Skip to main content
Sensors (Basel, Switzerland) logoLink to Sensors (Basel, Switzerland)
. 2017 Apr 25;17(5):945. doi: 10.3390/s17050945

Erratum: Kim, K.-P.; Singh, A.K.; Bai, X.; Leprun, L.; Bhunia, A.K. Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food. Sensors 2015, 15, 22672–22691

Kwang-Pyo Kim 1,2,, Atul K Singh 1,, Xingjian Bai 1, Lena Leprun 1,, Arun K Bhunia 1,3,*
Editor: Alexander Star
PMCID: PMC5461069  PMID: 28441322

The authors wish to correct the oligonucleotide sequence of primer E-LAP-F1 and LIS-R1 in Table 1 in their paper published in Sensors [1], doi:10.3390/s150922672, http://www.mdpi.com/1424-8220/15/9/22672. The following table should be used.

Table 1.

Sequences of species-specific primers based on lap sequence used in this study.

Primer Sequence a Location in Lap Gene Product Size (bp) Specificity
ELAP-F1 5′CGGTCCCCGGGTACCATGGCAATTAAAGAAAATGCGGCC3′ 1–1301 1301 Listeria spp. (except L. grayi, L. rocourtiae)
LIS-R1 5′TTTGTGATACAGAGTTTTTACC3′
Inn-F1 5′GGAGTTATTAACGAAGATACT3′ 286–822 536 L. innocua
Inn-R1 5′TTCTGCTTTTACTTCTTTAGCA3′
IvaSee-F1 5′AAGCTGCAGTTATTCATTCC3′ 1137–1743 606 L. ivanovii, L. seeligeri
IvaSee-R1 5′ATCTAAGAATTTTTGTTTTAGT3′
Wel-F1 5′TTCTCGTATTATCGGTTTACCA3′ 2344–2581 237 L. welshimeri
Wel-R1 5′GCTTCAAGATAGATTTCTTTCAA3′
Mar-F1 5′AGAATATATTTGGAACAGCATC3′ 246–2059 1813 L. marthii
Mar-R1 5′GTTCGATTGCACGGATGGAAAG3′

a Underlining indicates artificial nucleotide addition sites; translation start codon is indicated in bold.

The changes do not affect the scientific results. The manuscript will be updated and the original will remain online on the article webpage, with a reference to this Erratum.

Supplementary Materials

Supplementary File 1

Reference

  • 1.Kim K.-P., Singh A.K., Bai X., Leprun L., Bhunia A.K., Kim, K-P Novel PCR Assays Complement Laser Biosensor-Based Method and Facilitate Listeria Species Detection from Food. Sensors. 2015;15:22672–22691. doi: 10.3390/s150922672. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary File 1

Articles from Sensors (Basel, Switzerland) are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES