Abstract
Background
Although Aspergillus fumigatus is an important human fungal pathogen there are few expression systems available to study the contribution of specific genes to the growth and virulence of this opportunistic mould. Regulatable promoter systems based upon prokaryotic regulatory elements in the E. coli tetracycline-resistance operon have been successfully used to manipulate gene expression in several organisms, including mice, flies, plants, and yeast. However, the system has not yet been adapted for Aspergillus spp.
Results
Here we describe the construction of plasmid vectors that can be used to regulate gene expression in A. fumigatus using a simple co-transfection approach. Vectors were generated in which the tetracycline transactivator (tTA) or the reverse tetracycline transactivator (rtTA2s-M2) are controlled by the A. nidulans gpdA promoter. Dominant selectable cassettes were introduced into each plasmid, allowing for selection following gene transfer into A. fumigatus by incorporating phleomycin or hygromycin into the medium. To model an essential gene under tetracycline regulation, the E. coli hygromycin resistance gene, hph, was placed under the control of seven copies of the TetR binding site (tetO7) in a plasmid vector and co-transfected into A. fumigatus protoplasts together with one of the two transactivator plasmids. Since the hph gene is essential to A. fumigatus in the presence of hygromycin, resistance to hygromycin was used as a marker of hph reporter gene expression. Transformants were identified in which the expression of tTA conferred hygromycin resistance by activating expression of the tetO7-hph reporter gene, and the addition of doxycycline to the medium suppressed hygromycin resistance in a dose-dependent manner. Similarly, transformants were identified in which expression of rtTA2s-M2 conferred hygromycin resistance only in the presence of doxycycline. The levels of doxycycline required to regulate expression of the tetO7-hph reporter gene were within non-toxic ranges for this organism, and low-iron medium was shown to reduce the amount of doxycycline required to accomplish regulation.
Conclusions
The vectors described in this report provide a new set of options to experimentally manipulate the level of specific gene products in A. fumigatus
Background
Aspergillus fumigatus is a saprophytic filamentous fungus that has become the leading mould pathogen in leukemia treatment centers and transplantation units in developed countries, second only to Candida spp. as a cause of systemic mycosis [1]. Despite some advances in therapy, currently available drugs for the treatment of aspergillosis continue to be hampered by problems with efficacy, toxicity, and the emergence of drug resistance. Moreover, a recent review of the Aspergillus case-fatality rate demonstrated that more than 50% of patients die with, or as a result of, aspergillosis, despite having received the reference standard of therapy [2]. The continued expansion of the immunosuppressed population emphasizes the need for increased understanding of both the basic biology and virulence of this mould so that more effective antifungal therapies can be developed.
The completion of the annotated sequence of the A. fumigatus genome is expected to greatly facilitate efforts to determine the contribution of specific gene products to the virulence of this opportunistic pathogen. Unfortunately, the genetic tractability of A. fumigatus has lagged behind some other fungal systems, particularly in the area of conditional expression systems. Inducible promoter systems have proven to be instrumental for the elucidation of gene function in a number of species, most notably with essential genes. Experimental manipulation of gene expression in A. fumigatus is presently accomplished through the use of DNA cassettes that are introduced into the organism as transgenes [3-5], inserted into specific chromosomal loci [3,6] or expressed from a multi-copy nonintegrating vector [7]. An inducible expression system based upon the ethanol-inducible alcA promoter from A. nidulans has been successfully used in A. fumigatus [8]. However, the conditions required to regulate the alcA promoter can have significant effects on the metabolism of the organism and thus remain a concern for many applications, particularly for in vivo studies.
The tetracycline operator system has been used to regulate gene expression in a number of species. The system is based upon the E. coli tetracycline-resistance operon, a regulatory unit that detects minute concentrations of tetracycline and mounts an appropriate resistance response. Expression of the operon is controlled by a repressor protein, TetR that binds to operator sequences (tetO) in the promoter/enhancer region of the operon and prevents transcription. In the presence of tetracycline TetR is unable to bind tetO, which releases the repression and allows the operon to be expressed. This system has been adapted for experimental gene regulation in eukaryotes by fusing TetR to the VP16 transcriptional activating domain of herpes simplex virus VP16, thereby creating a synthetic tetracycline-regulatable transcriptional activator protein (tTA) that can be used to regulate a gene that is under the control of a tetracycline-responsive promoter (reviewed in [9] and shown schematically in Fig. 1). A tetracycline-regulated promoter is constructed by introducing one or more copies of the tetO sequence upstream of a minimal promoter region and the gene of interest (Fig. 1). In the absence of tetracycline, tTA is free to bind to the tetO-promoter and drive the expression of the downstream gene. The addition of tetracycline to the medium prevents tTA from binding the tetO sequences and the promoter is inactive. A variation of this system uses a 'reverse' tetracycline transactivator, rtTA that only binds tetO in the presence of tetracycline. In this case, a gene under tetO control is expressed in the presence of tetracycline, but not in its absence [10].
Figure 1.
Schematic overview of the tetracycline-regulated gene expression system used in this study. The hygromycin resistance gene, hph, is under the control of seven copies of the TetR binding sequence, tetO, linked to a minimal promoter (Pmin). In the tTA-dependent expression system (A), the tTA protein (green circles) promotes hygromycin resistance of A. fumigatus by binding to the tetO promoter and activating transcription of the hph gene. Incorporation of doxycycline into the medium prevents tTA from binding to tetO, resulting in hygromycin sensitivity due to the absence of hph expression. The reverse tTA system (B) takes advantage of a reverse tetracycline transactivator, rtTA (blue circles), that binds to the tetO promoter only in the presence of doxycycline. In this case, rtTA promotes hygromycin resistance of A. fumigatus only when grown in the presence of doxycycline.
The TetR/tetO system is biologically active in a number of eukaryotes [11-13], including yeasts [14-17], but has not yet been adapted to the filamentous fungi. In this report we demonstrate that the tetracycline-regulated promoter system can be used to manipulate gene expression in Aspergillus fumigatus using a simple co-transfection procedure.
Results
Vector construction
Details on plasmid construction are provided in Methods. The plasmids are shown schematically in Fig. 2 and the individual components are summarized in Table-1.
Figure 2.
Schematic representation of plasmid constructions. The tTA gene is expressed from the A. nidulans promoter in three plasmids: p473 (no selection), p434 (hygromycin resistance encoded by hph) and p444 (phleomycin resistance encoded by ble). The rtTA2S-M2 gene is expressed from the A. nidulans gpdA promoter in p474 (no selection), p502 (hygromycin selection encoded by hph) and p480 (phleomycin resistance encoded by ble). Two versions of the tetO7-hph reporter construct are shown below. Plasmid p482 contains seven copies of tetO, a 175 bp minimal gpdA promoter (Pmin), and the hph gene encoding resistance to hygromycin. Plasmid p500 contains the same components, with the addition of a 280 bp fragment of the A. fumigatus cgrA terminator region upstream of the tetO7 promoter to reduce read-through from flanking sequences. All plasmids have been deposited in the Fungal Genetics Stock Center for distribution.
Table 1.
Plasmids and strains
Plasmids | Selectable marker | Transactivator | ||||
Promoter | Gene | Terminator | Promoter | Gene | Terminator | |
p473 | - | - | - | gpdA(-679) | tTA | cgrA |
p434 | gpdA(-679) | hph | trpC | gpdA(-679) | tTA | cgrA |
p444 | gpdA(-679) | ble | CYC1 | gpdA(-679) | tTA | cgrA |
p474 | - | - | - | gpdA(-679) | rtTA | cgrA |
p502 | gpdA(-679) | hph | trpC | gpdA(-679) | rtTA | cgrA |
p480 | gpdA(-679) | ble | CYC1 | gpdA(-679) | rtTA | cgrA |
p482 | tetO7-gpdA(-175) | hph | trpC | - | - | - |
p500 | TcgrA-tetO7-PgpdA(-175) | hph | trpC | - | - | - |
Strains | Genotype/construction | Source | ||||
wt | H237 | David Holden | ||||
Af-tTA-1 | H237 (p444, p482) – isolate 1 | This study | ||||
Af-tTA-2 | H237 (p444, p482) – isolate 2 | This study | ||||
Af-rtTA | H237 (p480, p500) | This study |
Effects of doxycycline on the growth of A. fumigatus
Tetracyclines are small lipophilic antibiotics that readily diffuse into eukaryotic cells by passive diffusion. Doxycycline was selected for this study since it has the highest association equilibrium constant to TetR among the common tetracycline derivatives [18], and has been reported to be most effective in the regulation of tetracycline-regulated promoters in S. cerevisiae [19]. For the doxycycline system to be effective, the levels of doxycycline required to regulate a tetO promoter must not be within a toxic range for the organism. To determine the range of doxycycline concentrations that are tolerated by A. fumigatus, conidia were spotted onto the center of plates of Aspergillus minimal medium containing 0 – 500 μg/ml of doxycycline and colony diameter was measured with time. Concentrations up to 100 μg/ml had little effect on radial growth rates, all of which were within 5% of each other (Fig. 3). However, growth rate was reduced by 16% at 200 μg/ml and by 34% at 500 μg/ml of doxycycline. These results indicate that doxycycline can be used up to 100 μg/ml in minimal medium with no detectable effects on growth rate.
Figure 3.
Sensitivity of A. fumigatus to doxycycline. Ten thousand conidia were spotted onto plates containing Aspergillus minimal medium and the indicated concentrations of doxycycline (μg/ml) and colony diameter was measured for 8 days at 37°C. This experiment used standard Aspergillus minimal medium adjusted to pH 6.5, but similar results were obtained when the pH was adjusted to 8 (data not shown).
Regulated expression of an essential gene by the 'tet-off' system
Inducible promoter systems are particularly useful for creating strains that can be inducibly depleted of an essential gene product [20]. To model an essential gene under tetO control we used heterologous expression of the E. coli hygromycin resistance gene, hph. The hph gene encodes a phosphotransferase that is essential to A. fumigatus in the presence of toxic concentrations of the aminoglycoside antibiotic hygromycin. The hph gene was cloned into a plasmid downstream of a hybrid promoter comprised of seven copies of the TetR binding sequence (tetO7) linked to a 175 bp minimal gpdA promoter from A. nidulans (p482, Fig. 2). The linearized tetO7-hph reporter plasmid was co-transfected into A. fumigatus protoplasts together with a linearized plasmid expressing the tetracycline transactivator, tTA (p444, Table-1) and transformants were selected on the basis of their resistance to hygromycin. Although p444 carries the ble gene, phleomycin selection was not included in this experiment. Thirteen hygromycin-resistant colonies were obtained from protoplasts transformed with the tetO7-hph reporter construct alone. Since these are integrative plasmids, the observed background colonies are presumed to be a consequence of positional effects at the site of integration, resulting in basal levels of expression of the hph reporter construct. By contrast, 192 colonies were obtained following co-transfection with p444 and the tetO7-hph reporter plasmid, suggesting that expression of tTA was driving expression of the tetO7-hph transgene and thus conferring hygromycin resistance. Fifty of these hygromycin-resistant colonies were randomly isolated and plated onto secondary hygromycin selection plates in the presence or absence of 100 μg/ml doxycycline. A total of five transformants showed increased hygromycin sensitivity in the presence of doxycycline, two of which were selected for further analysis: one showing marked hygromycin sensitivity in doxycycline (tTA-2) and one showing moderate hygromycin sensitivity (tTA-1). Conidia from each of these transformants were spotted into the center of a plate of minimal medium containing both doxycycline and hygromycin and the radial growth of the colony was monitored with time. The pH of the medium in this experiment was adjusted to 8 in order to maximize the hygromycin toxicity. As shown in Fig. 4A, the tTA-2 transformant showed tight regulation of the phenotype of hygromycin sensitivity. Doxycycline concentrations as low as 30 μg/ml completely arrested growth, indicating that a concentration of doxycycline that is inert to the growth of A. fumigatus (Fig. 3) can be used to modulate expression of an essential gene under tetO control in this fungus. Importantly, concentrations of doxycycline below 30 μg/ml could be used to manipulate the degree of hygromycin resistance; at 5 μg/ml and 2 μg/ml of doxycycline, the radial growth rate of the organism was reduced by 68% and 55%, respectively (data not shown).
Figure 4.
Effects of doxycycline on the hygromycin sensitivity of two A. fumigatus strains that express tTA (p444) in conjunction with the tetO7-hph reporter gene (p482). (A): Ten thousand conidia from the tTA-1 or tTA-2 transformants were spotted onto the center of a plate containing 1 mg/ml hygromycin and the indicated concentrations of doxycycline (μg/ml) and colony diameter was measured with time. (B): Doxycycline regulation of hph RNA levels in the tTA-1 and tTA-2 strains by Northern blot analysis. Total RNA isolated from overnight cultures grown in the presence of 0–200 μg/ml doxycycline was fractionated by agarose gel electrophoresis, transferred to nylon membranes, and probed with a 32P-labeled hph probe. (C): Hybridization intensity in each lane of the Northern blot in (B) was normalized to levels of the SYBR-green II-stained rRNA by phosphorimager analysis and is shown as a percentage of the levels seen in the tTA-1 transformant in the absence of doxycycline.
Higher levels of doxycycline were required to suppress the growth of the tTA-1 transformant on hygromycin medium (Fig. 4A). Northern blot analysis showed that the tTA-1 strain expressed about 5-fold more hph RNA than tTA-2 (Fig. 4B), which was consistent with the fact that tTA-1 grew faster than tTA-2 in the presence of the same concentration of hygromycin (Fig. 4A, compare tTA-1 and tTA-2, no doxycycline). The doublet shown in Fig. 4B was occasionally seen on Northern blots hybridized to the hph probe and is presumed to represent alternative splicing of the primary hph transcript. The higher levels of hph RNA in the tTA-1 strain could be due to a combination of increased tTA expression (which would be expected to be susceptible to doxycycline regulation) and/or basal expression from one or more integrated copies of the tetO7-hph reporter gene (which would not be affected by doxycycline). Since there was a clear dose-response effect of doxycycline on hph expression and hygromycin resistant growth in this strain (Fig. 4A and 4B), it is likely that the two strains differ primarily in the amount of tTA that they express. Although Northern blot analysis showed barely detectable levels of tTA in either strain (data not shown), undetectable levels of tTA have been reported in other applications of the tetracycline regulatory system and are thought to be due to the toxic effects of overexpression [21]. Since very low levels of tTA protein are actually required to regulate a tetO promoter [21], even a small difference in tTA expression level that is beyond the limit of detection of a Northern blot could influence the amount of doxycycline required to suppress tTA activity in this transformant.
Regulated expression of an essential gene by the 'tet-on' system
A limitation of the tTA-regulated system is that it requires inhibition of transcription rather than activation. To address this, a 'reverse' tTA has been generated (rtTA) that requires interaction of the transactivator with tetracyclines before tetO binding can occur, a system that is referred to as 'tet-on' [10]. Unfortunately, the mutations that reverse the response to doxycycline also reduce binding affinity for doxycycline ten-fold, thus requiring higher levels of doxycycline for maximal induction. Since there may be adverse effects associated with high doxycycline concentration in A. fumigatus under some conditions [22], we chose a derivative of rtTA that contains additional mutations that restore binding affinity for doxycycline [23]. One particular variant, rtTA2S-M2, also contains a multimerized minimal VP16 activation domain to enhance transcriptional activity, and its sequence has been manipulated to optimize expression in eukaryotic cells [23].
Using the same co-transfection approach used for the tTA system, the tetO7-hph reporter (p500, Fig. 2) was co-transfected into A. fumigatus protoplasts together with a linearized plasmid that expresses rtTA2S-M2 (p474, Fig. 2) and the transformants were plated onto medium containing both hygromycin and doxycycline. In this experiment, a modified tetO7-hph reporter was used in which a 280 bp terminator sequence from the A. fumigatus cgrA gene [29] was inserted upstream of the tetO7 repeats to minimize read-through from flanking sequences (p500). Doxycycline was incorporated into the medium at 100 μg/ml to ensure that the tetO7-hph transgene would be expressed at sufficient levels to protect against hygromycin toxicity. Approximately 15% of 27 hygromycin resistant colonies showed reduced growth when shifted to hygromycin medium without doxycycline, one of which was selected for further analysis. As shown in Fig. 5, the inability of this transformant to grow in the presence of hygromycin was restored by the incorporation of as little as 5 μg/ml of doxycycline into the medium, indicating that low levels of doxycycline are biologically active as regulators of the tetO promoter in A. fumigatus. A further increase in hygromycin resistance was achieved at 15 μg/ml of doxycycline, but concentrations above 15 μg/ml had no additional effect. Northern blots analysis confirmed that the levels of hph RNA in the rtTA transformant were increased by the addition of doxycycline to the medium (Fig. 5). When hybridization intensity was normalized to SYBR-green II-stained rRNA bands by phosphorimager analysis, the levels of hph expression in the presence of both concentrations of doxycycline (Fig. 5) were thirty-fold greater than in the absence of added doxycycline.
Figure 5.
Effects of doxycycline on hygromycin sensitivity of a strain expressing rtTA in conjunction with the tetO7-hph reporter gene. Ten thousand conidia were spotted onto the center of a plate containing 750 μg/ml hygromycin and the indicated concentrations of doxycycline (μg/ml) and colony diameter was measured with time. Below: levels of hph RNA levels in the rtTA transformant by Northern blot analysis. Total RNA isolated from overnight cultures grown in the presence of 0, 5 or 50 μg/ml of doxycycline was fractionated by agarose gel electrophoresis, transferred to nylon membranes, and probed with a 32P-labeled hph probe.
Doxycycline-regulation is enhanced by low- iron medium
A recent report has shown that iron blocks the accumulation and activity of tetracyclines in bacteria [24]. Since iron is a standard component of Aspergillus minimal medium, its presence may limit the efficiency of doxycycline-mediated gene regulation, particularly if transcriptional modulators with lower affinity for doxycycline are used. Fig. 6 shows the effects of lowering the iron concentration on doxycycline-mediated suppression of the tetO7-hph transgene in the tTA-1 clone showed in Fig. 4. In comparison to standard minimal medium, where 200 μg/ml of doxycycline was required to reduce expression in this strain (Fig. 4A and 4B), only 5 μg/ml was required in medium containing one tenth the normal concentration of FePO4·4H20 (Fig. 6). This indicates that iron may also impair the accumulation of doxycycline in A. fumigatus and that the choice of medium could have significant effects on doxycycline-mediated gene regulation. Wild type A. fumigatus showed no reduction in radial growth rate on this low-iron minimal medium (data not shown).
Figure 6.
Doxycycline-regulation is enhanced in low-iron medium. Total RNA was isolated from an overnight culture of the tTA-1 transformant (Fig. 4) growing in Aspergillus minimal medium supplemented with one tenth the normal concentration of iron and the indicated concentrations of doxycycline (0–50 μg/ml). RNA was fractionated by agarose gel electrophoresis, transferred to nylon membranes, and probed with a 32P-labeled hph probe. Wild type A. fumigatus is included in the first lane as a negative hybridization control. Hybridization intensity was normalized to levels of SYBR-green II-stained rRNA by phosphorimager analysis and is presented in the graph as a percentage of the signal obtained in the tTA-1 strain in the absence of doxycycline (0).
Discussion
The tetracycline-inducible method of gene regulation has become one of the most popular tools to manipulate gene expression in eukaryotes [25]. The efficacy of the system is attributed to the use of prokaryotic regulatory elements that respond to low concentrations of tetracyclines without affecting eukaryotic physiology, allowing control of gene expression without the concern for pleiotropic effects mediated by the effector. Although widely used in higher eukaryotes, including the model yeast S. cerevisiae [19], the system has not yet been reported in filamentous fungi. Candida albicans and C. glabrata are the only pathogenic fungi in which the system has been successfully applied thus far, however neither of these studies used the tetR-VP16 fusions upon which the tTA and rtTA systems are based [15-17].
In this study we show that both the tet-off (tTA) and tet-on (rtTA) systems can be used to regulate the expression of a hygromycin resistance reporter gene in A. fumigatus. Since the hph gene is essential in the presence of toxic levels of hygromycin, the ability to control hygromycin resistance by modulating the levels of hph transcription validates the system as a tool for analysis of essential genes in A. fumigatus. In the tTA system we found that individual transformants varied in the amount of doxycycline that was necessary to regulate expression of the tetO7-hph reporter gene. Since doxycycline prevents the tTA protein from binding to the tetO sequence, this is most likely due to variability in the amount of tTA protein that is expressed in each transformant. A limitation of the tTA approach described here is that the majority of the hygromycin-resistant transformants from the tTA/tetO7-hph co-transfection were not susceptible to regulation by doxycycline. This may be due in part to leaky expression of the tetO7-hph reporter, caused by enhancers in the proximity of the integration site [21,25]. A second possibility is that the levels of tTA coming from the gpdA promoter used in this study were too high to be removed by non toxic concentrations of doxycycline. Since lower levels of tTA expression are more readily suppressed by doxycycline, it is conceivable that a weaker promoter used to drive tTA would increase the frequency with which doxycycline-regulatable transformants can be isolated. Lower levels of tTA expression could also be accomplished by using a shorter segment of the gpdA promoter used in this study.
The ability to quantitatively control expression from the tetO7-hph reporter gene was also observed in a strain expressing the reverse transactivator, rtTA. Concentrations of doxycycline from 2 μg/ml to 15 μg/ml gave a graded response of hygromycin resistance, indicating that A. fumigatus is responsive to concentrations of doxycycline that are similarly effective in S. cerevisiae [19] and C. albicans [15]. Moreover, this level of sensitivity falls within the range of doxycycline concentrations that can be achieved in mouse tissues [15,16], raising the possibility of using this system to modulate the expression of virulence-related genes in pathogenesis studies on A. fumigatus. Only 15% of the hygromycin-resistant colonies from an rtTA/tetO7-hph co-transfection showed doxycycline-dependent hygromycin resistance however, suggesting that some of the hygromycin resistance was due to leaky expression of the tetO7-hph gene. Leakage of tetO7-regulated genes has been described in other systems, and is attributed to enhancers located in the proximity of the integration site that increase expression of the tetO-linked gene [21,25]. This type of problem will affect tetO7-controlled genes regardless of whether they are integrated randomly in the genome or targeted to specific loci.
Conclusions
This report establishes the utility of the tetracycline-regulated system as an approach to regulate gene expression in A. fumigatus. A limitation of the system was that only 10–15% of the transformants could be regulated by doxycycline, either when tTA or rtTA were used, emphasizing the need to screen for regulatable transformants. A recent approach to limit the problem of leakiness of a tetO-driven gene is the use of trans-silencer proteins comprised of fusions between tetR and a transcriptional silencing domain [26,27]. It is conceivable that the incorporation of a synthetic A. fumigatus-derived trans-silencer protein into the co-transfection approach described in this study would improve the efficiency of the system.
Methods
Vector construction
All vectors are based on the pBluescript plasmid (Stratagene) and were linearized prior to transfection. PCR amplification of components were performed using standard amplification protocols using PfuTurbo DNA polymerase (Stratagene).
Hph Reporter Constructs (p482 and p500)
A segment containing seven copies of the tet operator sequence (tetO7) was PCR amplified from pUHD10-3 [12] with the forward primer 5'-aagcttgcgtatcacgaggccctttc and the reverse primer 5'-aagcttctcgacccgggtaccgag (added HindIII cloning sites are underlined) and cloned into the HindIII site of pBluescript. A 1.6 kb fragment containing a minimal gpdA promoter from A. nidulans (-175 relative to the ATG of the hph open reading frame), the hph gene encoding resistance to hygromycin, and the trpC terminator from A. nidulans, was then PCR amplified from pAN7-1 [28] with forward primer 5'-gagctccccatcttcagtatattcatc (added SstI cloning site underlined) and reverse primer 5'-tctagatcgcgtggagccaagagcgg (added XbaI cloning site underlined) and cloned downstream of tet07 into the SstI and XbaI sites of the plasmid, creating p482. To minimize read-through from flanking sequences into tet07, a 280 bp segment of the terminator region of A. fumigatus cgrA [29] was inserted upstream of tet07 PCR to create p500. The cgrA terminator was PCR amplified from genomic DNA of A. fumigatus isolate H237 using the forward primer 5'aagcttacagcagaagaatctctc (added HindIII cloning site underlined) and reverse primer 5'ctcgagatgattcatgacgtatattc (added XhoI cloning site underlined), cloned into pCR2.1-Topo (Invitrogen), excised with HindIII, and inserted upstream of tetO7 in p482 to create p500.
tTA expression vectors (p473, p434, and p444)
A segment of the A. nidulans gpdA promoter was amplified from pAN7-1 [28] (position -679 to -1, with +1 being the start of the hph open reading frame) using the forward primer 5'-aagcttcggagaatatggagctt (added HindIII cloning site underlined) and the reverse primer 5'-gaattcggtgatgtctgctcaag (added EcoRI cloning site underlined) and cloned into pBluescript at the same sites. The tTA gene was then PCR amplified from pUHD15-1 [12] with the forward primer 5'-gaattctggcaatgtctagattagataaaag (added EcoRI cloning site underlined) and reverse primer 5'-atcatgtctggatcctcgcg (internal BamHI site underlined) and cloned into the EcoRI and BamHI sites downstream of the gpdA (-679) promoter. A 280 bp segment of the terminator region of A. fumigatus cgrA [29] was then amplified from H237 genomic DNA using the forward primer 5'-actagtacagcagaagaatctctc (added SpeI site underlined) and reverse primer 5'-gcggccgcatgattcatgacgtatattc (added NotI site underlined) and inserted into the SpeI and NotI sites downstream of tTA. To introduce phleomycin selection into this construct, a phleomycin resistance cassette containing the A. nidulans gpdA promoter, the Streptoalloteichus hindustanus ble gene encoding resistance to phleomycin, and the S. cerevisiae CYC1 terminator was amplified from pBCphleo (Fungal Genetics Stock Center) using the forward primer 5'-cctcaggcggagaatatggagcttcatcg and the reverse primer 5'-cctcaggaattaaagccttcgagcgtccc. The PCR product was cloned into pCR-Blunt II-TOPO (Invitrogen), excised with KpnI and XhoI and inserted into the PgpdA-tTA construct to create p444. The phleomycin cassette was excised from p444 with HindIII and re-ligated to create p473. To introduce hygromycin selection into p444, the phleomycin cassette was excised with KpnI and HindIII and replaced with a hygromycin resistance cassette (containing the A. nidulans gpdA promoter, the hph gene encoding resistance to hygromycin, and the trpC terminator from A. nidulans) that was amplified from pAN7-1 [28] with forward primer 5'-ggtacccggagaatatggagcttc (added KpnI cloning site underlined) and reverse primer 5'-aagcttgcttgagagttcaaggaag (added HindIII cloning site underlined) to make p434.
rtTA expression vectors
The tTA gene was excised from p473 with EcoRI and BamHI and replaced with an EcoRI-BamHI fragment containing the rtTA2s-M2 variant of rTA from pUHrT62-1 (generous gift from C. Berens, Erlangen, FRG) to create p474. To introduce phleomycin resistance into p474, the phleomycin resistance cassette was excised from p444 with KpnI and HindIII and cloned into the same sites in p474 to create p480. To introduce hygromycin resistance into p474, the hygromycin resistance cassette described in p434 was excised from an unrelated plasmid as a HindIII fragment and cloned into the HindIII site of p474 to make p502.
Strains and culture conditions
The A. fumigatus strains used in this study are listed in Table-1. The wild-type strain, H237, is a clinical isolate. Conidia were harvested from strains grown on Aspergillus minimal medium plates [30]. This minimal medium contains 4.5 μM FePO4·4H20. For low-iron minimal medium, the FePO4·4H20 concentration was reduced to 0.45 μM.
Plasmids were introduced into A. fumigatus protoplasts as previously described [3]. Following transformation, protoplasts were plated onto 20 ml of osmotically stabilized minimal medium containing 100 μg/ml doxycycline (for transformations involving rtTA-expressing plasmids) or no added doxycycline (for transformations involving tTA-expressing plasmids). After incubating at room temperature overnight, each plate was overlaid with 10 ml of minimal medium top agar containing 0.5% agar, 1M sorbitol, and 8 mg hygromycin B (Invivogen, San Diego, CA). Doxycycline was also incorporated into the top agar overlay (100 μg/ml) for experiments involving rtTA-expressing plasmids. Colonies arising on these primary plates were transferred onto secondary selection plates containing the same selective agents, and conidia from the secondary plates were replated onto selective medium at low density to isolate colonies derived from single conidia. All subsequent experiments were performed on monoconidial isolates. For co-transfection experiments, 5 μg of the linearized tetO7-hph reporter construct was co-transfected with 5 μg of the linearized tTA plasmid (p444), or 50 μg of the linearized rtTA plasmid (p474).
For experiments addressing the effects of doxycycline on hygromycin sensitivity, ten thousand conidia were spotted onto the surface of Aspergillus minimal medium agar containing hygromycin and doxycycline at the concentrations specified in the Figure legends. The plates were then incubated at 37°C, and colony diameter was measured with time. Radial growth rates were calculated from the exponential part of the resulting growth curves.
Northern blot analysis
For analysis of hph gene expression, RNA was isolated from overnight cultures in minimal medium supplemented with the indicated concentrations of doxycycline by crushing in liquid nitrogen and extracting RNA from the crushed mycelium with phenol/chloroform. Twenty micrograms of total RNA were fractionated by formaldehyde gel electrophoresis as previously described [20], transferred to positively charged nylon membranes (MSI, Inc., Westborough, MA, USA) and hybridized to a 32P-labeled hph DNA probe under stringent conditions in 50% (v/v) formamide/5XSSC (1X SSC is 0.15 M NaCl/0.015 M Na3·citrate, pH 7.6)/2X Denhardt's solution/10% (w/v) dextran sulfate/1% (w/v) sodium dodecyl sulfate (SDS). The hph probe was an 800 bp EcoRI-BamHI fragment from pAN7-1 [28] containing a segment of the hph open reading frame. Hybridization intensity was quantified with a Phosphorimager (Molecular Dynamics) and normalized for differences in gel loading by quantitating the relative levels of SYBR-green II-stained rRNA (Molecular Probes, Inc., Eugene, OR, USA).
List of abbreviations
tTA tetracycline transactivator
rtTA reverse tetracycline transactivator
TetR tetracycline repressor
tetO TetR binding sequence
hph hygromycin resistance gene
ble phleomycin resistance gene
Authors' contributions
KV participated in vector construction, gene transfer into A. fumigatus, screening of transformants and drafting the manuscript. RB participated in plasmid construction. JCR contributed to the planning of the study. DSA conceived of the project and directed its design and execution. All authors have read and approved the final manuscript.
Acknowledgments
Acknowledgements
We thank Jay card for assistance with the figures. This work was supported by National Institutes of Health Grant R03AI53184 to DSA.
Contributor Information
Keith Vogt, Email: vogt.53@osu.edu.
Ruchi Bhabhra, Email: Ruchi.Bhabhra@uc.edu.
Judith C Rhodes, Email: Judith.Rhodes@uc.edu.
David S Askew, Email: David.Askew@uc.edu.
References
- Ho PL, Yuen KY. Aspergillosis in bone marrow transplant recipients. Crit Rev Oncol Hematol. 2000;34:55–69. doi: 10.1016/s1040-8428(00)00047-0. [DOI] [PubMed] [Google Scholar]
- Lin SJ, Schranz J, Teutsch SM. Aspergillosis case-fatality rate: systematic review of the literature. Clin Infect Dis. 2001;32:358–366. doi: 10.1086/318483. [DOI] [PubMed] [Google Scholar]
- Bhabhra R, Miley MD, Mylonakis E, Boettner D, Fortwendel JR, Panepinto J, Postow M, Rhodes JC, Askew DS. Disruption of the Aspergillus fumigatus gene encoding nucleolar protein CgrA impairs thermotolerant growth and reduces virulence. Infect Immun. 2004;72:4731–4740. doi: 10.1128/IAI.72.8.4731-4740.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Fortwendel JR, Panepinto JC, Seitz AE, Askew DS, Rhodes JC. Aspergillus fumigatus rasA and rasB regulate the timing and morphology of asexual development. Fungal Genet Biol. 2004;41:129–139. doi: 10.1016/j.fgb.2003.10.004. [DOI] [PubMed] [Google Scholar]
- Wasylnka JA, Moore MM. Uptake of Aspergillus fumigatus Conidia by phagocytic and nonphagocytic cells in vitro: quantitation using strains expressing green fluorescent protein. Infect Immun. 2002;70:3156–3163. doi: 10.1128/IAI.70.6.3156-3163.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Langfelder K, Philippe B, Jahn B, Latge JP, Brakhage AA. Differential expression of the Aspergillus fumigatus pksP gene detected in vitro and in vivo with green fluorescent protein. Infect Immun. 2001;69:6411–6418. doi: 10.1128/IAI.69.10.6411-6418.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Liu W, May GS, Lionakis MS, Lewis RE, Kontoyiannis DP. Extra copies of the Aspergillus fumigatus squalene epoxidase gene confer resistance to terbinafine: genetic approach to studying gene dose-dependent resistance to antifungals in A. fumigatus. Antimicrob Agents Chemother. 2004;48:2490–2496. doi: 10.1128/AAC.48.7.2490-2496.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Romero B, Turner G, Olivas I, Laborda F, De Lucas JR. The Aspergillus nidulans alcA promoter drives tightly regulated conditional gene expression in Aspergillus fumigatus permitting validation of essential genes in this human pathogen. Fungal Genet Biol. 2003;40:103–114. doi: 10.1016/S1087-1845(03)00090-2. [DOI] [PubMed] [Google Scholar]
- Gossen M, Bonin AL, Bujard H. Control of gene activity in higher eukaryotic cells by prokaryotic regulatory elements. Trends Biochem Sci. 1993;18:471–475. doi: 10.1016/0968-0004(93)90009-C. [DOI] [PubMed] [Google Scholar]
- Gossen M, Freundlieb S, Bender G, Muller G, Hillen W, Bujard H. Transcriptional activation by tetracyclines in mammalian cells. Science. 1995;268:1766–1769. doi: 10.1126/science.7792603. [DOI] [PubMed] [Google Scholar]
- Weinmann P, Gossen M, Hillen W, Bujard H, Gatz C. A chimeric transactivator allows tetracycline-responsive gene expression in whole plants. Plant J. 1994;5:559–569. doi: 10.1046/j.1365-313x.1994.5040559.x. [DOI] [PubMed] [Google Scholar]
- Gossen M, Bujard H. Tight control of gene expression in mammalian cells by tetracycline-responsive promoters. Proc Natl Acad Sci U S A. 1992;89:5547–5551. doi: 10.1073/pnas.89.12.5547. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Stebbins MJ, Yin JC. Adaptable doxycycline-regulated gene expression systems for Drosophila. Gene. 2001;270:103–111. doi: 10.1016/S0378-1119(01)00447-4. [DOI] [PubMed] [Google Scholar]
- Nagahashi S, Nakayama H, Hamada K, Yang H, Arisawa M, Kitada K. Regulation by tetracycline of gene expression in Saccharomyces cerevisiae. Mol Gen Genet. 1997;255:372–375. doi: 10.1007/s004380050508. [DOI] [PubMed] [Google Scholar]
- Nakayama H, Mio T, Nagahashi S, Kokado M, Arisawa M, Aoki Y. Tetracycline-regulatable system to tightly control gene expression in the pathogenic fungus Candida albicans. Infect Immun. 2000;68:6712–6719. doi: 10.1128/IAI.68.12.6712-6719.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Nakayama H, Izuta M, Nagahashi S, Sihta EY, Sato Y, Yamazaki T, Arisawa M, Kitada K. A controllable gene-expression system for the pathogenic fungus Candida glabrata. Microbiology. 1998;144 ( Pt 9):2407–2415. doi: 10.1099/00221287-144-9-2407. [DOI] [PubMed] [Google Scholar]
- Stoyan T, Gloeckner G, Diekmann S, Carbon J. Multifunctional centromere binding factor 1 is essential for chromosome segregation in the human pathogenic yeast Candida glabrata. Mol Cell Biol. 2001;21:4875–4888. doi: 10.1128/MCB.21.15.4875-4888.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Degenkolb J, Takahashi M, Ellestad GA, Hillen W. Structural requirements of tetracycline-Tet repressor interaction: determination of equilibrium binding constants for tetracycline analogs with the Tet repressor. Antimicrob Agents Chemother. 1991;35:1591–1595. doi: 10.1128/aac.35.8.1591. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gari E, Piedrafita L, Aldea M, Herrero E. A set of vectors with a tetracycline-regulatable promoter system for modulated gene expression in Saccharomyces cerevisiae. Yeast. 1997;13:837–848. doi: 10.1002/(SICI)1097-0061(199707)13:9<837::AID-YEA145>3.0.CO;2-T. [DOI] [PubMed] [Google Scholar]
- Moy TI, Boettner D, Rhodes JC, Silver PA, Askew DS. Identification of a role for Saccharomyces cerevisiae Cgr1p in pre-rRNA processing and 60S ribosome subunit synthesis. Microbiology. 2002;148:1081–1090. doi: 10.1099/00221287-148-4-1081. [DOI] [PubMed] [Google Scholar]
- Freundlieb S, Baron U, Bonin AL, Gossen M, Bujard H. Use of tetracycline-controlled gene expression systems to study mammalian cell cycle. Methods Enzymol. 1997;283:159–173. doi: 10.1016/s0076-6879(97)83014-5. [DOI] [PubMed] [Google Scholar]
- Hughes CE, Harris C, Peterson LR, Gerding DN. Enhancement of the in vitro activity of amphotericin B against Aspergillus spp. by tetracycline analogs. Antimicrob Agents Chemother. 1984;26:837–840. doi: 10.1128/aac.26.6.837. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Urlinger S, Baron U, Thellmann M, Hasan MT, Bujard H, Hillen W. Exploring the sequence space for tetracycline-dependent transcriptional activators: novel mutations yield expanded range and sensitivity. Proc Natl Acad Sci U S A. 2000;97:7963–7968. doi: 10.1073/pnas.130192197. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Avery AM, Goddard HJ, Sumner ER, Avery SV. Iron blocks the accumulation and activity of tetracyclines in bacteria. Antimicrob Agents Chemother. 2004;48:1892–1894. doi: 10.1128/AAC.48.5.1892-1894.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Berens C, Hillen W. Gene regulation by tetracyclines. Constraints of resistance regulation in bacteria shape TetR for application in eukaryotes. Eur J Biochem. 2003;270:3109–3121. doi: 10.1046/j.1432-1033.2003.03694.x. [DOI] [PubMed] [Google Scholar]
- Deuschle U, Meyer WK, Thiesen HJ. Tetracycline-reversible silencing of eukaryotic promoters. Mol Cell Biol. 1995;15:1907–1914. doi: 10.1128/mcb.15.4.1907. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Belli G, Gari E, Piedrafita L, Aldea M, Herrero E. An activator/repressor dual system allows tight tetracycline-regulated gene expression in budding yeast. Nucleic Acids Res. 1998;26:942–947. doi: 10.1093/nar/26.4.942. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Punt PJ, Oliver RP, Dingemanse MA, Pouwels PH, van den Hondel CA. Transformation of Aspergillus based on the hygromycin B resistance marker from Escherichia coli. Gene. 1987;56:117–124. doi: 10.1016/0378-1119(87)90164-8. [DOI] [PubMed] [Google Scholar]
- Boettner. Huebner N, Rhodes JC, Askew DS. Molecular cloning of Aspergillus fumigatus CgrA, the ortholog of a conserved fungal nucleolar protein. Med Mycol. 2001;39:517–521. doi: 10.1080/mmy.39.6.517.521. [DOI] [PubMed] [Google Scholar]
- Cove DJ. The induction and repression of nitrate reductase in the fungus Aspergillus nidulans. Biochim Biophys Acta. 1966;113:51–56. doi: 10.1016/s0926-6593(66)80120-0. [DOI] [PubMed] [Google Scholar]