Skip to main content
The Journal of Biological Chemistry logoLink to The Journal of Biological Chemistry
. 2017 Apr 5;292(23):9540–9550. doi: 10.1074/jbc.M116.773671

Poly(C)-binding protein 1 (Pcbp1) regulates skeletal muscle differentiation by modulating microRNA processing in myoblasts

Ramón A Espinoza-Lewis ‡,1,2, Qiumei Yang ‡,§,1, Jianming Liu ‡,3, Zhan-Peng Huang ‡, Xiaoyun Hu ‡, Daiwen Chen §, Da-Zhi Wang ‡,4
PMCID: PMC5465481  PMID: 28381556

Abstract

Regulation of gene expression during muscle development and disease remains incompletely understood. microRNAs are a class of small non-coding RNAs that regulate gene expression and function post-transcriptionally. The poly(C)-binding protein1 (Pcbp1, hnRNP-E1, or αCP-1) is an RNA-binding protein that has been reported to bind the 3′-UTRs of target genes to regulate mRNA stability and protein translation. However, Pcbp1's biological function and the general mechanism of action remain largely undetermined. Here, we report that Pcbp1 is a component of the miRNA-processing pathway that regulates miRNA biogenesis. siRNA-based inhibition of Pcbp1 in mouse skeletal muscle myoblasts led to dysregulated cellular proliferation and differentiation. We also found that Pcbp1 null mutant mice exhibit early embryonic lethality, indicating that Pcbp1 is indispensable for embryonic development. Interestingly, hypomorphic Pcbp1 mutant mice displayed defects in muscle growth due to defects in the proliferation and differentiation of myoblasts and muscle satellite cells, in addition to a slow to fast myofibril switch. Moreover, Pcbp1 modulated the processing of muscle-enriched miR-1, miR-133, and miR-206 by physically interacting with argonaute 2 (AGO2) and other miRNA pathway components. Our study, therefore, uncovers the important function of Pcbp1 in skeletal muscle and the microRNA pathway, signifying its potential as a therapeutic target for muscle disease.

Keywords: Dicer, microRNA (miRNA), RNA, RNA-binding protein, skeletal muscle, Pcbp, poly(C)-binding proteins

Introduction

Control of muscle cell proliferation and differentiation is essential to the process of muscle development, function, and regeneration. A variety of transcriptional and epigenetic regulators have been demonstrated key to this process (1, 2). Recent studies have linked miRNAs5 to muscle gene expression, muscle development, and disease (3–6). Muscle expressed miRNAs, miR-1, miR-133, and miR-206 in particular, have been demonstrated to play critical roles in myocyte proliferation and differentiation (4, 6). Most importantly, the expression and function of many miRNAs have been associated with muscle diseases (3). However, little is known about whether the miRNA biogenesis pathway, which is involved in the processing and maturation of miRNAs, also participate in the regulation of muscle gene expression and muscle function.

Ribonucleoprotein (RNPs) particles are large heteromeric protein complexes bound to the new, actively transcribed RNA. RNA-binding particles are composed of several “core” and “minor” proteins termed heterogeneous nuclear ribonucleoproteins (hnRNPs) (7–9). However, protein abundance within the RNP complex does not imply hierarchy of function as exemplified in the latest classifications of RNA-binding proteins (9–12). hnRNPs comprise an extensive family of RNA-binding proteins (RBPs) characterized and classified by RNA-binding domain sequence and structure homology (8, 10, 11). The KH-RNA binding domain family of RBPs is composed of the poly(C)-binding proteins (Pcbp1–4, also known as αCP1–4 or hnRNP-E1–4) along with hnRNP-K/J and is characterized by the evolutionary conservation of multiples copies of the ∼70-amino acid KH RNA binding domain (8, 13–15). Pcbp1 is a gene that lacks introns, and its mRNA is highly homologous with that of Pcbp2. It has been rationalized that Pcbp1 originated from a Pcbp2 mRNA transposition event, a further mutation, and eventual positive selection (14, 16). Pcbp1 has been identified as a multilevel regulator of gene expression and protein function, acting as: 1) transcription factor, i.e. regulating expression of eIF4eE or by activating the internal ribosome entry sites of certain genes, such as Bag-1 (17, 18); 2) translation factor, enhancing or suppressing protein expression by its specific binding to poly(C) regions occurring preferentially within the 3′-UTR of target mRNAs or by its interaction with secondary structures in the 5′-UTR or 3′-UTR of the target mRNAs (BAT and DICE regions) (8, 13, 19–23); 3) post-transcriptional regulator, as a modulator of alternative splicing to direct differential gene expression (24, 25); 4) molecular chaperone and stress responder by interacting with other protein partners to induce or inhibit certain cell functions such as iron chelation and hypoxia-response blockade through inhibition of hypoxia-induced factors (HIFs) expression (26).

Pcbp1 is ubiquitously expressed (15, 16); however, Pcbp1 protein expression has been recently identified to be enriched in certain specific organ niches. Indeed, Pcbp1 protein is expressed specifically in chief cells of the gastric mucosa, suggesting that its expression and function are cell context-dependent and related to growth, apoptosis, and proliferation or differentiation (27, 28). Moreover, Pcbp1 expression has been reported to be enhanced in many cancers including prostate cancer and colorectal cancer. Pcbp1 may have a function in epithelial-mesenchymal transformation and metastases, as reports have indicated it acts as a checkpoint by modulating protein translation of the PRL-3 phosphatase mRNA and, thus, activation of AKT (23). Despite the recent reports and accumulation of information on Pcbp1 functions, the overall molecular mechanisms of Pcbp1 function are still not clear. Here, we report a novel function of Pcbp1 and its involvement in the miRNA maturation process that results in the modulation of skeletal muscle proliferation, development, and differentiation.

Results

Pcbp1 interacts with components of the miRNA pathway

We initially identified Pcbp1 from a screen of potential myocardin-interacting proteins in a yeast two-hybrid assay using myocardin as bait (29, 30). However, surprisingly, Pcbp1 and myocardin did not appear to directly interact, although we have observed that Pcbp1 was capable of modulating the transcriptional activity of myocardin with an unknown mechanism. Next, we applied an unbiased approach to identify Pcbp1-interacting proteins. We performed immunoprecipitation and mass spectrometry using specific antibodies against Pcbp1 protein in heart and skeletal muscle tissues of different stages of development (postnatal day 1 and 2-month-old adults). Mass spectrometry results showed that Pcbp1 interacts with argonaute 2 (AGO2), the core member of the RNA-induced silencing complex (RISC) and miRNA-processing machinery (31). This result is in accordance with previous reports that independently indicated that Pcbp1 and AGO2 localize to the P-body (32, 33). Given that Pcbp1 is a RNA-binding protein known to bind to 3′-UTRs of its target mRNAs, we hypothesized that Pcbp1 might interact with the machinery of the miRNA biogenesis and/or target inhibition, which also associate with the 3′-UTRs of mRNAs targeted by miRNAs.

To confirm the interaction of Pcbp1 with AGO2 and other members of the miRNA pathway, we performed co-immunoprecipitation (co-IP) assays using FLAG-tagged Pcbp1 and MYC-tagged candidate proteins. We included the miRNA microprocessor (Dgcr8), the endoribonuclease Dicer, and the RNA-binding protein Trbp as well as members of the RISC machinery (AGO1 and others). Indeed, the co-IP experiments confirmed the interaction between Pcbp1 and AGO2 (Fig. 1). Interestingly, we also found that Pcbp1 interacted preferentially with Trbp, a Dicer co-factor and key modulator of heart development and function (34, 35). Pcbp1 also interacted with AGO1 and Ddx3x (DEAD box helicase 3, X-linked) (36). However, Pcbp1 did not appear to directly interact with Dgcr8 or Dicer (Fig. 1, A and B). Next, we asked whether the interaction of Pcbp1 and its partner proteins is RNA-dependent. We treated the cell extracts with RNase A and H before immunoprecipitation and found that depletion of RNAs did not abolish the interaction between Pcbp1 and AGO2, Ddx3x, and Trbp (Fig. 1, C and D), indicating that these protein-protein interactions are RNA-independent.

Figure 1.

Figure 1.

Pcbp1 interacts with the RISC. A, co-IP assay. FLAG-tagged Pcbp1 and the indicated MYC-tagged proteins were expressed in 293T cells. Protein expression was detected by Western blot (INPUT, upper panel). Protein lysate was precipitated by anti-FLAG antibodies, and the associated proteins were detected by Western blot using anti-MYC antibodies (IP, lower panel). B, summary of co-IP results. Pcbp1 strongly interacts with Trbp, AGO1, AGO2, and Ddx3x. C, FLAG-tagged Pcbp1 and the indicated MYC-tagged proteins were expressed in 293T cells. Protein expression was detected by Western blot (INPUT). D, co-IP assay. Protein lysate was treated with RNase inhibitor (inh) or RNase A and H before precipitation by anti-FLAG antibodies. The associated proteins were detected by Western blot using anti-MYC antibodies. *, immunoglobulin heavy chain.

Pcbp1 is dynamically expressed in skeletal muscle

Previous studies have reported that Pcbp1 mRNA is ubiquitously expressed, yet enriched in cardiac and skeletal muscle (15). We examined Pcbp1 protein expression in mouse skeletal muscle at several stages of development including embryonic (E16.5), postnatal (P0-P7), juvenile (P10-P21), and 2 months old (2m) using Western blot analysis. We found that Pcbp1 protein is dynamically expressed in the skeletal muscle with higher expression levels in embryonic and immature stages of development, whereas its expression is lower in adult muscle (Fig. 2A). Interestingly, we observed that the anti-Pcbp1 antibodies also detected a second, slightly higher molecular weight band that shows increased expression pattern accordance to age. This could be an isoform of the Pcbp1 protein or a post-translationally modified Pcbp1 protein.

Figure 2.

Figure 2.

Expression of Pcbp1 protein in skeletal muscle. A, Western blot detecting Pcbp1 protein levels in mouse skeletal muscles at different stages. GAPDH served as a loading control. B, Western blot detecting Pcbp1 protein levels in C2C12 myoblasts kept in growth medium (GM) or switched to differentiation condition at indicated times. MHC was used to indicate myogenic differentiation. β-Tubulin (β-Tub) served as a loading control. E, embryonic date; P, postnatal date; m, month.

We next examined Pcbp1 protein expression in the mouse skeletal myoblast cell line C2C12. We either maintained the C2C12 cells in growth medium to keep them as undifferentiated myoblasts or induced them to form multinucleated myotubes under differentiation conditions (6). Unexpectedly, we found that the expression levels of Pcbp1 proteins were not drastically altered during myoblast differentiation (Fig. 2B). As a positive control, the expression of MyHC, a muscle terminal differentiation marker, was substantially induced when C2C12 cells were differentiated into myotubes (Fig. 2B).

Inhibition of Pcbp1 enhanced skeletal muscle myoblast differentiation

Next, we investigated the role of Pcbp1 during myoblast differentiation. C2C12 myoblasts were seeded at similar confluence, transfected with siRNA for Pcbp1 (siPcbp1) or control siRNA (siCNTRL). We used two independent siRNAs to knock down Pcbp1. We confirmed that each siRNA or the combination of both siRNAs substantially knocked down the expression of endogenous Pcbp1 (Fig. 3A). Substantial inhibition of endogenous Pcbp1 could be observed even 4 days after siRNA transfection (Fig. 3B). After transfection, C2C12 myoblasts were cultured for 24 h in growth medium; subsequently, they were switched into differentiation medium for 1, 3, and 5 days, respectively. Whereas control myoblasts differentiated into rod-shaped myotubes upon differentiation stimulation, knockdown of Pcbp1 further enhanced the differentiation process (Fig. 3C). Immunostaining using the MF20 antibody, which recognizes myosin heavy chain (MHC), showed a substantial increase of MHC positive multinuclei myotubes (Fig. 3D), supporting the view that inhibition of Pcbp1 enhances myogenic differentiation. Together, these results suggest that Pcbp1 inhibits the skeletal muscle differentiation process in vitro.

Figure 3.

Figure 3.

Pcbp1 regulates myoblast differentiation. A, Western blot detecting Pcbp1 protein levels after siRNA-mediated knockdown in C2C12 myoblasts. NT = non-transfected. B, Western blot detecting Pcbp1 protein levels after siRNA-mediated knockdown in C2C12 myoblasts at the indicated time points. C, morphology of C2C12 myoblasts after transfection with Pcbp1 siRNA or control siRNA and kept in growth medium (GM) or different time points in differentiation medium (DM). D, immunostaining of C2C12 myoblasts for αMHC after transfection with Pcbp1 siRNA or control siRNA.

Pcbp1 is required for animal development

To define the in vivo function of Pcbp1 in skeletal muscle, we generated Pcbp1 mutant mice. The whole coding sequence of the Pcbp1 genomic locus was flanked by the loxP sequences to generate the Pcbp1 floxed allele Pcbp1f/f (Fig. 4A; “Experimental Procedures”). PCR assays and Southern blot analyses were applied to confirm correct gene targeting events (Fig. 4, B and C). Heterozygous mice (Pcbp1f/+), which are phenotypically normal, were intercrossed to obtain homozygous Pcbp1 floxed allele (Pcbp1f/f) mice. Unexpectedly, genotyping of progeny at birth and 4 weeks postnatally from the intercrossing of Pcbp1f/+ mice showed that Pcbp1f/f mice were underrepresented, indicating premature loss of Pcbp1f/f mice (Table 1). This was a surprising result because these Pcbp1f/f mice were not crossed with a Cre mouse line to delete the Pcbp1 genomic sequences. These results suggest that non-deleted Pcbp1 homozygous floxed mice are hypomorphic.

Figure 4.

Figure 4.

Pcbp1 is required for mouse development. A, genomic structure of the mouse Pcbp1 allele and the gene targeting strategy. Arrows = PCR primers for 5′-LoxP genotyping; red triangles, flox cassettes; blue triangles, frt cassettes. TK, thymidine kinase. B, PCR genotyping for the identification of ES cell clones with correct homologous recombination event. Arrows point to correctly targeted clones. C, Southern blot analysis of ES cell clones using neo sequence as a probe. D and E, gross morphology of Pcbp1f/f and control mice at postnatal day 1 (D) and 1 month (E). F, quantitative measurement of body weight of Pcbp1f/f and control mice at P1 and 2 months, respectively. G, quadriceps (Quad), TA, gastrocnemius/soleus (Gas/Sol) from 2-month-old Pcbp1f/f and control mice. Scale bars = 3 mm. H, quantification of muscle weight from 2-month-old Pcbp1f/f and control mice. I, Western blot detecting Pcbp1 protein expression in TA and gastrocnemius/soleus muscles of Pcbp1f/f and control mice. β-Tubulin serves as a loading control. J, quantification of Pcbp1 protein levels in the TA and gastrocnemius/soleus muscles of 2-month-old Pcbp1f/f and control mice. *, p < 0.05.

Table 1.

Genotyping results of Pcbp1f/+ mouse breeding

Genotypes Numbers of pups at P1 Percentage Numbers of mice at 4 weeks Percentage
% %
+/+ 31 33.3 19 25.7
+/f 44 47.3 46 62.2
f/f 18 19.4 9 12.2
Total 93 100 74 100

The Pcbp1f/f mice are smaller in size at birth (Fig. 4D), and this difference is maintained throughout adulthood (Fig. 4E). The body weight of Pcbp1f/f homozygous mice was measured and showed ∼20–30% reduction when compared with their wild type (WT) littermate controls (Fig. 4F). We dissected the tibialis anterior (TA), gastrocnemius (Gast) and quadriceps (Quad) muscles from Pcbp1f/f mice and compared them to those of their WT littermate controls and found that skeletal muscles are smaller in Pcbp1f/f mice (Fig. 4G). Weight measurements further confirmed the above observation. However, the TA weight to tibia length ratio is unchanged, indicating that this growth deficiency is proportional to the whole body and not specific to the muscle groups (Fig. 4H).

Despite their smaller size, Pcbp1f/f mice are viable, albeit with a lower fertility rate. The smaller size and lower weight of Pcbp1f/f led us to investigate if the expression of the Pcbp1 gene was affected by the targeting strategy. Indeed, Quantitative PCR (qPCR and Western blot results show that the expression of the Pcbp1 gene is reduced up to 85% in Pcbp1f/f mice (Fig. 4, I and J). These results indicate that the targeting strategy (flanking the Pcbp1 locus with the loxP sequences) has impaired expression of the Pcbp1 gene and that down-regulation of Pcbp1 affects the development of skeletal muscle and whole body growth in general. Consistent with our observations, a recent report showed that homozygote Pcbp1 mutation leads to embryonic lethality, whereas heterozygote mice exhibit haploinsufficiency; these mice were also smaller in size (37). These results, therefore, suggest that the Pcbp1f/f allele is hypomorphic, leading to the reduced expression of the Pcbp1 gene.

Pcbp1 is required for the growth of skeletal muscle and the development of slow-twitch myofibers

The embryonic lethality of Pcbp1 null mice prevented us from investigating the function of this gene in postnatal and adult mice. Given that the floxed allele of Pcbp1 (Pcbp1f/f) reduced the expression of Pcbp1 protein and resulted in smaller animals, we decided to study putative skeletal muscle defects in these hypomorphic Pcbp1f/f mice. We performed histological sections on tibialis anterior (TA), gastrocnemius (GAS), and quadriceps (Quad) muscles, and our results revealed that transverse section fiber size in Pcbp1f/f skeletal muscles is skewed toward a smaller type. Fibers per cross-section are more numerous, and the distribution of fiber size shifts to the accumulation of smaller fibers compared with that of WT muscles (Fig. 5, A and B).

Figure 5.

Figure 5.

Pcbp1 regulates myocyte size and myofiber type. A, transverse sections of Quadriceps (Quad), gastrocnemius (GAS), and tibialis anterior (TA) from 2-month-old Pcbp1f/f and control mice were stained for laminin. B, cross-sectional areas were measured and the distribution of myocyte size in the indicated muscle types is shown. C, immunostaining to detect fast- and slow-twitch myofibers in TA and soleus muscles. D, quantification of fast- and slow-twitch myofibers in Pcbp1f/f and control mice. Scale bar = 100 μm. *, p < 0.05.

Skeletal muscle myocyte physiological requirements are strongly related to the metabolic state of the muscle fibers. Thus, higher metabolic state correlates with a higher speed of contraction (fast twitch) and vice versa (slow twitch). We, therefore, asked whether the fiber type composition was changed in Pcbp1f/f skeletal muscles. We performed immunohistochemical analysis for slow (anti-MHCα and -β)- and fast-twitch (anti-MHC-IIb) myofiber types in Pcbp1f/f and control skeletal muscles. We observed a decrease in the slow-twitch myofiber type and a induction in the fast-twitch myofiber type in the soleus and TA muscle bundles of Pcbp1f/f mice when compared with WT controls (Fig. 5, C and D). These results indicate that Pcbp1 regulates muscle fiber formation and consequently induces a slow- to fast-twitch myofiber shift in the affected muscle.

Inhibition of Pcbp1 reduced numbers of satellite cells and enhanced the premature differentiation of primary myoblasts

Satellite cells, the skeletal muscle stem cells, are responsible for muscle regeneration and normal postnatal muscle growth. We asked whether Pcbp1 directly regulates the proliferation and differentiation of satellite cells. Extensor digitorum longus (EDL) muscle fibers were dissociated from Pcbp1f/f and control mice, cultured, and fixed. Myofiber-associated satellite cells were visualized by immunostaining for Pax7, a satellite cell marker. Pcbp1f/f myofibers overall showed a reduced number of Pax7+ cells per fiber. Quantification revealed a reduction of total numbers of nuclei per myofiber in Pcbp1f/f muscle compared with that of controls (Fig. 6A). Further analysis indicates that the ratio of Pax7+ cells per total number of nuclei per myofiber is reduced by ∼25% in Pcbp1f/f mice when compared with WT controls (Fig. 6B).

Figure 6.

Figure 6.

Reduced satellite cell population in Pcbp1f/f mice. A, Pax7 immunostaining to detect satellite cells in isolated myofibers from EDL muscles of Pcbp1f/f and control mice. DAPI marks the cell nuclei. Yellow arrowheads indicate Pax7 positive satellite cells. B, comparison of total number of nuclei per fiber and percentage of Pax7+ cells per fiber. C, gross morphology of satellite cells isolated from EDL muscles of Pcbp1f/f and control mice. They were either kept in growth condition (G1) or induced for differentiation (D1). D, immunostaining for myosin heavy chain (Myh) in satellite cells isolated from Pcbp1f/f and control EDL muscles that were induced for differentiation for 1 day. *, p < 0.05.

To confirm the above observation and better understand how Pcbp1 regulates the proliferation and differentiation of satellite cells, we isolated satellite cells from skeletal muscles of neonatal Pcbp1f/f or control WT mice and cultured them in vitro. We found that reduction of Pcbp1 in isolated Pcbp1f/f satellite cells, often referred to as activated primary myoblasts, substantially inhibits cell proliferation as measured by direct cell counting (Fig. 6C). In contrast, satellite cells isolated from Pcbp1f/f mice differentiate into multinuclear myofibers much more robustly when compared with those of wild type controls, suggesting that Pcbp1 represses myoblast differentiation (Fig. 6D). These data are consistent with the results obtained from C2C12 myoblasts where knockdown of Pcbp1 by siPcbp1 resulted in an enhanced myoblast differentiation. Taken together, our results suggest that Pcbp1 regulates the proliferation and differentiation of skeletal muscle satellite cells.

Pcbp1 modulates miRNA maturation in skeletal muscle

We hypothesize that Pcbp1 regulates myoblast proliferation and differentiation by modulating the maturation process of miRNAs. To test this hypothesis, we knocked down Pcbp1 in C2C12 cells with Pcbp1 siRNAs and examined the expression of muscle-enriched miRNAs. Northern blotting demonstrates that the expression levels for mature miR-1, miR-133, and miR-206, known for their roles in skeletal muscle proliferation and differentiation program, are significantly down-regulated when the endogenous Pcbp1 level was inhibited (Fig. 7A). Quantification of the changes of miRNA expression indicated that the decreased expression of these miRNAs was statistically significant (Fig. 7B). Finally, we examined the expression of these miRNAs in skeletal muscles of Pcbp1f/f and control mice. Consistent with the results of C2C12 myoblasts, we found that the expression of these miRNAs decreased in skeletal muscle of Pcbp1f/f mice (Fig. 7C). These results indicate that Pcbp1 is required for the biogenesis of miRNAs in skeletal muscles.

Figure 7.

Figure 7.

Pcbp1 regulates muscle miRNA maturation. A, miRNA Northern blots showing expression of miR-1, miR-133, and miR-206 in untreated (unt) and siRNA-control (siCNTRL)- and siRNA-Pcbp1 (siPcbp1)-treated C2C12 cells at one day of differentiation. U6 served as a loading control. B, quantification of miRNA expression relative to U6 expression. *, p < 0.05. C, qPCR analyses of miRNA expression in skeletal muscles (quadriceps) of Pcbp1f/f and control mice.

Discussion

In this study we reported that the RNA-binding protein Pcbp1 plays an important role in myoblast proliferation, differentiation, and myofiber type specification. We showed that inhibition of Pcbp1 affects myoblast differentiation in vitro. Reduction of Pcbp1 expression by genetic alteration of the Pcbp1 locus leads to muscle defects, apparently resulted from precocious myocyte differentiation and reduction of their proliferation. Mechanistically, our results link the function of Pcbp1 to miRNA processing; Pcbp1 physically interacts with AGO2 and its associated proteins. Inhibition of Pcbp1 results in reduction of muscle miRNAs, suggesting that these miRNAs may mediate Pcbp1 function in skeletal muscle.

Interestingly, we observed that reduced Pcbp1 expression in mice resulted in a switch of fast- to slow-twitch myofibers. Skeletal muscle contractility is closely correlated with fast-twitch and slow-twitch myofibrils (38). Several important molecular pathways, such as the AMP-activated protein kinase (AMPK), the peroxisome proliferator-activated receptor γ co-activator 1-α (PGC-1α), and the calcineurin and protein kinase C, have been implicated in the regulation of myofiber switch (39–45). Additionally, the function of the transcription factor Sox6 has been linked to the regulation of fast- and slow-myofiber switch (46). We speculate some of these above regulators are miRNA targets in a manner that genetic mutation of Pcbp1 results in alteration of miRNA levels, leading to the change of these target genes.

Pcbp1 (and Pcbp2) was identified as a member(s) of the P-body mRNA degradation complex, which comprises other multifunctional protein molecules, such as AGO2, the core member of the RISC (33, 47). These analyses suggest that Pcbp1 could be involved in the processing and function of miRNAs. However, thus far there was no direct evidence to link the function of this protein to the miRNA pathway. Our study demonstrated that Pcbp1 physically interacts with components of the miRNA-processing machinery to modulate the expression/processing of muscle miRNAs. However, it remains unclear about how Pcbp1 specifically regulates the processing of a subset of miRNAs. Additional experiment evidence, such as miRNA-dependent rescue, is needed to establish that the function of Pcbp1 is mediated by miRNAs, not other targets, in skeletal muscle. By using a loss-of-function approach, our genetic studies demonstrated that Pcbp1 plays a key role in the regulation of muscle gene expression, skeletal muscle differentiation, and muscle stem cell-mediated muscle regeneration. Importantly, Pcbp1 was reported as an RNA-binding protein, which could also target the poly(C) regions in the 3′-UTR region of several genes including p21, the human androgen receptor, and the human α-globin among others (19, 21, 48, 49). Clearly, it remains to be determined if these Pcbp1 targets contribute to its function in regulating skeletal muscle. Given Pcbp1 is highly conserved in human, it will be important to define whether human Pcbp1 gene is involved in muscular dystrophy or muscle degeneration related muscle disorders.

Experimental procedures

Cell culture, siRNA transfection, and viral infection

The mouse myoblast cell line C2C12 was maintained in a proliferative state utilizing growth medium (DMEM supplemented with 10% FBS and 1% penicillin/streptomycin antibiotics) and incubated at 37 °C and 5% CO2. DMEM supplemented with 2% horse serum and 1% antibiotics was utilized for induction of differentiation. Cells were maintained in growing conditions and split when reaching 50% confluence to avoid spontaneous differentiation. C2C12 cells were seeded (0.3 × 106 cells) in 6-well plates at ∼80% confluence the night before treatment. Control siRNA (MISSION® siRNA Universal Negative Control #1 (catalog no. SIC001-10NMOL) and siRNA against mouse Pcbp1 (MISSION® SASI_Mm01_00177173, MISSION® SASI_Mm01_00177174) were purchased from Sigma. siRNA transfection was performed by using Lipofectamine RNAi max following the manufacturer's instructions. Adenovirus infection was performed by incubating cells with Ad-EGFP or Ad-Pcbp1 at a 10 multiplicity of infection for 6 h.

Generation of Pcbp1f/f allele and mouse model

The Pcbp1 coding sequence followed by ∼350 bp of the 3′-UTR was amplified by PCR using genomic DNA (C57BL/6J x 129/SvJae) as a template and cloned into the pGEM-T easy vector containing the thymidine kinase negative selector to create the “P-TK” vector. LoxP sequences were cloned in the same direction into the 5′- and 3′-ends of the Pcbp1–3′-UTR sequence to create the “PLoxP-TK” vector. An frt-flanked Neomycin resistance gene was cloned into the 3′-end of the PLoxP-TK vector to create the PLoxP-Neo-TK vector. Similarly a 2.2-kb fragment 5′-upstream of the Pcbp1 ATG codon sequence and a 4.7-kb 3′-downstream fragment were amplified by PCR and cloned into the PLoxP-Neo-TK vector to create the final “2.2K-PLoxP-Neo-4.7K-TK” vector, which was named Pcbp1f-targeting construct (Fig. 4A). Next, 30 μg of the final Pcbp1f targeting vector was linearized with the restriction endonuclease NdeI, purified with phenol:chloroform:isoamyl alcohol (25:24:1) and used for embryonic stem (ES) cell electroporation. Targeted ES cells were screened by PCR and Southern blot, and four clones were identified to possess the correct homologous recombination. One clone was utilized for blastocyst injection, and five male and one female high percentage chimeric mice were obtained. The resulting chimeric mice were bred to C57BL/6 mice to obtain germ-line transmission. The neomycin cassette was subsequently excised by breeding with β-actin-Flp mice.

Virus production

The Pcbp1 coding sequence was amplified by PCR and cloned into the pIRES2-EGFP vector; subsequently the Pcbp1-IRES2-EGFP sequence was excised and cloned into the pENTR3c shuttle vector. Finally, recombination into the pAd/CMV/V5-DEST vector was achieved following the manufacturer's instructions (Invitrogen). The final adenoviral construct was linearized with PacI restriction endonuclease, purified with phenol:chloroform:isoamyl alcohol (25:24:1), resuspended in sterile distilled water, and diluted to a concentration of 1 μg/μl. For adenovirus production human epithelial kidney cells (HEK-293AD) were seeded in a 6-well plate, transfected with 1 μg of linearized plasmid, and maintained following the manufacturer's instructions (Invitrogen) as well as standard adenovirus production protocols (50).

RNA isolation, RT-PCR and qPCR

RNA isolation was achieved by isopropyl alcohol precipitation after TRIzol (Life Technologies) or Tri-PURE (Roche Applied Science) following manufacturer's instructions. Retro-transcriptase reactions (M-MLV, Life Technologies) and real-time PCR were performed following manufacturer's instructions (Affimetrix). PCR primers for mouse Pcbp1 were: forward, GAGAGTCATGACCATCCCGTA; reverse, GCGGAGAAATGGTGTGTTGT.

Western blot and co-immunoprecipitation

Cells or tissues were homogenized in lysis buffer (Tris-HCl pH 7.5, 300 mm NaCl, 1 mm EDTA, pH 8.0, 0.5% Triton X-100 supplemented with 1× proteinase inhibitor mixture, Roche Applied Science). Lysates were precipitated by centrifugation at 4 °C and 10,000 rpm for 10 min. Equal amounts of total protein were loaded on an SDS-PAGE gel, transferred to a polyvinylidene difluoride membrane, and blotted with various antibodies: Pcbp1 (MBL RN024P, 1:4000), MF-20 (DHSB, 1:2000), myogenin (DHSB F5D 1:500), MyoD (DHSB D7F2, 1:1000).

Human embryonic kidney cells (HEK-293T) transected with various plasmids were lysed with protein lysis buffer (50 mm Tris-HCl, pH 7.5, 300 mm NaCl, 1 mm EDTA, 0.5% Triton X-100, and 1× proteinase inhibitor mixture). Lysates were cleared by centrifugation at 10,000 rpm, and protein content was measured by the BCA method (Bio-Rad). For co-immunoprecipitation assays lysates were incubated with 2 μg of antibody against a Myc or FLAG tag (Sigma) overnight at 4 °C followed by incubation with protein A/G-agarose beads for 2 h at 4 °C.

miRNA Northern blot

30 μg of total RNA was electrophoresed into a 15% acrylamide-Tris borate-EDTA gel, transferred to a nitrocellulose membrane, UV-light-fixed, probed with radioactive probes against various miRNAs in hybridization buffer (0.5 m Na2HPO4, 7% SDS) at 37 °C overnight, washed, and film-exposed for various times at −80 °C. Oligonucleotides were diluted at a concentration of 1 mm and used in a reaction containing [γ-32P]ATP (PerkinElmer Life Sciences) and polynucleotide kinase following the manufacturer's instructions (New England BioLabs). Radioactive oligonucleotides were purified using Sephadex G-25 columns (Roche Applied Science).

Skeletal muscle fiber isolation

EDL and soleus muscles were obtained by excision from hind-limb muscle and further digested using 0.2% collagenase type I (w/v). Fiber dissociation was performed under microscope in DMEM (with pyruvate) in 10-min intervals until necessary. Fibers were washed extensively in DMEM (with pyruvate), collected by centrifugation at 50 × g for 1 h and cultured in 0.2% collagen-coated culture dishes in medium containing DMEM (with pyruvate), 5% horse serum, and 2% FBS. Fixed fibers were fixed with 4% paraformaldehyde in PBS and stained, and the number of satellite cells was quantified on a per fiber basis.

Skeletal muscle primary myoblast isolation

Isolation of primary myoblast was performed following standard protocols as found elsewhere (51, 52). Briefly, mouse pups were sacrificed within 2 days after birth. Pups were dipped in alcohol for sterilization, the head was severed, internal organs were discarded, and the carcasses were then washed with sterile PBS. An incision on the dorsal side was performed, and skin was removed from the carcass. Skeletal muscles were exposed and excised from the carcass. Samples were finely minced in PBS, transferred to a 15-ml tube, and washed twice. Minced samples were incubated in a collagenase/dispase enzyme mixture for 30 min at 37 °C followed by pipetting-trituration. Triturating and enzymatic digestion was repeated twice more. Cells were accumulated by centrifugation and cultured in culture medium containing DMEM, 20% FBS (Invitrogen), 1% chick embryo extract, 10 ng/ml bovine FGF, and 0.5% penicillin-streptomycin. Induction of differentiation was performed in similar fashion to C2C12 cell treatment.

Immunocytochemistry/histochemistry

Skeletal muscle samples were isolated from sacrificed mice at different ages, immersed in cold (using a dry ice or liquid nitrogen bath) isopentene, immersed in optimal cutting temperature (OCT) compound, and stored at −80 °C. Samples were cryo-sectioned, air-dried for 5 min at room temperature, fixed in 4% paraformaldehyde at room temperature for 5 min, washed 3× with PBS, permeabilized with 0.5% Triton X-100 in PBS, washed again 3x with PBS, and blocked with 5% normal serum in PBS at room temperature for 1 h. Incubation with primary antibodies against slow anti-MHC-α,β (DHSB, BA-D5, 1:200), fast anti-MHC-IIb (DHSB, F-18, 1:200), Pax7 (DHSB, 1:200), and myogenin (DHSB, 1:200) was performed overnight at 4 °C. Samples were washed 3× with PBS and incubation with the respective secondary antibodies was performed at room temperature for 2 h. Finally, samples were stained with DAPI or Hoeschst dye, washed with PBS, and mounted with fluorescent stable mounting medium. Staining for the identification of membranes was performed with wheat germ agglutinin following a similar methodology to secondary antibody treatment.

Author contributions

R. E.-L. and D.-Z. W. conceived the idea for this work. R. E.-L., Q. Y., J. L., X. H., and Z.-P. H. performed the experiments. R. E.-L. and D.-Z. W. designed the experiments and interpreted the results. D. C. supervised the project. R. E.-L., Q. Y., and D.-Z. W. wrote and edited the manuscript.

Acknowledgments

We thank members of the Wang laboratory for advice and support. We appreciate Dr. Francisco Naya (Boston University) for careful reading of the manuscript and stimulating discussion.

This work was supported, in whole or in part, by National Institutes of Health Grants HL085635 and HL116919. This work was also supported by the American Heart Association and Muscular Dystrophy Association. The authors declare that they have no conflicts of interest with the contents of this article. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.

5
The abbreviations used are:
miRNA
microRNA
Pcbp1
poly(C)-binding protein1
siPcbp1
siRNA-Pcbp1
RNP
ribonucleoprotein particle
hnRNP
heterogeneous nuclear ribonucleoprotein
RBP
RNA-binding protein
KH
K-homology
AGO2
argonaute 2
co-IP
co-immunoprecipitation
MHC
myosin heavy chain
qPCR
quantitative PCR
EDL
extensor digitorum longus
ES
embryonic stem
TA
tibialis anterior
DHSB
developmental Studies Hybridoma Bank
RISC
RNA-induced silencing complex.

References

  • 1. Buckingham M., and Rigby P. W. (2014) Gene regulatory networks and transcriptional mechanisms that control myogenesis. Dev. Cell 28, 225–238 [DOI] [PubMed] [Google Scholar]
  • 2. Comai G., and Tajbakhsh S. (2014) Molecular and cellular regulation of skeletal myogenesis. Curr. Top. Dev. Biol. 110, 1–73 [DOI] [PubMed] [Google Scholar]
  • 3. Kirby T. J., Chaillou T., and McCarthy J. J. (2015) The role of microRNAs in skeletal muscle health and disease. Front. Biosci. (Landmark Ed) 20, 37–77 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Williams A. H., Liu N., van Rooij E., and Olson E. N. (2009) MicroRNA control of muscle development and disease. Curr. Opin. Cell Biol. 21, 461–469 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Diniz G. P., and Wang D. Z. (2016) Regulation of Skeletal Muscle by microRNAs. Compr. Physiol. 6, 1279–1294 [DOI] [PubMed] [Google Scholar]
  • 6. Chen J. F., Mandel E. M., Thomson J. M., Wu Q., Callis T. E., Hammond S. M., Conlon F. L., and Wang D. Z. (2006) The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiation. Nat. Genet. 38, 228–233 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Wilk H. E., Werr H., Friedrich D., Kiltz H. H., and Schäfer K. P. (1985) The core proteins of 35S hnRNP complexes: characterization of nine different species. Eur. J. Biochem. 146, 71–81 [DOI] [PubMed] [Google Scholar]
  • 8. Chaudhury A., Chander P., and Howe P. H. (2010) Heterogeneous nuclear ribonucleoproteins (hnRNPs) in cellular processes: focus on hnRNP E1's multifunctional regulatory roles. RNA 16, 1449–1462 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Dreyfuss G. (1986) Structure and function of nuclear and cytoplasmic ribonucleoprotein particles. Annu. Rev. Cell Biol. 2, 459–498 [DOI] [PubMed] [Google Scholar]
  • 10. Swanson M. S., and Dreyfuss G. (1988) Classification and purification of proteins of heterogeneous nuclear ribonucleoprotein particles by RNA-binding specificities. Mol. Cell. Biol. 8, 2237–2241 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Han S. P., Tang Y. H., and Smith R. (2010) Functional diversity of the hnRNPs: past, present, and perspectives. Biochem. J. 430, 379–392 [DOI] [PubMed] [Google Scholar]
  • 12. Dreyfuss G., Kim V. N., and Kataoka N. (2002) Messenger-RNA-binding proteins and the messages they carry. Nat. Rev. Mol. Cell Biol. 3, 195–205 [DOI] [PubMed] [Google Scholar]
  • 13. Makeyev A. V., and Liebhaber S. A. (2002) The poly(C)-binding proteins: a multiplicity of functions and a search for mechanisms. RNA 8, 265–278 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Makeyev A. V., Chkheidze A. N., and Liebhaber S. A. (1999) A set of highly conserved RNA-binding proteins, αCP-1 and αCP-2, implicated in mRNA stabilization, are coexpressed from an intronless gene and its intron-containing paralog. J. Biol. Chem. 274, 24849–24857 [DOI] [PubMed] [Google Scholar]
  • 15. Aasheim H. C., Loukianova T., Deggerdal A., and Smeland E. B. (1994) Tissue specific expression and cDNA structure of a human transcript encoding a nucleic acid binding [oligo(dC)] protein related to the pre-mRNA-binding protein K. Nucleic Acids Res. 22, 959–964 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Leffers H., Dejgaard K., and Celis J. E. (1995) Characterisation of two major cellular poly(rC)-binding human proteins, each containing three K-homologous (KH) domains. Eur. J. Biochem. 230, 447–453 [PubMed] [Google Scholar]
  • 17. Meng Q., Rayala S. K., Gururaj A. E., Talukder A. H., O'Malley B. W., and Kumar R. (2007) Signaling-dependent and coordinated regulation of transcription, splicing, and translation resides in a single coregulator, PCBP1. Proc. Natl. Acad. Sci. U.S.A. 104, 5866–5871 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Pickering B. M., Mitchell S. A., Spriggs K. A., Stoneley M., and Willis A. E. (2004) Bag-1 internal ribosome entry segment activity is promoted by structural changes mediated by poly(rC) binding protein 1 and recruitment of polypyrimidine tract binding protein 1. Mol. Cell. Biol. 24, 5595–5605 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Waggoner S. A., Johannes G. J., and Liebhaber S. A. (2009) Depletion of the poly(C)-binding proteins αCP1 and αCP2 from K562 cells leads to p53-independent induction of cyclin-dependent kinase inhibitor (CDKN1A) and G1 arrest. J. Biol. Chem. 284, 9039–9049 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Thiele B. J., Doller A., Kähne T., Pregla R., Hetzer R., and Regitz-Zagrosek V. (2004) RNA-binding proteins heterogeneous nuclear ribonucleoprotein A1, E1, and K are involved in post-transcriptional control of collagen I and III synthesis. Circ. Res. 95, 1058–1066 [DOI] [PubMed] [Google Scholar]
  • 21. Giles K. M., Daly J. M., Beveridge D. J., Thomson A. M., Voon D. C., Furneaux H. M., Jazayeri J. A., and Leedman P. J. (2003) The 3′-untranslated region of p21WAF1 mRNA is a composite cis-acting sequence bound by RNA-binding proteins from breast cancer cells, including HuR and poly(C)-binding protein. J. Biol. Chem. 278, 2937–2946 [DOI] [PubMed] [Google Scholar]
  • 22. Cloke B., Shah K., Kaneda H., Lavery S., Trew G., Fusi L., Higham J., Dina R. E., Ghaem-Maghami S., Ellis P., Brosens J. J., and Christian M. (2010) The poly(c)-binding protein-1 regulates expression of the androgen receptor. Endocrinology 151, 3954–3964 [DOI] [PubMed] [Google Scholar]
  • 23. Wang H., Vardy L. A., Tan C. P., Loo J. M., Guo K., Li J., Lim S. G., Zhou J., Chng W. J., Ng S. B., Li H. X., and Zeng Q. (2010) PCBP1 suppresses the translation of metastasis-associated PRL-3 phosphatase. Cancer Cell 18, 52–62 [DOI] [PubMed] [Google Scholar]
  • 24. Zhang T., Huang X. H., Dong L., Hu D., Ge C., Zhan Y. Q., Xu W. X., Yu M., Li W., Wang X., Tang L., Li C. Y., and Yang X. M. (2010) PCBP-1 regulates alternative splicing of the CD44 gene and inhibits invasion in human hepatoma cell line HepG2 cells. Mol. Cancer 9, 72. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Lian W. X., Yin R. H., Kong X. Z., Zhang T., Huang X. H., Zheng W. W., Yang Y., Zhan Y. Q., Xu W. X., Yu M., Ge C. H., Guo J. T., Li C. Y., and Yang X. M. (2012) THAP11, a novel binding protein of PCBP1, negatively regulates CD44 alternative splicing and cell invasion in a human hepatoma cell line. FEBS Lett. 586, 1431–1438 [DOI] [PubMed] [Google Scholar]
  • 26. Nandal A., Ruiz J. C., Subramanian P., Ghimire-Rijal S., Sinnamon R. A., Stemmler T. L., Bruick R. K., and Philpott C. C. (2011) Activation of the HIF prolyl hydroxylase by the iron chaperones PCBP1 and PCBP2. Cell Metab. 14, 647–657 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Diez-Roux G., Banfi S., Sultan M., Geffers L., Anand S., Rozado D., Magen A., Canidio E., Pagani M., Peluso I., Lin-Marq N., Koch M., Bilio M., Cantiello I., Verde R., De Masi C., Bianchi S. A., et al. (2011) A high-resolution anatomical atlas of the transcriptome in the mouse embryo. PLos Biol. 9, e1000582. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Ghanem L. R., Chatterji P., and Liebhaber S. A. (2014) Specific enrichment of the RNA-binding proteins PCBP1 and PCBP2 in chief cells of the murine gastric mucosa. Gene Expr. Patterns 14, 78–87 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Wang D., Chang P. S., Wang Z., Sutherland L., Richardson J. A., Small E., Krieg P. A., and Olson E. N. (2001) Activation of cardiac gene expression by myocardin, a transcriptional cofactor for serum response factor. Cell 105, 851–862 [DOI] [PubMed] [Google Scholar]
  • 30. Wang C., Cao D., Wang Q., and Wang D. Z. (2011) Synergistic activation of cardiac genes by myocardin and Tbx5. PloS ONE 6, e24242. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Hutvagner G., and Simard M. J. (2008) Argonaute proteins: key players in RNA silencing. Nat. Rev. Mol. Cell Biol. 9, 22–32 [DOI] [PubMed] [Google Scholar]
  • 32. Fujimura K., Katahira J., Kano F., Yoneda Y., and Murata M. (2009) Selective localization of PCBP2 to cytoplasmic processing bodies. Biochim. Biophys. Acta 1793, 878–887 [DOI] [PubMed] [Google Scholar]
  • 33. Liu J., Valencia-Sanchez M. A., Hannon G. J., and Parker R. (2005) MicroRNA-dependent localization of targeted mRNAs to mammalian P-bodies. Nat. Cell Biol. 7, 719–723 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Chendrimada T. P., Gregory R. I., Kumaraswamy E., Norman J., Cooch N., Nishikura K., and Shiekhattar R. (2005) TRBP recruits the Dicer complex to Ago2 for microRNA processing and gene silencing. Nature 436, 740–744 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Ding J., Chen J., Wang Y., Kataoka M., Ma L., Zhou P., Hu X., Lin Z., Nie M., Deng Z. L., Pu W. T., and Wang D. Z. (2015) Trbp regulates heart function through microRNA-mediated Sox6 repression. Nat. Genet. 47, 776–783 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Kasim V., Wu S., Taira K., and Miyagishi M. (2013) Determination of the role of DDX3 a factor involved in mammalian RNAi pathway using an shRNA-expression library. PloS ONE 8, e59445. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Ghanem L. R., Kromer A., Silverman I. M., Chatterji P., Traxler E., Penzo-Mendez A., Weiss M. J., Stanger B. Z., and Liebhaber S. A. (2015) The Poly(C) binding protein Pcbp2 and its retrotransposed derivative Pcbp1 are independently essential to mouse development. Mol. Cell. Biol. 36, 304–319 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Bassel-Duby R., and Olson E. N. (2006) Signaling pathways in skeletal muscle remodeling. Annu. Rev. Biochem. 75, 19–37 [DOI] [PubMed] [Google Scholar]
  • 39. Finck B. N., and Kelly D. P. (2006) PGC-1 coactivators: inducible regulators of energy metabolism in health and disease. J. Clin. Invest. 116, 615–622 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Gan Z., Rumsey J., Hazen B. C., Lai L., Leone T. C., Vega R. B., Xie H., Conley K. E., Auwerx J., Smith S. R., Olson E. N., Kralli A., and Kelly D. P. (2013) Nuclear receptor/microRNA circuitry links muscle fiber type to energy metabolism. J. Clin. Invest. 123, 2564–2575 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Lin J., Wu H., Tarr P. T., Zhang C. Y., Wu Z., Boss O., Michael L. F., Puigserver P., Isotani E., Olson E. N., Lowell B. B., Bassel-Duby R., and Spiegelman B. M. (2002) Transcriptional co-activator PGC-1α drives the formation of slow-twitch muscle fibres. Nature 418, 797–801 [DOI] [PubMed] [Google Scholar]
  • 42. Narkar V. A., Downes M., Yu R. T., Embler E., Wang Y. X., Banayo E., Mihaylova M. M., Nelson M. C., Zou Y., Juguilon H., Kang H., Shaw R. J., and Evans R. M. (2008) AMPK and PPARδ agonists are exercise mimetics. Cell 134, 405–415 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Reyes N. L., Banks G. B., Tsang M., Margineantu D., Gu H., Djukovic D., Chan J., Torres M., Liggitt H. D., Hirenallur-S D. K., Hockenbery D. M., Raftery D., and Iritani B. M. (2015) Fnip1 regulates skeletal muscle fiber type specification, fatigue resistance, and susceptibility to muscular dystrophy. Proc. Natl. Acad. Sci. U.S.A. 112, 424–429 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Schiaffino S., and Reggiani C. (2011) Fiber types in mammalian skeletal muscles. Physiol. Rev. 91, 1447–1531 [DOI] [PubMed] [Google Scholar]
  • 45. Chin E. R., Olson E. N., Richardson J. A., Yang Q., Humphries C., Shelton J. M., Wu H., Zhu W., Bassel-Duby R., and Williams R. S. (1998) A calcineurin-dependent transcriptional pathway controls skeletal muscle fiber type. Genes Dev. 12, 2499–2509 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Quiat D., Voelker K. A., Pei J., Grishin N. V., Grange R. W., Bassel-Duby R., and Olson E. N. (2011) Concerted regulation of myofiber-specific gene expression and muscle performance by the transcriptional repressor Sox6. Proc. Natl. Acad. Sci. U.S.A. 108, 10196–10201 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Zheng D., Chen C. Y., and Shyu A. B. (2011) Unraveling regulation and new components of human P-bodies through a protein interaction framework and experimental validation. RNA 17, 1619–1634 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Yeap B. B., Voon D. C., Vivian J. P., McCulloch R. K., Thomson A. M., Giles K. M., Czyzyk-Krzeska M. F., Furneaux H., Wilce M. C., Wilce J. A., and Leedman P. J. (2002) Novel binding of HuR and poly(C)-binding protein to a conserved UC-rich motif within the 3′-untranslated region of the androgen receptor messenger RNA. J. Biol. Chem. 277, 27183–27192 [DOI] [PubMed] [Google Scholar]
  • 49. Chkheidze A. N., Lyakhov D. L., Makeyev A. V., Morales J., Kong J., and Liebhaber S. A. (1999) Assembly of the α-globin mRNA stability complex reflects binary interaction between the pyrimidine-rich 3′-untranslated region determinant and poly(C) binding protein αCP. Mol. Cell. Biol. 19, 4572–4581 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50. Luo J., Deng Z. L., Luo X., Tang N., Song W. X., Chen J., Sharff K. A., Luu H. H., Haydon R. C., Kinzler K. W., Vogelstein B., and He T. C. (2007) A protocol for rapid generation of recombinant adenoviruses using the AdEasy system. Nat. Protoc. 2, 1236–1247 [DOI] [PubMed] [Google Scholar]
  • 51. Shefer G., and Yablonka-Reuveni Z. (2005) Isolation and culture of skeletal muscle myofibers as a means to analyze satellite cells. Methods Mol. Biol. 290, 281–304 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52. Rando T. A., and Blau H. M. (1994) Primary mouse myoblast purification, characterization, and transplantation for cell-mediated gene therapy. J. Cell Biol. 125, 1275–1287 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from The Journal of Biological Chemistry are provided here courtesy of American Society for Biochemistry and Molecular Biology

RESOURCES