Skip to main content
Antimicrobial Agents and Chemotherapy logoLink to Antimicrobial Agents and Chemotherapy
. 2005 Feb;49(2):791–793. doi: 10.1128/AAC.49.2.791-793.2005

AcrAB Efflux Pump Plays a Role in Decreased Susceptibility to Tigecycline in Morganella morganii

Alexey Ruzin 1,*, David Keeney 1, Patricia A Bradford 1
PMCID: PMC547285  PMID: 15673770

Abstract

Transposon mutagenesis of a clinical isolate of Morganella morganii, G1492 (tigecycline MIC of 4 μg/ml), yielded two insertion knockout mutants for which tigecycline MICs were 0.03 μg/ml. Transposon insertions mapped to acrA, which is constitutively overexpressed in G1492, suggesting a role of the AcrAB efflux pump in decreased susceptibility to tigecycline in M. morganii.


Tigecycline is a novel expanded broad-spectrum glycylcycline antibiotic (1, 8, 9). Tigecycline circumvents classical tetracycline resistance mechanisms such as ribosomal protection and efflux by tetracycline-specific pumps (3, 9). Nevertheless, several species of gram-negative bacteria are intrinsically less susceptible to tigecycline; among them are Pseudomonas aeruginosa, Proteus spp., Providencia spp., and Morganella morganii. In addition, a few strains of Klebsiella pneumoniae have been isolated with acquired decreased susceptibility to tigecycline.

Previous studies showed that decreased tigecycline susceptibility is associated with multidrug efflux systems such as MexXY in P. aeruginosa and AcrAB in Proteus mirabilis and K. pneumoniae (4, 10, 14). These pumps belong to the resistance/nodulation/division family and are often associated with multidrug resistance (MDR). As determined previously, the constitutive overexpression of the pump components correlated with reduced susceptibility to tigecycline in P. aeruginosa and K. pneumoniae (4, 10).

This study was performed to identify the mechanism of decreased susceptibility to tigecycline in many strains of M. morganii. For the majority of M. morganii strains, the tigecycline MIC was 1 to 4 μg/ml. Two clinical isolates of M. morganii, G858 and G1492, which represent the lower and higher ends of the range of tigecycline MICs, were selected for this study.

Bacterial strains and plasmids used in this study are shown in Table 1. The strains were propagated at 37°C in Luria-Bertani broth or agar. Standard DNA manipulations such as restriction digestion and molecular cloning were performed as described previously (11). Chemically competent Escherichia coli strains TOP10 and INV110 (Invitrogen, Carlsbad, Calif.) were used for cloning experiments. DNA transformations were performed by electroporation with the Gene Pulser II system (Bio-Rad, Hercules, Calif.), using the optimal electroporation settings of 2.5 kV, 25 μF, 200 Ω, and 5 ms. Transposon mutagenesis was done with the EZ::TN <R6γori/KAN-2> transposome kit (Epicentre, Madison, Wis.) according to the manufacturer's protocol. The selection of tigecycline-susceptible transposon mutants, rescue cloning, and mapping of transposon insertions were performed as described previously (14). The nucleotide sequence was determined with an ABI 3700 automated sequencer (Applied Biosystems, Foster City, Calif.). The MICs of various antibacterial agents were determined by standard broth microdilution tests (6). MICs of tigecycline were determined with fresh Mueller-Hinton broth (<12 h old).

TABLE 1.

Bacterial strains and plasmids used in this study

Strain or plasmid Description Source or reference
Strains
    E. coli
        TOP10 Cloning strain Invitrogen
        INV110 dam and dcm methylase deficient Invitrogen
    M. morganii
        G858 Clinical isolate, tigecycline MIC = 1 μg/ml This study
        G1492 Clinical isolate, tigecycline MIC = 4 μg/ml This study
        GC7676 G1492 insertion mutant, EZ::TN inserted in 453 bp of acrA This study
        GC7677 G1492 insertion mutant, EZ::TN inserted in 946 bp of acrA This study
        GC7743 GC7676 transformed with pCLL3444 This study
        GC7744 GC7677 transformed with pCLL3444 This study
Plasmids
    pCR2.1-TOPO PCR cloning vector Invitrogen
    pUCGm pUC19 derivative containing gentamicin resistance cassette 13
    pCLL3443 pCR2.1-TOPO with cloned acrAB genes (4,859-bp PCR fragment) This study
    pCLL3444 pCLL3443 with cloned gentamicin cassette (878-bp XbaI fragment) This study

Two tigecycline-susceptible transposon mutants, GC7676 and GC7677, were obtained upon transposon mutagenesis of a clinical isolate of M. morganii G1492. The sites of transposon insertion were mapped by rescue cloning and sequencing to a homolog of the acrA gene. GC7676 had an insertion at nucleotide 453, and GC7677 had an insertion at nucleotide 946. The nucleotide sequence of a 6,104-bp genomic DNA fragment containing the entire acrRAB locus of G1492 was determined from the rescue clones. The acrRAB genes of M. morganii were 648, 1,194, and 3,177 bp long, respectively, and had 63, 57, and 81% amino acid sequence identity to acrRAB genes of P. mirabilis (14). The orientation of genes was identical to that of P. mirabilis, with the acrR and acrAB genes being divergently transcribed from a common intergenic region.

Transposon insertion into the acrA gene of G1492 resulted in a substantial decrease in the MIC of tigecycline (128-fold reduction from 4 to 0.03 μg/ml; Table 2). In addition, the MDR phenotype was suppressed, as demonstrated by the decrease in the MICs of minocycline, acriflavine, ethidium bromide, sodium dodecyl sulfate, erythromycin, chloramphenicol, nalidixic acid, novobiocin, and trimethoprim for GC7676 and GC7677 (Table 2).

TABLE 2.

Antibiotic susceptibility for M. morganii strains

Strain AcrA over- expression MIC (μg/ml)a
TGC MIN TET ACR EtBr SDS ERY CHL NA NOV TRM
G858 − 1 2 1 128 512 >2,048 128 4 2 8 2
G1492 + 4 8 32 32 1,024 >2,048 >256 64 4 256 2
GC7676 − 0.03 0.5 16 2 2 64 16 8 1 2 0.25
GC7677 − 0.03 0.5 16 4 2 128 16 8 1 2 0.25
GC7743 + 4 8 64 32 1,024 >2,048 256 128 4 256 2
GC7744 + 8 16 64 32 1,024 >2,048 >256 128 4 256 4
a

Abbreviations: TGC, tigecycline; MIN, minocycline; TET, tetracycline; ACR, acriflavine; EtBr, ethidium bromide; SDS, sodium dodecyl sulfate; ERY, erythromycin; CHL, chloramphenicol; NA, nalidixic acid; NOV, novobiocin; TRM, trimethoprim.

For transcomplementation studies, a DNA fragment containing the full-length acrAB of G1492 was amplified by PCR with the primers listed in Table 3. Genomic DNA of G1492 was isolated by using the Puregene tissue kit (Gentra Systems, Inc., Minneapolis, Minn.) and served as a template for PCR. The gel-purified PCR fragment was cloned into the pCR2.1-TOPO vector (Invitrogen) as specified by the manufacturer. The resulting plasmid, pCLL3443, was modified by cloning an 878-bp XbaI fragment containing the gentamicin resistance cassette from pUCGm into the XbaI site of pCLL3443. The resulting plasmid, pCLL3444, was used in transcomplementation studies. Introduction of pCLL3444 into transposon mutants resulted in tigecycline MICs of 4 to 8 μg/ml and in the restoration of the MDR phenotype. It should be noted that both acrA and acrB were required for transcomplementation because these genes are cotranscribed; therefore, both were inactivated by transposon insertions in acrA. These results indicated that the acrAB locus was linked to the decreased tigecycline susceptibility and MDR phenotype of G1492.

TABLE 3.

Primers and fluorescent probes used for PCR and RT-PCR

Gene(s) Product size (bp) Purpose Sequence (5′→3′) of:
Forward primer Reverse primer Fluorescent probea
acrAB 4,859 TOPO cloning ATCCACTAATGACGTCGC GCAGAGTAAATGCCTGAACG NAb
acrA 72 RT-PCR ACCTGCGTCTGAAACAAGAAATC CCAGGCTGACAGCAACTTTACC CCAGCGGTGCCGTGGATAAAGAAC
rrsE 71 RT-PCR TTGACGTTACCCGCAGAAGAA GCTTGCACCCTCCGTATTACC TAACTCCGTGCCAGCAGCCG
a

Labeled with 6-carboxyfluorescein (6′-FAM) at the 5′ end and with 6-carboxytetramethylrodamine (TAMRA) at the 3′ end.

b

NA, not applicable.

To determine whether the decreased tigecycline susceptibility of G1492 was associated with acrAB overexpression, the transcriptional levels of acrA were analyzed by Taqman quantitative real-time PCR (RT-PCR) on the iCycler iQ real-time PCR detection system (Bio-Rad). DNase-treated RNA templates were prepared from mid-log-phase bacterial cultures by using the RNAeasy kit (Qiagen, Valencia, Calif.). Oligonucleotide primers and probes used for RT-PCR are shown in Table 3. RT-PCR and the quantification of the target gene expression (acrA) relative to an endogenous reference (rrsE) were performed as described previously (10). As shown in Table 4, the level of acrA expression was approximately 48.5-fold higher in G1492 (tigecycline MIC = 4 μg/ml) than in G858 (tigecycline MIC = 1 μg/ml). In addition, the elevated level of acrA expression in G1492 in comparison to that in G858 was confirmed by Northern blot hybridization (data not shown), further suggesting that reduced susceptibility to tigecycline was linked to acrA overexpression in M. morganii. It should be noted that strains G858 and G1492 are nonisogenic, and, therefore, an additional analysis of acrAB expression levels in the same-strain background would be beneficial to confirm the correlation between increased levels of acrAB expression and decreased susceptibility to tigecycline in M. morganii.

TABLE 4.

RT-PCR analysis of acrA expression

Gene Strain Cta Relative expression vs that of rrsEb Overexpression ratioc
acrA G858 30.9 3.32e-6 48.5
G1492 25.6 1.61e-4
rrsE G858 12.7
G1492 13.0
a

Ct (critical threshold cycle) numbers represent an average for duplicate samples with a final RNA concentration of 40 ng/ml.

b

Relative expression is calculated as 2−ΔΔT, where ΔΔT = Cttarget − Ctreference.The target is acrA, and the reference is rrsE.

c

Ratio between relative expression level of the target gene in G1492 versus that in G858.

In conclusion, the mechanism of efflux-mediated decreased susceptibility to tigecycline in M. morganii appears to be similar to that identified earlier in P. aeruginosa, P. mirabilis, and K. pneumoniae (4, 10, 14). Future studies will be directed toward understanding the molecular mechanisms of constitutive pump overexpression and the regulation of pump production in M. morganii. Based on previously published studies, the overexpression of the pump components is commonly caused by inactivation of the pump repressor or overproduction of transcriptional activator(s) (2, 4, 5, 7, 12). The possibility that any of these mechanisms caused the increased production of AcrAB in M. morganii will be an area for future study.

Only limited data on genetic characterization of M. morganii are available. The present study provides the first sequence and description of acrRAB in this species.

Nucleotide sequence accession number.

The nucleotide and protein sequences of the acrRAB genes of M. morganii have been registered in GenBank under accession no. AY669147.

REFERENCES

  • 1.Boucher, H. W., C. B. Wennersten, and G. M. Eliopoulos. 2000. In vitro activities of the glycylcycline GAR-936 against gram-positive bacteria. Antimicrob. Agents Chemother. 44:2225-2229. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Chollet, R., C. Bollet, J. Chevalier, M. Malléa, J. M. Pages, and A. Davin-Regli. 2002. mar operon involved in multidrug resistance of Enterobacter aerogenes. Antimicrob. Agents Chemother. 46:1093-1097. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Chopra, I. 2002. New developments in tetracycline antibiotics: glycylcyclines and tetracycline efflux pump inhibitors. Drug Resist. Updates 5:119-125. [DOI] [PubMed] [Google Scholar]
  • 4.Dean, C. R., M. A. Visalli, S. J. Projan, P.-E. Sum, and P. A. Bradford. 2003. Efflux-mediated resistance to tigecycline (GAR-936) in Pseudomonas aeruginosa PAO1. Antimicrob. Agents Chemother. 47:972-978. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Linde, H. J., F. Notka, C. Irtenkauf, J. Decker, J. Wild, H. H. Niller, P. Heisig, and N. Lehn. 2002. Increase in MICs of ciprofloxacin in vivo in two closely related clinical isolates of Enterobacter cloacae. J. Antimicrob. Chemother. 49:625-630. [DOI] [PubMed] [Google Scholar]
  • 6.National Committee for Clinical Laboratory Standards. 2000. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically. Approved standard M7-A5 and information supplement M100-S10. National Committee for Clinical Laboratory Standards, Wayne, Pa.
  • 7.Oethinger, M., I. Podglajen, W. V. Kern, and S. B. Levy. 1998. Overexpression of the marA or soxS regulatory gene in clinical topoisomerase mutants of Escherichia coli. Antimicrob. Agents Chemother. 42:2089-2094. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Petersen, P. J., P. A. Bradford, W. J. Weiss, T. M. Murphy, P. E. Sum, and S. J. Projan. 2002. In vitro and in vivo activities of tigecycline (GAR-936), daptomycin, and comparative antimicrobial agents against glycopeptide-intermediate Staphylococcus aureus and other resistant gram-positive pathogens. Antimicrob. Agents Chemother. 46:2595-2601. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Petersen, P. J., N. V. Jacobus, W. J. Weiss, P. E. Sum, and R. T. Testa. 1999. In vitro and in vivo antibacterial activities of a novel glycylcycline, the 9-t-butylglycylamido derivative of minocycline (GAR-936). Antimicrob. Agents Chemother. 43:738-744. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Ruzin, A., M. A. Visalli, D. Keeney, and P. A. Bradford. Influence of transcriptional activator RamA on expression of multidrug efflux pump AcrAB and tigecycline susceptibility in Klebsiella pneumoniae. Antimicrob. Agents Chemother., in press. [DOI] [PMC free article] [PubMed]
  • 11.Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
  • 12.Schneiders, T., S. G. B. Amyes, and S. B. Levy. 2003. Role of AcrR and RamA in fluoroquinolone resistance in clinical Klebsiella pneumoniae isolates from Singapore. Antimicrob. Agents Chemother. 47:2831-2837. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Schweizer, H. D. 1993. Small broad-host-range gentamycin resistance gene cassettes for site-specific insertion and deletion mutagenesis. BioTechniques 15:831-834. [PubMed] [Google Scholar]
  • 14.Visalli, M. A., E. Murphy, S. J. Projan, and P. A. Bradford. 2003. AcrAB multidrug efflux pump is associated with reduced levels of susceptibility to tigecycline (GAR-936) in Proteus mirabilis. Antimicrob. Agents Chemother. 47:665-669. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES