset of the R-wave for all measurements. Lumen diameter was measured manually with calipers by a trained sonographer with >15 years of experience, and the median of 5 evenly spaced diameter measurements obtained within a 5-cm segment was used for analyses. Procedures were performed on the same brachial artery location and with the same cuff position at each time point. Measurements were highly reproducible as blinded re-measurement of 10 tests revealed a coefficient of variation of <3% and r2 = 0.97. Results are presented as percent change in brachial artery diameter (hyperemia minus baseline) at zero and 10 days after participating in the prescribed exercise-training program.

DXA

Fat mass, fat-free mass, and percent body fat were measured by DXA (Prodigy, LUNAR Radiation Corp., Madison, Wis., USA).

Framingham coronary heart disease risk score

Risk scores were calculated for each subject based on the Framing-ham study algorithms (Wilson et al. 1998) to estimate an individual’s 10-year risk for coronary heart disease using the following parameters: age, sex, total cholesterol, HDL-C, systolic blood pressure, cigarette smoking, and whether the individual is currently on medications to manage high blood pressure (Wilson et al. 1998).

V̇O2max

V̇O2max was measured by indirect calorimetry (Quark, Cosmed USA, Chicago, Ill., USA) during a constant-speed treadmill protocol with 2% increases in incline every 2 min until exhaustion as previously described (Prior et al. 2014). V̇O2max was defined as the highest oxygen consumption (V̇O2) value obtained for a 30-s increment. V̇O2 was considered maximum if the following standard criteria were met: respiratory exchange ratio > 1.10 or a plateau in V̇O2 with an increase in workload.

Blood sample analyses

Blood samples were obtained in tubes containing 15% potassium EDTA (Becton Dickinson) for measurement of glucose and lipoprotein lipid levels and enumeration and isolation of CACs. Plasma glucose levels were measured with a glucose analyzer (2300 STAT Plus, YSI, Yellow Springs, Ohio, USA). Lipoprotein lipid levels were analyzed using an automated colorimetric assay as previously described (Joseph et al. 2011). Briefly, HDL-C was measured in the supernatant after precipitation with dextran sulfate, and LDL-C was calculated using the Friedewald equation:

[LDL-cholesterol]=[totalcholesterol]-[HDL-cholesterol]-([triglyceriders]/5)

Circulating angiogenic cell number

Flow cytometry was used to determine the number of CD34+, CD34+/KDR+, and KDR+ CACs. Total peripheral blood mononuclear cells (PBMCs) were separated from whole blood using density centrifugation (Ficolle-Paque Plus; GE Healthcare). A total of 1 × 106 PBMCs were Fc Receptor blocked (Miltenyi Biotech), immunostained with monoclonal anti-human CD34-FITC (BD Biosciences) and PE-VEGFR-2 (aka KDR; R&D Systems), and fixed in 2% paraformaldehyde. Flow cytometry analyses were performed in the University of Maryland Baltimore Flow Cytometry Core Facility with an Epics EliteESP flow cytometer (Beckman Coulter Inc., Brea, Calif., USA). The foward–side scatter plot was used to identify the lymphocyte gate and a total of 100 000 events per sample were acquired.

Immunomagnetic cell separation

PBMCs were isolated from venous blood samples using density gradient centrifugation (Ficoll, GE Healthcare). CD34+ was selected as the cell type on which to perform intracellular measures based on the following: frequency of this cell type within total PBMCs, previous work in our lab supporting the use of similar intracellular measures in the same cell type (Jenkins et al. 2011a, 2011b), and literature identifying cells with the CD34 marker as progenitor cells with angiogenic properties (Schatteman et al. 2000; Harraz et al. 2001; Awad 2006; Mackie and Losordo 2011; Losordo et al. 2011). The CD34+ fraction was purified using 2 rounds of immunomagnetic cell separation according to the manufacturer’s instructions (EasySep Immunomagnetic Cell Separation Kits, STEMCELL Technologies) using an antibody specific for CD34. This isolation approach has been published previously from our laboratory (Jenkins et al. 2011a, 2011b; Landers-Ramos et al. 2015) and results in ~50% purity of the cell populations from nonmobilized blood, which is equivalent to or greater than other published purity results (Asahara 1997; Schatteman et al. 2000; Awad 2006). The validity of the CD34+ PBMC immunomagnetic selection procedure has been previously confirmed in our laboratory via fluorescent activated cell sorting analyses and confirmed via messenger RNA (mRNA) expression (Jenkins et al. 2011a, 2011b; Landers-Ramos et al. 2015) as positively selected CD34+ cells displayed strong expression of the target antigens with minimal presence of the target in the negative fractions (data not shown).

Measurement of intracellular NO and reactive oxygen species (ROS)

These experiments were performed in duplicate as previously described (Jenkins et al. 2011a, 2011b; Landers-Ramos et al. 2015) with minor modifications. Briefly, 1.5 × 105 cells were stained with 10 μmol/L 4-amino-5-methylamino-2′,7′-difluorofluorescein (DAF-FM) diacetate for determination of intracellular NO levels or 2 μmol/L 2′,7′-dichlorodihydrofluorescein diacetate (H2DCFDA) for determination of intracellular ROS levels (Molecular Probes). Cells were incubated with fluorescent dyes in a final volume of 150 μL serum-free phosphate-buffered saline (PBS) for 30 min at 37 °C. After incubation, cells were washed with PBS and NO and ROS fluorescence was quantified using a fluorescent microplate reader (BioTek H1 Synergy Hybrid Reader, BioTek Instruments Inc., Winooski, Vt., USA) using excitation and emission filters of 488 and 535 nm, respectively. All fluorescent probes were validated using positive and negative controls as described previously by our lab (Jenkins et al. 2011a, 2011b; Landers-Ramos et al. 2015). Briefly, we observe several fold increases in intracellular DAF-FM and H2DCFDA signals in the presence of an NO donor, Diethylenetriamine NONOate (50 μmol/L) and 3-Morpholinosydnonimine (200 μmol/L), respectively. Pretreatment with 50 U/mL polyethylene glycol-catalase reduces H2DCFDA signal by nearly 40% after exposure to hydrogen peroxide (500 μmol/L). Intra-assay coefficients of variation for ROS and NO were 4.0% and 3.4%, respectively (Landers-Ramos et al. 2015).

Assessment of gene expression by real-time polymerase chain reaction (RT-PCR)

Total RNA was extracted from freshly isolated CACs using the TriZol reagent, quantified using a spectrophotometer (BioTek H1 Synergy Hybrid Reader, BioTek Instruments Inc.) and reverse transcribed to complementary DNA (cDNA) (Life Technologies, Grand Island, N.Y., USA). Quantitative RT-PCR was performed using Applied BioSystems 7300 Real-Time PCR System. Primer Assays were purchased from IDT (Coralville, Iowa, USA) and optimal concentration for efficacy of >90% was determined. Primer sequences are listed in Table 1. Each reaction was performed in duplicate on a 96-well plate and contained iTaq Universal Probes Supermix (Bio-rad, Hercules, Calif., USA), respective primer probe, and the cDNA template. The PCR conditions used were as follows: 95 °C for 3 min, followed by 50 cycles of 95 °C for 15 s, and 60 °C for 45 s. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) primers were used as a control gene and GAPDH cycle thresholds (CTs) were not different across time in the present study. mRNA expression values are presented as 2−ΔCT, where ΔCT is the CT of the target gene minus GAPDH control for each condition.

Table 1.

Real-time polymerase chain reaction genes and primer sequences.

Symbol Gene name Primer sequence
eNOS Endothelial nitric oxide synthase F: CCCTGTAGTTTCCGTGGA
R: TTCCCTCGTGTGAAGAACTG
NOX2 NADPH oxidase 2 F: TCAGCATGCAGTTGAAATTCAG
R: TTCCTCTTTGTCTGGTATTACCG
p47phox Neutrophil cytosolic factor 1 F: CCTGTTCTCTGGATTGATCGC
R: GCACTATGTGTACATGTTCCTG
SOD1 Superoxide dismutase 1 F: CCTCTCTTCATCCTTTGGC
R: AAGGTGTGGGGAAGCATT
GAPDH Glyceraldehyde 3-phosphate dehydrogenase F: TGTAGTTGAGGTCAATGAAGGG
R: ACATCGCTCAGACACCATG
Open in a new tab

Statistical analysis

Sample size calculations were performed a priori based on effect size estimates from findings published in the literature regarding our primary study outcomes — changes in CAC number (Van Craenenbroeck et al. 2010; Witkowski et al. 2010; Gatta et al. 2012) and changes in %FMD (Franzoni et al. 2005; Witkowski et al. 2010; Grace et al. 2015) with exercise training — indicating between 80%–95% power to detect differences with a sample size of 10. Statistical analyses were completed using IBM SPSS Statistics 21 (IBM, Armonk, N.Y., USA). Assumptions of homoscedasticity and normality were verified for all outcome measures. A repeated-measures multivariate analysis of variance was used to test for effects of training (baseline vs. 10 days after exercise training) and sex (men vs. women). For CAC number analyses, when data were not normally distributed, data were analyzed using Wilcoxon signed-rank tests. Statistical significance was accepted at P = 0.05. Values are expressed as means ± standard error of the mean.

Results

Subject characteristics can be found in Table 2. Four men and 7 women completed the study. All subjects were sedentary but were otherwise healthy according to BMI and cardiometabolic risk factors. There were no significant changes in body weight with the 10 days of training.

Table 2.

Subject characteristics (n = 11).

Baseline After training
Age (y) 61±2.1 —
V̇O2max (L/min) 2.2±0.1 2.1±0.2
V̇O2max (mL/(kg·min)) 29.3±1.5 28.7±1.6
Framingham risk (%) 5.3±1.5 5.3±1.9
Fat mass (kg) 24.6±1.7 —
Lean mass (kg) 46.5±3.2 —
Body fat (%) 34±2.2 —
Height (cm) 169±2.2 —
Weight (kg) 74±4.3 74±4.4
BMI (kg/m2) 26±0.9 26±1.1
SBP (mm Hg) 117±6 117±5
DBP (mm Hg) 71±2.3 70±3.3
MAP (mm Hg) 87±3.3 86±3.3
Cholesterol (mg/dL) 198±9.6 185±9.3*
HDL (mg/dL) 56±4.5 56±5.6
LDL (mg/dL) 121±7.4 109±7.6*
TC/HDL (mg/dL) 3.7±0.4 3.6±0.4
LDL/HDL (mg/dL) 2.3±0.3 2.2±0.3*
Triglycerides (mg/dL) 106±12.8 100±13.9
Glucose (mg/dL) 92±2.9 93±3.9
Open in a new tab

Note: Data are presented as means ± SE. BMI, body mass index; DBP, diastolic blood pressure; HDL, high-density lipoprotein; LDL, low-density lipoprotein; MAP, mean arterial pressure; SBP, systolic blood pressure; TC, total cholesterol; V̇O2max, maximal oxygen consumption;

*

Significantly different from baseline value.

FMD

FMD increased significantly and substantially after 10 days of aerobic exercise training in these sedentary older men and women (P < 0.05; Fig. 1). Values increased from 25 ± 2 mm to 27 ± 2.3 mm in response to hyperemia at baseline and from 26 ± 2.7 mm to 30 ± 3 mm after 10 days of exercise training with no changes in baseline diameter as a result of training (P > 0.05), but there was significantly greater hyperemia-induced diameter after exercise training (P < 0.05). Baseline and hyperemia-induced time-averaged mean velocity were similar before and after the exercise training period (P > 0.05 for both). FMD responses increased for nearly every subject after training with no distinguishable differences found as a function of sex.

Fig. 1.

Fig. 1

Open in a new tab

Effects of 10 days of endurance-exercise training on brachial artery flow-mediated dilation in older previously sedentary adults (n = 11). Left panel represents means at baseline and after training and right panel represents individual data with black lines indicating men and gray lines indicating women. *, Statistically significant from baseline at P < 0.05.

Flow cytometry analyses

CD34+/KDR+ cell number increased by 104% and KDR+ cell number increased by 151% after the 10-day aerobic exercise-training program (P < 0.05 for both, Figs. 2A and 2B). Although not statistically significant, CD34+ cell number was numerically 48% higher after 10 days of endurance exercise training (P = 0.28, Fig. 2C). Notably, this difference appears to be driven by 1 individual. No differences in CAC number as a function of sex were found. There was no statistically significant correlation between ΔFMD and ΔCD34+/KDR+, ΔKDR+, or ΔCD34+ (P > 0.05 for all).

Fig. 2.

Fig. 2

Open in a new tab

Basal cell number counts of CD34+/KDR+ (A), KDR+ (B), and CD34+ (C) circulating angiogenic cells (CACs) before and after 10 days of endurance-exercise training (n = 10). Left panels represent means and right panels represent individual data with black lines indicating men and gray lines indicating women. *, Statistically significant from baseline at P < 0.05.

Intracellular NO and ROS

CD34+ intracellular ROS levels were not significantly different after 10 days of aerobic exercise training compared with baseline levels (20 880 ± 4098 vs. 21 449 ± 3139 arbitrary units (a.u.), respectively; P = 0.85). There were also no significant differences in intracellular NO levels before and after 10 days of aerobic exercise training (24 245 ± 3739 vs. 23235 ± 4374 a.u., respectively; P = 0.73). There was large individual variability in both ROS and NO at baseline, after 10 days of exercise training but no differences in intra-cellular ROS or NO were found as a function of sex.

RT-PCR

Expression of genes associated with the production of NO (eNOS) and ROS (superoxide dismutase 1 (SOD1), NADPH oxidase 2 (NOX-2), and neutrophil cytosolic factor 1 (p47phox)) was measured in CD34+ CACs. SOD1 mRNA expression was not significantly different after 10 days of aerobic exercise training compared with baseline (P > 0.05, Fig. 3A). eNOS mRNA was numerically 42% lower after training compared with baseline, but this was not significantly different because of large individual variation (P = 0.13, Fig. 3B). NOX-2 mRNA expression was not significantly different after 10 days of aerobic exercise training compared with baseline (P > 0.05, Fig. 3C). Although not statistically different, p47phox mRNA expression was 63% greater after 10 days of aerobic exercise training compared with baseline (P > 0.05, Fig. 3D). No differences in mRNA expression of any targets were found as a function of sex.

Fig. 3.

Fig. 3

Open in a new tab

Effects of 10 days of endurance-exercise training on SOD1 (A), endothelial nitric oxide synthase (eNOS) (B), NOX2 (C), and p47phox (D) real-time messenger RNA (mRNA) expression for freshly isolated CD34+ circulating angiogenic cells (n = 11). Glyceraldehyde 3-phosphate dehydrogenase was used to normalize all data. Left panels represent means and right panels represent individual data with black lines indicating men and gray lines indicating women. *, Statistically significant from baseline at P < 0.05.

Discussion

Aerobic exercise training is beneficial for individuals of all ages and has been used successfully as a means of preventing and reversing age- and CVD-related endothelial dysfunction (Seals et al. 2008; Van Craenenbroeck et al. 2010; DeVan and Seals 2012; Grace et al. 2015). We tested whether a short-term aerobic exercise-training program results in positive cardiovascular changes, specifically in terms of FMD, CAC number, and CAC intracellular measures. The major findings of this study were that just 10 days of aerobic exercise training was sufficient to increase CD34+/KDR+ and KDR+ CAC number and improve FMD in previously sedentary older adults.

Aging is associated with the development of CVD and dysfunction of the vascular endothelium that, in part, can be attributed to a decrease in NO bioavailability from oxidative stress and reduced antioxidant defenses (Seals et al. 2011). However, studies comparing older athletes with nonathletes have found that lifelong exercise can attenuate this age-related development of endothelial dysfunction (Seals et al. 2008; DeVan and Seals 2012). Even 6–8 weeks of exercise training in older adults has been found to improve FMD in both healthy individuals (Grace et al. 2015) and those with CVD (Green et al. 2003; Kim et al. 2014). However, few studies have assessed the effects of short-term exercise on FMD. Our finding that 10 days of daily exercise improves FMD are concordant with a previous report that as little as 4 days of hand-grip exercise (20 min per day) improved brachial artery FMD (Allen et al. 2003). Conversely, Baynard et al (2009) found that 10 consecutive days of aerobic exercise training did not improve FMD in obese older adults (Baynard et al. 2009). Because the present study included leaner subjects, this suggests that obesity may mitigate the timeframe for FMD adaptations to aerobic exercise training.

Low CAC number is associated with older age (Heiss et al. 2005), physical inactivity (Heiss et al. 2005; Volaklis et al. 2013), and reduced cardiovascular health status (Koutroumpi 2012). The progression of CVD may be due, in part, to a lack of a sufficient number of CACs to aid in the preservation of endothelial integrity with age (Hill et al. 2003). An acute bout of exercise has been shown to mobilize CACs from the bone marrow and increase circulating cell number (Mobius-Winkler et al. 2009; Sandri et al. 2010); thus, routine exercise is expected to result in regular, intermittent mobilization of CACs. The shortest exercise training period found in the previous literature that investigated CAC number found increases in CD34+/KDR+ CACs after 3 weeks in older heart failure patients exercising for 30 min twice a day at 75%–85% V̇O2max (Gatta et al. 2012). To our knowledge, the current study is the first report of increased basal numbers of CD34+/KDR+ and KDR+ CACs after just 10 days of endurance exercise training in healthy older adults.

Contrary to our hypothesis, we did not detect a significant increase in the number of CD34+ CACs after 10 days of aerobic exercise training; however, this finding is concordant with reports showing no significant changes in CD34+ number (Cesari et al. 2012; Keser et al. 2013) despite differences in CD34+/KDR+ number (Cesari et al. 2012) after exercise training. This suggests that the signals elicited by exercise affect mobilization of CACs with an endothelial lineage to a greater degree or that exercise may be causing a shift in CACs to a more endothelial phenotype (i.e., those expressing KDR, also known as the receptor for vascular endothelial growth factor-2 (VEGFR-2)). Increases in NO bioavailability and signaling factors such as VEGF and SDF-1, among others, result in the release of CACs from the bone marrow (Fleissner and Thum 2011). It is interesting to speculate that endothelial factors may preferentially induce mobilization of CACs with a more endothelial phenotype (e.g., CD34+/KDR+ and KDR+), but not the entire population of CD34+ cells. However, direct measurements of these factors as well as evidence of preferential release of these cells with exercise are necessary to confirm these speculations.

Previous studies have found strong correlations between CAC number and FMD response to hyperemia (Hill et al. 2003; Witkowski et al. 2010). Indeed, some have found that the use of CAC number to predict vascular function in adults was equivalent to or greater than traditional CVD risk factors (Hill et al. 2003). In the present study, change in %FMD measures with 10 days of exercise training was not significantly correlated with change in any CAC subtype number. Heiss et al. (2005) found that attenuations in the maintenance of vascular integrity with older age were related more to reductions in CAC function (i.e., CAC migration and proliferation) than quantitative differences in CAC numbers (Heiss et al. 2005). Thus, future work should aim to determine whether functional measures in CACs serve as an alternative predictor of vascular homeostasis in older adults in response to exercise training.

When markers of oxidative stress were assessed, we found that there was no effect of 10-day exercise training on eNOS, SOD1, NOX2, or p47phox mRNA expression, or on intracellular ROS or NO measures in CD34+ CACs. Our lab has previously found more favorable CD34+ CAC intracellular redox balance (lower NO and superoxide levels) in young endurance-trained adults compared with their sedentary counterparts (Jenkins et al. 2011a). Our previous and current studies differ in 2 major ways in that subjects were younger, college-aged men, and that the study design was cross-sectional with the endurance-trained subjects reporting being regularly physically active for the past 5 years (Jenkins et al. 2011a). As such, we can speculate that if improvements in intracellular redox balance occur with aerobic exercise training, the age of the individual, and/or the length of the exercise-training period may impact these effects. Future studies should include a younger control group to better address these questions.

An acute intense bout of exercise is known to elicit increases in both ROS and NO in many tissues (especially in sedentary individuals), whereas regular, repeated exercise bouts result in a more blunted effect as redox balance improves compared with baseline levels (Nikolaidis et al. 2012). However, to our knowledge, a time course of potential improvements in CAC intracellular redox balance has not yet been established. Thus, we could speculate that if improvements in intracellular redox balance occur in CD34+ CACs from older adults with exercise, a training program longer than 10 days would be necessary to elicit these improvements.

It is also possible that intracellular ROS and NO levels may differ in CAC subpopulations other than CD34+. Indeed, Guhanarayan et al. (2014) found that 10 days of reduced physical activity is sufficient to decrease CFU number and CFU intracellular NO, but this was not evident in the freshly isolated CD34+ CACs. This suggests that there is a cell-type specific response and that some CACs could adapt or respond more quickly to changes in their intracellular environment. In the present study, our cell-sampling methods did not yield adequate numbers of cells to assess ROS and NO changes in CD34+/KDR+ and KDR+ CACs. As our lab has previously found differences in both CD34+ cell number and intracellular redox balance as a function of reduced physical activity (Witkowski et al. 2010) and aerobic exercise (both chronic and acute) (Jenkins et al. 2011a), respectively, we selected this cell type as our focus for mRNA and intracellular measures of ROS and NO. Future studies should investigate intracellular ROS and NO in other CAC subtypes to determine if differences in intracellular redox state are cell-type specific.

When interpreting our findings, it is important to consider that despite being older and sedentary our subjects were otherwise healthy, not on medication, and free of traditional CVD risk factors (Table 2). In fact, FMD measures at baseline were high compared with some other studies assessing FMD in both older (Green et al. 2003; Pierce et al. 2011) and younger (Allen et al. 2003; Pierce et al. 2011; Llewellyn et al. 2012) adults. Thus, although interesting and in line with some other studies (Seals et al. 2008; DeVan and Seals 2012; Gatta et al. 2012), it is unclear whether our findings can be extrapolated to populations with CVD.

There is some disagreement in the field regarding the ideal cuff placement to determine the most accurate endothelial-dependent FMD response. In the current study, we used upper arm occlusion rather than forearm occlusion. Using this method, the buildup of metabolites as a result of tissue ischemia can contribute to the dilatory response making the response only partly mediated by NO (Doshi et al. 2001). However, Vogel et al. (2000) found better separation of subjects with and without coronary risk factors using the upper arm technique compared with the forearm occlusion (Vogel et al. 2000). Thus, although the method used in the current study is valid, interpretation of our FMD data in relation to other studies using forearm occlusion may be difficult. Indeed, this may explain the discrepancies between the present study and the Baynard et al. (2009) study that employed a similar short-term aerobic exercise program (Baynard et al. 2009).

Notably, adherence rates to the 10-day exercise program were 100%, despite relatively high exercise intensity (70% of the subjects’ V̇O2max) and duration (60 min) of daily exercise. This exercise program falls within the higher range of the recommended physical activity for older adults prescribed by the American College of Sports Medicine (American College of Sports Medicine et al. 2009), and the program was well-tolerated by the subjects indicating that healthy older adults are capable of exercise training in this capacity and may derive some novel cardiovascular health benefits within just the first 10 days after adoption. Given the multitude of benefits of regular exercise, it is critical that clinicians continue to prescribe and educate older adults about the benefits of aerobic exercise training.

Although women are at a lower risk for CVD at a younger age, older men and women have similar rates of cardiovascular events and CVD is the leading cause of death for both men and women (Gillespie et al. 2013). As such, it is important that we include both sexes when studying CACs that may be used in cell therapies. In this study we detected no significant differences in outcome measures as a function of sex. However, future studies with a larger sample size of men and women so that the study is adequately powered to detect sex differences are necessary to determine whether differences in CAC number or function exist as a function of sex.

In the present study, body composition was assessed at baseline but not after the 10-day exercise-training period. Previous studies indicate that an exercise training program of this length would not be expected to substantially alter body composition (Cononie et al. 1994; Houmard et al. 1995; Kang et al. 1996; Cox et al. 1999; Youngren et al. 2001). We did find that although most CVD risk factors assessed were unchanged, total and LDL cholesterol were significantly reduced after the 10-day exercise-training period. Thus, it appears that in this short-term exercise training program, enhancements in novel CVD risk factors (i.e., CAC number and FMD) occur in the absence of changes in aerobic fitness and some conventional risk factors, but not total nor LDL cholesterol.

Although we examined the effects of our short-term exercise training program on enumeration of 3 different CAC subtypes, the present study did not comprehensively examine all pro-angiogenic PBMCs. Indeed, a number of different subtypes of PBMCs with pro-angiogenic potential have been identified including CD34−/CD31+ (Landers-Ramos et al. 2015), CD62E+ (Lansford et al. 2016), angiogenic T-cells (Hur et al. 2007; Kushner et al. 2010), and angiogenic monocytes (Favre et al. 2013), among others. Future studies investigating both the number and function of a variety of different pro-angiogenic PBMCs would provide a more comprehensive assessment of the heterogeneous response of CACs to aerobic exercise training.

In conclusion, 10 days of aerobic exercise training in previously sedentary, but otherwise healthy older men and women improved FMD and increased CD34+/KDR+ and KDR+ CAC number; however, these beneficial adaptations appear to be independent of alterations in CD34+ cell number and intracellular redox balance. Together, these data provide the rationale for future studies investigating the effects of regular exercise on CAC populations, as well as the time course of cardiovascular adaptations with aerobic exercise training in both healthy and CVD patients who may benefit from exercise as a treatment or prevention strategy.

Acknowledgments

We thank the study volunteers for their time and commitment to this study.

Funding: R.Q.L., L.M.G., and C.N.A. were supported by National Institutes of Health (NIH) Predoctoral Institutional Training Grant T32AG000268 (to J.M.H.). R.Q.L. was supported by the University of Maryland Summer Research Fellowship and the Ann G. Wylie Dissertation Fellowship. S.J.P. was supported by a Paul B. Beeson Career Development Award in Aging (K23-AG040775 and the American Federation for Aging Research). This study was supported by NIH R21-HL98810 (to J.M.H.); the University of Maryland Department of Kinesiology Graduate Research Initiative Fund (to R.Q.L.); the Baltimore Veterans Affairs Geriatric Research, Education, and Clinical Center (GRECC); and the University of Maryland Claude D. Pepper Center (P30-AG028747).

Footnotes

Conflict of interest statement

No competing interests are reported.

Author contributions: R.Q.L., E.E.S., S.J.P., and J.M.H. conceived and designed the research experiments. R.Q.L., K.J.C., L.M.G., and C.N.A. performed the experiments and collected the data. Analysis and interpretation of data was performed by R.Q.L., E.E.S., S.J.P., and J.M.H. R.Q.L. drafted the manuscript; K.J.C., L.M.G., C.N.A., E.E.S., S.J.P., and J.M.H. edited and revised the manuscript and provided important intellectual content. All authors approved the final version of the manuscript.

Contributor Information

Rian Q. Landers-Ramos, Department of Kinesiology, University of Maryland, College Park, MD 20742-2611, USA

Kelsey J. Corrigan, Department of Kinesiology, University of Maryland, College Park, MD 20742-2611, USA

Lisa M. Guth, Department of Kinesiology, University of Maryland, College Park, MD 20742-2611, USA

Christine N. Altom, Department of Kinesiology, University of Maryland, College Park, MD 20742-2611, USA

Espen E. Spangenburg, Department of Kinesiology, University of Maryland, College Park, MD 20742-2611, USA

Steven J. Prior, University of Maryland School of Medicine and Baltimore VA GRECC, Baltimore, MD 21201, USA

James M. Hagberg, Department of Kinesiology, University of Maryland, College Park, MD 20742-2611, USA

References

  1. Allen JD, Geaghan JP, Greenway F, Welsch MA. Time course of improved flow-mediated dilation after short-term exercise training. Med Sci Sports Exerc. 2003;35(5):847–853. doi: 10.1249/01.MSS.0000064931.62916.8A. [DOI] [PubMed] [Google Scholar]
  2. American College of Sports Medicine. Chodzko-Zajko WJ, Proctor DN, Fiatarone Singh MA, Minson CT, Nigg CR, et al. American College of Sports Medicine position stand. Exercise and physical activity for older adults. Med Sci Sports Exerc. 2009;41(7):1510–1530. doi: 10.1249/MSS.0b013e3181a0c95c. [DOI] [PubMed] [Google Scholar]
  3. Asahara T. Isolation of putative progenitor endothelial cells for angiogenesis. Science. 1997;275(5302):964–966. doi: 10.1126/science.275.5302.964. [DOI] [PubMed] [Google Scholar]
  4. Awad O. Differential healing activities of CD34+ and CD14+ endothelial cell progenitors. Arterioscler Thromb Vasc Biol. 2006;26(4):758–764. doi: 10.1161/01.ATV.0000203513.29227.6f. [DOI] [PubMed] [Google Scholar]
  5. Bakogiannis C, Tousoulis D, Androulakis E, Briasoulis A, Papageorgiou N, Vogiatzi G, et al. Circulating endothelial progenitor cells as biomarkers for prediction of cardiovascular outcomes. Curr Med Chem. 2012;19(16):2597–2604. doi: 10.2174/092986712800492995. [DOI] [PubMed] [Google Scholar]
  6. Baynard T, Carhart RL, Weinstock RS, Ploutz-Snyder LL, Kanaley JA. Short-term exercise training improves aerobic capacity with no change in arterial function in obesity. Eur J Appl Physiol. 2009;107(3):299–308. doi: 10.1007/s00421-009-1126-2. [DOI] [PubMed] [Google Scholar]
  7. Bielak LF, Horenstein RB, Ryan KA, Sheedy PF, Rumberger JA, Tanner K, et al. Circulating CD34+ cell count is associated with extent of subclinical atherosclerosis in asymptomatic amish men, independent of 10-year Framingham Risk. Clin Med Cardiol. 2009;3:53–60. doi: 10.4137/cmc.s2111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Bonello L, Harhouri K, Baumstarck K, Arnaud L, Lesavre N, Piot C, et al. Mobilization of CD34+KDR+ endothelial progenitor cells predicts target lesion revascularization. J Thromb Haemost. 2012;10(9):1906–1913. doi: 10.1111/j.1538-7836.2012.04854.x. [DOI] [PubMed] [Google Scholar]
  9. Cesari F, Sofi F, Gori AM, Corsani I, Capalbo A, Caporale R, et al. Physical activity and circulating endothelial progenitor cells: an intervention study. European J Clin Investig. 2012;42(9):927–932. doi: 10.1111/j.1365-2362.2012.02670.x. [DOI] [PubMed] [Google Scholar]
  10. Cononie CC, Goldberg AP, Rogus E, Hagberg JM. Seven consecutive days of exercise lowers plasma insulin responses to an oral glucose challenge in sedentary elderly. J Am Geriatr Soc. 1994;42(4):394–398. doi: 10.1111/j.1532-5415.1994.tb07487.x. [DOI] [PubMed] [Google Scholar]
  11. Cox JH, Cortright RN, Dohm GL, Houmard JA. Effect of aging on response to exercise training in humans: skeletal muscle GLUT-4 and insulin sensitivity. J Appl Physiol. 1999;86(6):2019–2025. doi: 10.1152/jappl.1999.86.6.2019. [DOI] [PubMed] [Google Scholar]
  12. Currie KD, Dubberley JB, McKelvie RS, MacDonald MJ. Low-volume, high-intensity interval training in patients with CAD. Med Sci Sports Exerc. 2013;45(8):1436–1442. doi: 10.1249/MSS.0b013e31828bbbd4. [DOI] [PubMed] [Google Scholar]
  13. DeVan AE, Seals DR. Vascular health in the ageing athlete. Exp Physiol. 2012;97(3):305–310. doi: 10.1113/expphysiol.2011.058792. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Doshi SN, Naka KK, Payne N, Jones CJ, Ashton M, Lewis MJ, Goodfellow J. Flow-mediated dilatation following wrist and upper arm occlusion in humans: the contribution of nitric oxide. Clin Sci. 2001;101(6):629–635. [PubMed] [Google Scholar]
  15. Everaert BR, Van Craenenbroeck EM, Hoymans VY, Haine SE, Van Nassauw L, Conraads VM, et al. Current perspective of pathophysiological and interventional effects on endothelial progenitor cell biology: Focus on Pi3K/AKT/eNOS pathway. Int J Cardiol. 2010;144(3):350–366. doi: 10.1016/j.ijcard.2010.04.018. [DOI] [PubMed] [Google Scholar]
  16. Favre J, Terborg N, Horrevoets AJG. The diverse identity of angiogenic monocytes. Eur J Clin Investig. 2013;43(1):100–107. doi: 10.1111/eci.12009. [DOI] [PubMed] [Google Scholar]
  17. Fleissner F, Thum T. Critical role of the nitric oxide/reactive oxygen species balance in endothelial progenitor dysfunction. Antioxid Redox Signal. 2011;15(4):933–948. doi: 10.1089/ars.2010.3502. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Franzoni F, Ghiadoni L, Galetta F, Plantinga Y, Lubrano V, Huang Y, et al. Physical activity, plasma antioxidant capacity, and endothelium-dependent vasodilation in young and older men. Am J Hypertens. 2005;18(4):510–516. doi: 10.1016/j.amjhyper.2004.11.006. [DOI] [PubMed] [Google Scholar]
  19. Gatta L, Armani A, Iellamo F, Consoli C, Molinari F, Caminiti G, et al. Effects of a short-term exercise training on serum factors involved in ventricular remodelling in chronic heart failure patients. Int J Cardiol. 2012;155(3):409–413. doi: 10.1016/j.ijcard.2010.10.045. [DOI] [PubMed] [Google Scholar]
  20. Gillespie CD, Wigington C, Hong Y Centers for Disease Control and Prevention (CDC) Coronary heart disease and stroke deaths - United States, 2009. MMWR Surveill Summ. 2013;62(S3):157–160. [PubMed] [Google Scholar]
  21. Grace FM, Herbert P, Ratcliffe JW, New KJ, Baker JS, Sculthorpe NF. Age related vascular endothelial function following lifelong sedentariness: positive impact of cardiovascular conditioning without further improvement following low frequency high intensity interval training. Physiol Rep. 2015;3(1):e12234–e12234. doi: 10.14814/phy2.12234. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Green DJ, Walsh JH, Maiorana A, Best MJ, Taylor RR, O’Driscoll JG. Exercise-induced improvement in endothelial dysfunction is not mediated by changes in CV risk factors: pooled analysis of diverse patient populations. AJP: Heart Circul Physiol. 2003;285(6):H2679–H2687. doi: 10.1152/ajpheart.00519.2003. [DOI] [PubMed] [Google Scholar]
  23. Guhanarayan G, Jablonski J, Witkowski S. Circulating angiogenic cell population responses to 10 days of reduced physical activity. J Appl Physiol. 2014;117(5):500–506. doi: 10.1152/japplphysiol.00087.2014. [DOI] [PubMed] [Google Scholar]
  24. Harraz M, Jiao C, Hanlon HD, Hartley RS, Schatteman GC. CD34-blood-derived human endothelial cell progenitors. Stem Cells. 2001;19(4):304–312. doi: 10.1634/stemcells.19-4-304. [DOI] [PubMed] [Google Scholar]
  25. Heidenreich PA, Trogdon JG, Khavjou OA, Butler J, Dracup K, Ezekowitz MD, et al. American Heart Association Advocacy Coordinating Committee; Stroke Council; Council on Cardiovascular Radiology and Intervention; Council on Clinical Cardiology; Council on Epidemiology and Prevention; Council on Arteriosclerosis; Thrombosis and Vascular Biology; Council on Cardiopulmonary; Critical Care, Perioperative and Resuscitation; Council on Cardiovascular Nursing; Council on the Kidney in Cardiovascular Disease; Council on Cardiovascular Surgery and Anesthesia; Interdisciplinary Council on Quality of Care and Outcomes Research. Forecasting the future of cardiovascular disease in the United States: a policy statement from the American Heart Association. Circulation. 2011;123(8):933–944. doi: 10.1161/CIR.0b013e31820a55f5. [DOI] [PubMed] [Google Scholar]
  26. Heiss C, Keymel S, Niesler U, Ziemann J, Kelm M, Kalka C. Impaired progenitor cell activity in age-related endothelial dysfunction. J Am Coll Cardiol. 2005;45(9):1441–1448. doi: 10.1016/j.jacc.2004.12.074. [DOI] [PubMed] [Google Scholar]
  27. Hill JM, Zalos G, Halcox JPJ, Schenke WH, Waclawiw MA, Quyyumi AA, Finkel T. Circulating endothelial progenitor cells, vascular function, and cardiovascular risk. N Engl J Med. 2003;348(7):593–600. doi: 10.1056/NEJMoa022287. [DOI] [PubMed] [Google Scholar]
  28. Hoetzer GL, Van Guilder GP, Irmiger HM, Keith RS, Stauffer BL, DeSouza CA. Aging, exercise, and endothelial progenitor cell clonogenic and migratory capacity in men. J Appl Physiol. 2007;102(3):847–852. doi: 10.1152/japplphysiol.01183.2006. [DOI] [PubMed] [Google Scholar]
  29. Houmard JA, Hickey MS, Tyndall GL, Gavigan KE, Dohm GL. Seven days of exercise increase GLUT-4 protein content in human skeletal muscle. J Appl Physiol. 1995;79(6):1936–1938. doi: 10.1152/jappl.1995.79.6.1936. [DOI] [PubMed] [Google Scholar]
  30. Hur J, Yang HM, Yoon CH, Lee CS, Park KW, Kim JH, et al. Identification of a novel role of T cells in postnatal vasculogenesis: characterization of endothelial progenitor cell colonies. Circulation. 2007;116(15):1671–1682. doi: 10.1161/CIRCULATIONAHA.107.694778. [DOI] [PubMed] [Google Scholar]
  31. Jenkins NT, Landers RQ, Prior SJ, Soni N, Spangenburg EE, Hagberg JM. Effects of acute and chronic endurance exercise on intracellular nitric oxide and superoxide in circulating CD34+ and CD34-cells. J Appl Physiol. 2011a;111(3):929–937. doi: 10.1152/japplphysiol.00541.2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Jenkins NT, Landers RQ, Thakkar SR, Fan X, Brown MD, Prior SJ, et al. Prior endurance exercise prevents postprandial lipaemia-induced increases in reactive oxygen species in circulating CD31+ cells. J Physiol (Lond) 2011b;589(Pt 22):5539–5553. doi: 10.1113/jphysiol.2011.215277. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Joseph LJ, Prigeon RL, Blumenthal JB, Ryan AS, Goldberg AP. Weight loss and low-intensity exercise for the treatment of metabolic syndrome in obese postmenopausal women. J Gerontol Ser A Biol Sci Med Sci. 2011;66A(9):1022–1029. doi: 10.1093/gerona/glr093. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Kang J, Robertson RJ, Hagberg JM, Kelley DE, Goss FL, DaSilva SG, et al. Effect of exercise intensity on glucose and insulin metabolism in obese individuals and obese NIDDM patients. Diabetes Care. 1996;19(4):341–349. doi: 10.2337/diacare.19.4.341. [DOI] [PubMed] [Google Scholar]
  35. Keser I, Suyani E, Aki SZ, Sucak AGT. Transfusion and Apheresis Science. 2. Vol. 49. Elsevier Ltd; 2013. The positive impact of regular exercise program on stem cell mobilization prior to autologous stem cell transplantation; pp. 302–306. [DOI] [PubMed] [Google Scholar]
  36. Kim C, Choi HE, Jung H, Kang SH, Kim JH, Byun YS. Impact of aerobic exercise training on endothelial function in acute coronary syndrome. Ann Rehabil Med. 2014;38(3):388–395. doi: 10.5535/arm.2014.38.3.388. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Koutroumpi M. Circulating endothelial and progenitor cells: evidence from acute and long-term exercise effects. WJC. 2012;4(12):312–326. doi: 10.4330/wjc.v4.i12.312. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Kushner EJ, MacEneaney OJ, Morgan RG, Van Engelenburg AM, Van Guilder GP, DeSouza CA. CD31+ T cells represent a functionally distinct vascular T cell phenotype. Blood Cells Molec Dis. 2010;44(2):74–78. doi: 10.1016/j.bcmd.2009.10.009. [DOI] [PubMed] [Google Scholar]
  39. Kwon HR, Min KW, Ahn HJ, Seok HG, Lee JH, Park GS, Han KA. Effects of aerobic exercise vs. resistance training on endothelial function in women with type 2 diabetes mellitus. Diabetes Metab J. 2011;35(4):364–373. doi: 10.4093/dmj.2011.35.4.364. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Landers-Ramos RQ, Sapp RM, Jenkins NT, Murphy AE, Cancre L, Chin ER, et al. Chronic endurance exercise affects paracrine action of CD31+ and CD34+ cells on endothelial tube formation. AJP: Heart Circ Physiol. 2015;309(3):H407–H420. doi: 10.1152/ajpheart.00123.2015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Lansford KA, Shill DD, Dicks AB, Marshburn MP, Southern WM, Jenkins NT. Effect of acute exercise on circulating angiogenic cell and microparticle populations. Exp Physiol. 2016;101(1):155–167. doi: 10.1113/EP085505. [DOI] [PubMed] [Google Scholar]
  42. Liu M, Gillis LJ, Persadie NR, Atkinson SA, Phillips SM, Timmons BW. Effects of short-term exercise training with and without milk intake on cardiometabolic and inflammatory adaptations in obese adolescents. Pediatr Exerc Sci. 2015;27(4):518–524. doi: 10.1123/pes.2015-0053. [DOI] [PubMed] [Google Scholar]
  43. Llewellyn TL, Chaffin ME, Berg KE, Meendering JR. The relationship between shear rate and flow-mediated dilation is altered by acute exercise. Acta Physiol. 2012;205(3):394–402. doi: 10.1111/j.1748-1716.2012.02417.x. [DOI] [PubMed] [Google Scholar]
  44. Losordo DW, Henry TD, Davidson C, Sup Lee J, Costa MA, Bass T, et al. Intramyocardial, autologous CD34+ cell therapy for refractory angina. Circ Res. 2011;109(4):428–436. doi: 10.1161/CIRCRESAHA.111.245993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Mackie AR, Losordo DW. CD34-positive stem cells: in the treatment of heart and vascular disease in human beings. Tex Heart Inst J. 2011;38(5):474–485. [PMC free article] [PubMed] [Google Scholar]
  46. Mobius-Winkler S, Hilberg T, Menzel K, Golla E, Burman A, Schuler G, Adams V. Time-dependent mobilization of circulating progenitor cells during strenuous exercise in healthy individuals. J Appl Physiol. 2009;107(6):1943–1950. doi: 10.1152/japplphysiol.00532.2009. [DOI] [PubMed] [Google Scholar]
  47. Nikolaidis MG, Kyparos A, Spanou C, Paschalis V, Theodorou AA, Vrabas IS. Redox biology of exercise: an integrative and comparative consideration of some overlooked issues. J Exp Biol. 2012;215(10):1615–1625. doi: 10.1242/jeb.067470. [DOI] [PubMed] [Google Scholar]
  48. Pierce GL, Donato AJ, LaRocca TJ, Eskurza I, Silver AE, Seals DR. Habitually exercising older men do not demonstrate age-associated vascular endothelial oxidative stress. Aging Cell. 2011;10(6):1032–1037. doi: 10.1111/j.1474-9726.2011.00748.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Prior SJ, Blumenthal JB, Katzel LI, Goldberg AP, Ryan AS. Increased skeletal muscle capillarization after aerobic exercise training and weight loss improves insulin sensitivity in adults with IGT. Diabetes Care. 2014;37(5):1469–1475. doi: 10.2337/dc13-2358. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Rogers MA, Yamamoto C, Hagberg JM, Martin WH, Ehsani AA, Holloszy JO. Effect of 6 d of exercise training on responses to maximal and sub-maximal exercise in middle-aged men. Med Sci Sports Exerc. 1988a;20(3):260–264. doi: 10.1249/00005768-198806000-00008. [DOI] [PubMed] [Google Scholar]
  51. Rogers MA, Yamamoto C, King DS, Hagberg JM, Ehsani AA, Holloszy JO. Improvement in glucose tolerance after 1 wk of exercise in patients with mild NIDDM. Diabetes Care. 1988b;11(8):613–618. doi: 10.2337/diacare.11.8.613. [DOI] [PubMed] [Google Scholar]
  52. Sandri M, Bernhard Beck E, Adams V, Gielen S, Lenk K, Höllriegel R, et al. Maximal exercise, limb ischemia, and endothelial progenitor cells. Eur J Cardiovasc Prev Rehabil. 2010;18(1):55–64. doi: 10.1097/HJR.0b013e32833ba654. [DOI] [PubMed] [Google Scholar]
  53. Schatteman GC, Hanlon HD, Jiao C, Dodds SG, Christy BA. Blood-derived angioblasts accelerate blood-flow restoration in diabetic mice. J Clin Invest. 2000;106(4):571–578. doi: 10.1172/JCI9087. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Schreuder THA, Green DJ, Nyakayiru J, Hopman MTE, Thijssen DHJ. Time-course of vascular adaptations during 8 weeks of exercise training in subjects with type 2 diabetes and middle-aged controls. Eur J Appl Physiol. 2015;115(1):187–196. doi: 10.1007/s00421-014-3006-7. [DOI] [PubMed] [Google Scholar]
  55. Seals DR, DeSouza CA, Donato AJ, Tanaka H. Habitual exercise and arterial aging. J Appl Physiol. 2008;105(4):1323–1332. doi: 10.1152/japplphysiol.90553.2008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Seals DR, Jablonski KL, Donato AJ. Aging and vascular endothelial function in humans. Clin Sci. 2011;120(9):357–375. doi: 10.1042/CS20100476. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Van Craenenbroeck EM, Conraads VM. Endothelial progenitor cells in vascular health: focus on lifestyle. Microvasc Res. 2010;79(3):184–192. doi: 10.1016/j.mvr.2009.12.009. [DOI] [PubMed] [Google Scholar]
  58. Van Craenenbroeck EM, Hoymans VY, Beckers PJ, Possemiers NM, Wuyts K, Paelinck BP, et al. Exercise training improves function of circulating angiogenic cells in patients with chronic heart failure. Basic Res Cardiol. 2010;105(5):665–676. doi: 10.1007/s00395-010-0105-4. [DOI] [PubMed] [Google Scholar]
  59. Vogel RA, Corretti MC, Plotnick GD. A comparison of brachial artery flow-mediated vasodilation using upper and lower arm arterial occlusion in subjects with and without coronary risk factors. Clin Cardiol. 2000;23(8):571–575. doi: 10.1002/clc.4960230805. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Volaklis KA, Tokmakidis SP, Halle M. Acute and chronic effects of exercise on circulating endothelial progenitor cells in healthy and diseased patients. Clin Res Cardiol. 2013;102(4):249–257. doi: 10.1007/s00392-012-0517-2. [DOI] [PubMed] [Google Scholar]
  61. Wilson PW, D’Agostino RB, Levy D, Belanger AM, Silbershatz H, Kannel WB. Prediction of coronary heart disease using risk factor categories. Circulation. 1998;97(18):1837–1847. doi: 10.1161/01.CIR.97.18.1837. [DOI] [PubMed] [Google Scholar]
  62. Witkowski S, Lockard MM, Jenkins NT, Obisesan TO, Spangenburg EE, Hagberg JM. Relationship between circulating progenitor cells, vascular function and oxidative stress with long-term training and short-term detraining in older men. Clin Sci. 2010;118(4):303–311. doi: 10.1042/CS20090253. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Youngren JF, Keen S, Kulp JL, Tanner CJ, Houmard JA, Goldfine ID. Enhanced muscle insulin receptor autophosphorylation with short-term aerobic exercise training. Am J Physiol Endocrinol Metab. 2001;280(3):E528–E33. doi: 10.1152/ajpendo.2001.280.3.E528. [DOI] [PubMed] [Google Scholar]

RESOURCES