Skip to main content
Medical Science Monitor: International Medical Journal of Experimental and Clinical Research logoLink to Medical Science Monitor: International Medical Journal of Experimental and Clinical Research
. 2017 Jun 9;23:2805–2815. doi: 10.12659/MSM.904670

Changes in Expression of Dopamine, Its Receptor, and Transporter in Nucleus Accumbens of Heroin-Addicted Rats with Brain-Derived Neurotrophic Factor (BDNF) Overexpression

Yixin Li 1,B,C,D,E, Baijuan Xia 1,B,D, Rongrong Li 1,C,D, Dan Yin 1,C,E, Wenmei Liang 1,A,F,
PMCID: PMC5473376  PMID: 28598964

Abstract

Background

The aim of this study was to explore how changes in the expression of BDNF in MLDS change the effect of BDNF on dopamine (DA) neurons, which may have therapeutic implications for heroin addiction.

Material/Methods

We established a rat model of heroin addiction and observed changes in the expression of BDNF, DA, dopamine receptor (DRD), dopamine transporter (DAT), and other relevant pathways in NAc. We also assessed the effect of BDNF overexpression in the NAc, behavioral changes of heroin-conditioned place preference (CPP), and naloxone withdrawal in rats with high levels of BDNF. We established 5 adult male rat groups: heroin addiction, lentivirus transfection, blank virus, sham operation, and control. The PCR gene chip was used to study gene expression changes. BDNF lentivirus transfection was used for BDNF overexpression. A heroin CPP model and a naloxone withdrawal model of rats were established.

Results

Expression changes were found in 20 of the 84 DA-associated genes in the NAc of heroin-addicted rats. Weight loss and withdrawal symptoms in the lentivirus group for naloxone withdrawal was less than in the blank virus and the sham operation group. These 2 latter groups also showed significant behavioral changes, but such changes were not observed in the BDNF lentivirus group before or after training. DRD3 and DAT increased in the NAc of the lentivirus group.

Conclusions

BDNF and DA in the NAc are involved in heroin addiction. BDNF overexpression in NAc reduces withdrawal symptoms and craving behavior for medicine induced by environmental cues for heroin-addicted rats. BDNF participates in the regulation of the dopamine system by acting on DRD3 and DAT.

MeSH Keywords: Dopamine Plasma Membrane Transport Proteins; Heroin; Nucleus Accumbens; Receptors, Dopamine

Background

Drug addiction is seriously harmful to human health and social development, being a chronic relapsing mental disease [1], mainly involving compulsive and reckless drug-seeking behavior, the loss of limited drug intake capacity, and withdrawal symptoms after drug discontinuance [2,3].

The nucleus accumbens (NAc) is an important component of the brain reward system, and it is also an effective target for many addictive drugs. At present, it is believed that opioid addiction can lead to functional and structural adaptive changes in NAc neurons [4], which may lead to memory and craving for drug reward [5]. NAc mainly consists of dopaminergic (DA) neurons, which generates DA using tyrosine as a raw material. The chemical reaction on the DA generated by the action of tyrosine hydroxylase and DA decarboxylase is released through the cytoplasm. DA regulates various neural mechanisms, such as cognitive memory, natural reward, drug reward, and emotional activity. DA is the most important neurotransmitter of the reward system of NAc involved in the regulation of drugs [6].

The physiological role of DA in vivo involves the dopamine receptor and the dopamine transporter (DAT). Five kinds of dopamine receptors have been cloned so far, which can be divided into 2 categories: D1 and D2. Dl receptors include DlR and D5R, and D2 receptors include D2R, D3R, and D4R [7]. Different receptor subtypes mediate different transduction processes and intracellular signals, causing significant differences in intracerebral distribution.

DAT is a membrane protein located in central dopaminergic nerve endings, with a physiological role in there-uptake DA in synaptic space. Its physiological effect in the cytoplasm of neurons involves reuse, regulation of timing, extent and scope of DR activation, and regulation of the DA energy system signal transmission [8]. DAT determines the duration of the action of DA and maintains the steady state of DA in the neurons [9].

Brain-derived neurotrophic factor (BDNF) is a member of the family of neurotrophic factors, which is widely expressed in NAc, and it plays an important role in the survival, growth, differentiation, repair, and regeneration after nerve injury of DA neurons [10]. The high-affinity binding of TrkB (a family of tyrosine kinases) and BDNF in vivo can lead to downstream pathway activation, and eventually transmits BDNF signals to the cell nucleus, causing lasting biological effects of drug addiction [11]. The effect of BDNF on the role of opioid addiction has been reported inconsistently. Studies have shown that after morphine addiction, BDNF mRNA and protein levels in different brain regions were significantly increased [12]; but in some other reports, the decrease of BDNF-positive cells in VTA of a morphine addiction model indicated that BDNF functions had decreased [13]. The emergence of these contradictory results suggests that BDNF plays an important role in opioid addiction, but its exact mechanism has not been clarified.

Studies have found that BDNF is a negative regulator of opioid addiction in DA neurons [14], and injection of BDNF in the nucleus accumbens can produce abnormal reward circuit excitement, similar to that induced by opioid-class drugs [15]. Hence, in this study, we propose that changing the expression of BDNF in NAc intervenes in the effect of BDNF on the DA neurons, which may have therapeutic implications for heroin addiction.

Material and Methods

Materials

We used lentiviral overexpression plasmid pLVX- mCMV-Zs Green (Biowit), 293T cell lines (Biowit), BDNF first antibodies (Abcam), DAT first antibodies (Abcam), DRD1 first antibodies (Abcam), DRD2 first antibodies (Abcam), DRD3 first antibodies (Abcam), heroin (Guizhou Province Public Security Bureau, with purity of 92.09%), naloxone (Chongqing Yaoyou pharmaceutical), RNeasy Mini Kit (Qiagen), RT2 First-Strand Kit (Qiagen), and RT2 SYBR Green Mastermix (Qiagen).

Experimental animals

Adult male Sprague-Dawley (SD) rats, weighing 180–220 g, provided by the Experimental Animal Center of Guizhou Medical University, were randomly divided into 4 groups: a heroin addiction group, a BDNF lentivirus group, a blank virus group, a sham operation group, and a saline control group. Rats were fed in cages and were allowed to freely drink and eat. The Experimental Animal Ethics Committee of Guizhou Medical University approved the experimental program.

Heroin-addicted rats model

Heroin-addicted rats were given progressively increasing injections of the heroin solution by weight, with the dose of 3 mg/kg in the first day, 2 times/d (8 AM, 3 PM). The daily increasing dose was 3 mg/kg, with continuous subcutaneous injection of heroin for 9 days. On the 9th day, the amount of heroin injection given was 27 mg/kg. No treatment was given to the rats in the normal control group. Rats in the heroin addiction group and normal control group were decapitated after anesthesia on the 10th day, and NAc was removed and frozen at −80°C using liquid nitrogen for preservation.

PCR Gene Chip Production (RT2Profiler™ PCR Array)

RT2Profiler™PCR Array (Biosciences, SA) was used to analyze and screen the expression changes of 84 genes associated with the DA system and the relevant pathways in NAc brain areas that are important in drug addiction. The main steps were: the Mini Kit RNeasy (Qiagen) was used to extract total RNA and detect purity, followed by electrophoresis of the RNA sample. After using the RT2 First-Strand Kit (Qiagen) for synthesis of cDNA, the RT2SYBR Green Mastermix (Qiagen) was used for the detection of genes. ΔΔCt method was used to calculate the ΔΔCt of each gene in the 2 groups, which can be expressed as ΔΔCt=ΔCt (heroin addiction group)−ΔCt (normal control group), and 2−ΔΔCt was used for calculation of the corresponding gene expression differences in the heroin addiction group and the normal control group. Compared with normal control rats, gene expression more than 2 times or less than 0.5 times were regarded as differentially expressed in the heroin addiction group [16].

pLVX-rBDNF-mCMV-ZsGreenPlasmid construction

The plasmid pLVX-mCMV-ZsGreen was digested by EcoRI+BamHI double enzyme, and the large fragment and the target gene were recycled and then ligated to the corresponding gene (connection response was in 22°C, reaction for 2 h). The ligation products were transformed into JM109-competent bacteria, 100 μL of which were inoculated in the LB plate containing 100 μg/ml Ampicillin, and inversely cultured overnight in a culture box with constant temperature of 37°C. Two single colonies were selected to be inoculated into 5 ml LB culture liquid with 100 μg/ml Ampicillin and allowed to grow with overnight shaking at 250 rpm and a constant temperature of 37°C. The plasmids were extracted with a mini Plasmid Extraction Kit, followed by plasmid EcoRI+BamHI double-enzyme digestion and 1% agarose gel electrophoresis. Sequencing analysis was conducted to identify the correct insertion of the DNA fragment.

Transfection of 293T cells and viral titer determination

Subculture cells: 293T cells were digested with 0.25% trypsin, and the cell density was adjusted by DMEM culture medium containing 10% serum, then 6~8×106 cells were inoculated in 10cm cell culture dishes at 37°C, and cultured in a 5% CO2 incubator, which can be used for transfection until 80–90% cell density. The recombinant plasmid pLVX-rBDNF-mCMV-ZsGreen carrying the target gene pLVX-rBDNF-mCMV-ZsGreen and the system plasmid were co-transfected to 293T cells. The viral supernatant was collected with 1000 rpm centrifugation for 5 min, followed by virus particles precipitation and virus suspension with 1 mL PBS, and then aliquoted into tubes of 10 μL/EP and stored at −70°C. Trypsin-digested 293T cells were inoculated into 6-well plates according to 2×105/holes. The above were cultured in a 37°C and 5% CO2 incubator until 50% fusion of cells. The lentivirus liquid was serially diluted (10−1~10−5) with the final volume of 1 mL. The cell culture fluid was discarded, and the above concentration of the virus (including liquid solution) was added to the 6-well plates.

Virus titer determination: after 72 h, positive cells were counted under fluorescence microscope for calculating virus titer (virus titer=GFP positive cells rate×total number of cells/lentivirus liquid volume×lentivirus dilution ratio) (TU/ml). To avoid error, only 1~30% of holes of the GFP positive cell rates were selected, and the average values of each group were calculated.

Microinjection of intracranial lentivirus in NAc region of rats

Rats were injected and anesthetized by 3% intraperitoneal sodium, and fixed on the brain stereo-positioning instrument. Rat scalps were disinfected by alcohol and iodophor, and a surgical knife was used for cutting off the skin, then we performed blunt separation of muscle and periosteum, with exposure to the surgical field of vision. The anterior midline, lambdoid suture, coronal suture, and other landmark positions were found. The related brain regions of rats with coordinates (bregma was regarded as 0, NAc: the anterior fontanelle 1.2 mm, lateral to the midline open 2 mm, subdural 7 mm) were determined through the brain stereo-positioning instrument. Holes were drilled in the skull by use of a dental drill. Rats in the BDNF lentivirus group were slowly injected with BDNF lentivirus using micro-needles; rats in the sham operation group were only cut using a scalpel, without drilling or microinjection; and rats in BDNF blank virus groups were slowly injected with the blank virus as a control. After suturing the scalp, rats were allowed to recover for 7 days. NAc brain tissue was taken from the rats after anesthesia and transfection with a slow virus vector, and then the expression level of BDNF was determined by Western blot technique to finally identify the effect of the transfection of the virus.

Establishment of naloxone withdrawal model

Rats in the BDNF lentivirus group, blank virus group, and sham operation group were progressively given increased injections of heroin solution by weight injection, with the dose of 3 mg/kg in the first day and given 2 times/d (8 AM, 3 PM). The daily increasing dose was 3 mg/kg, with continuous subcutaneous injection of heroin for 9 days. On the 9th day, the amount of heroin injected was 27 mg/kg. Rats in the saline group were injected with the same dose of normal saline every day.

On the 10th day, rats in each group were injected with 5 mg/kg naloxone. The rats in each group were observed for 30 min and the numbers of withdrawal symptoms were recorded. The withdrawal symptoms included tooth flutter, jumping, twisting, “wet-dog” shaking, and standing. Weight measurements were performed both before and after observation, and then the rats were anesthetized by intraperitoneal injection of 3% sodium and the brain tissue was taken. By referring to the rat brain stereotaxic atlas [17], NAc brain regions were located and removed, frozen using liquid nitrogen, and stored at −80°C.

CPP model building

Rats in the CPP experiment box were allowed to adapt for 3 days in the black box and white box, 15 min each time, once a day. On the third day, the residence time of rats within 15 min in the white box and black box were recorded, and rats with natural preference for the black box were selected. Black boxes were used as saline water tanks and the white boxes were used for training rats.

Rats were trained in a white box for 40 min after injection, with continuous subcutaneous injection of heroin for 9 days. In the afternoon, the rats were injected with the same dose of normal saline injection, and trained in a black box for 40 min after injection by the same method. In the control group, rats were treated with normal saline instead of heroin and the training method was the same as above.

On the 10th day, the rats were moved into the CPP box, the central partition was removed for free activities in the box for 15 min, the residence time of rats in the medicine chest was recorded and compared with the residence time before training. After the test, the rats were anesthetized by intraperitoneal injection of 3% sodium and the brain tissue was taken, frozen in liquid nitrogen, and stored at −80°C.

Western blot detection

For preparation of SDS-PAGE gel, the extracted samples of the total protein were denatured, separated using SDS-PAGE gel, and transferred to a PVDF membrane using standard methods. For detection, the primary antibody was diluted 1: 1000 and the membrane was incubated overnight in the primary antibody working fluid at 4°C. After washing in TBST, the membrane was incubated in the secondary antibody working liquid for 60 min. Chemical luminescence method was used for detection and collection of images.

Statistical analysis

Data obtained were statistically analyzed by use of the SPSS 11.5 software package. Single-factor analysis of variance was used for comparison between groups, and P<0.05 indicated that the difference was significant.

Results

Gene chips

Gene expression changes for 20 genes associated with DA in the NAc of heroin-addicted rats are summarized in Table 1 (Figures 1, 2).

Table 1.

Expression of DA related genes in NAc of heroin-addicted rats.

Gene name Description Folds up or down regulation
Adcy1 Adenylatecyclase 1 2.29↑
Adcy5 Adenylatecyclase 5 2.70↑
DRD1 Dopamine receptor D1A 4.71↑
DRD2 Dopamine receptor D2 3.12↑
DRD3 Dopamine receptor D3 3.66↑
Dusp1 Dual specificity phosphatase 1 3.10↑
Fos FBJ osteosarcoma oncogene 2.03↑
Alox12 Arachidonate 12-lipoxygenase 2.22↑
Mapk1 Mitogen activated protein kinase 1 3.16↑
Nr4a1 Nuclear receptor subfamily 4, group A, member 1 4.28↑
Nr4a3 Nuclear receptor subfamily 4, group A, member 3 4.01↑
Pde10a Phosphodiesterase 10A 10.35↑
Pde4a Phosphodiesterase 4A 2.61↑
Pdyn Prodynorphin 3.16↑
DAT Dopamine transporter 3.08↑
Slc18a2 Solute carrier family 18, member 2 0.12↓
Tdo2 Tryptophan 2,3-dioxygenase 0.41↓
TH Tyrosine hydroxylase 0.38↓
Tph2 Tryptophan hydroxylase 2 2.67↑
BDNF brain derived neurotrophic factor 0.50↓

↑ Increase in gene expression; ↓ decrease in gene expression.

Figure 1.

Figure 1

Venn diagram for DA-associated gene expression in NAc of heroin-addicted rats.

Figure 2.

Figure 2

Expression of TH, DRD, and DAT in NAc brain area of heroin-addicted rats.

Two signal pathways most evidently showed gene expression change: the cAMP/PKA pathway (TH, DRD, DAT, BDNF, ADCY1, ADCY5, DUSP1, FOS, MAPK1, PPP1R1B), and the PLC pathway (TH, DRD, DAT, BDNF, ITPR1, PLCB1). The common genes in the 2 pathways were TH DRD, DAT, and BDNF (Figures 3), among which the expressions of DRD1, DRD2, DRD3, and DAT were higher than in the normal group. TH and BDNF showed decreased expression, while DRD4 and DRD5 showed no significant difference (Figures 3, 4).

Figure 3.

Figure 3

pLVX-rBDNF-mCMV-ZsGreen plasmid enzyme digestion results. Band M – Trans2K plus marker; Band1 – pLVX-rBDNF-mCMV-ZsGreen plasmid.

Figure 4.

Figure 4

Cell fluorescence expression of pLVX-rBDNF-mCMV-ZsGreen transfected in 293T cells. (A) Green fluorescence after transfection, (B) White fluorescence after transfection, (C) Green fluorescence after transfection at 48 h, (D) White fluorescence after transfection at 48 h.

pLVX-rBDNF-mCMV-ZsGreen plasmid enzyme digestion results

The results of enzyme digestion showed a clear band at 750 bp, indicating positive clones (Figure 3).

pLVX-rBDNF-mCMV-ZsGreen Plasmid sequencing results

The pLVX-rBDNF-mCMV-ZsGreen plasmids were sequenced and the results were as follows:

  • TAATTTTGTTTAACTTTAAGAAGGAGATATACCATGGATCCGTATGGCAGGAAGAAGCGGAGACAGCGACGAAGAGCGCCCATGAAAGAAGCAAACGTCCACGGACAAGGCAACTTGGCCTACCCAGCTGTGCGGACCCATGGGACTCTGGAGAGCGTGAATGGGCCCAGGGCAGGTTCGAGAGGTCTGACGACGACGTCCCTGGCTGACACTTTTGAGCACGTGATCGAAGAGCTGCTGGATGAGGACCAGAAGGTTCGGCCCAACGAAGAAAACCATAAGGACGCGGACTTGTACACTTCCCGGGTGATGCTCAGCAGTCAAGTGCCTTTGGAGCCTCCTCTGCTCTTTCTGCTGGAGGAATACAAAAATTACCTGGATGCCGCAAACATGTCTATGAGGGTTCGGCGCCACTCCGACCCCGCCCGCCGTGGGGAGCTGAGCGTGTGTGACAGTATTAGCGAGTGGGTCACAGCGGCAGATAAAAAGACTGCAGTGGACATGTCCGGTGGGACGGTCACAGTCCTGGAGAAAGTCCCGGTATCAAAAGGCCAACTGAAGCAATATTTCTACGAGACCAAGTGTAATCCCATGGGTTACACGAAGGAAGGCTGCAGGGGCATAGACAAAAGGCACTGGAACTCGCAATGCCGAACTACCCAATCGTATGTTCGGGCCCTTACTATGGATAGCAAAAAGAGAATTGGCTGGCGGTTCATAAGGATAGACACTTCCTGTGTATGTACACTGACCATTAAAAGGGGAAGACTCGAGCACCACCACCACCACCACTGAGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGCTGAAAGGAGGAACTATATCCGGATTGGCGAA

The sequencing results showed that the plasmid was constructed successfully.

Transfection of 293T cells with pLVX-rBDNF-mCMV-ZsGreen plasmid

The recombinant plasmid pLVX-rBDNF-mCMV-ZsGreen with the target gene were used for transfecting the 293 T cells, and the fluorescence was observed under the microscope within 24 h before and after transfection (Figure 4).

Effect of BDNF over expression

BDNF was transfected into rats in the lentivirus group and normal rats. After anesthesia, the NAc brain areas were taken and BDNF was detected by Western blot method. Compared with the normal control group, rats in the BDNF lentivirus group showed a higher BDNF expression in the NAc region, confirming the successful construction of the BDNF overexpression model (Figure 5).

Figure 5.

Figure 5

BDNF protein expression. (A) BDNF lentivirus, (B) Normal control.

Observation of withdrawal symptoms

Naloxone withdrawal rats showed statistically significant reduced body weight compared with the control group. The weight loss of rats in the BDNF virus group was less than that in the blank virus group and sham operation group (Figure 6A).

Figure 6.

Figure 6

Comparison of withdrawal symptoms and weight loss in each group. * Compared with control group, P<0.05; # compared with lentivirus group, P<0.05.

The rats in the blank virus group and the sham operation group showed obvious jumping, standing, “wet-dog” shaking, torsion, and tooth fibrillation. The withdrawal symptoms of rats in the BDNF lentivirus group were mild, and these symptoms were not observed in the control group (Figure 6B).

CPP test

After CPP training for 9 days, rats were put into the CPP box. The central partition was removed for free activities for 15 min in the box, and the residence time of rats in the box was recorded. In the control group, the residence time of rats in the white box was not significantly different (P>0.05) from that before training. In the blank virus group and sham operation group, the residence time of rats in the white box was significantly longer than that before training (P<0.05). In the BDNF lentivirus group, the residence times of rats in the white box before and after training were not significantly different (Table 2, Figure 7). CPP results showed that in the blank virus group and sham operation group, rats showed preference for the white box, and in BDNF the lentivirus group, the residence time in the white box of rats was not significantly different from that before training.

Table 2.

Residence time of rats in the white boxbefore and after training (Time scale: 0–900 seconds).

Control group Blank virus group Sham operation group BDNF lentivirus group
Before training 212±48 258±36 262±41 231±43
After training 195±50# 555±61* 492±25* 255±80#
*

Compared with that before training, P<0.05;

#

compared with that before training, P>0.05.

Figure 7.

Figure 7

Residence time of rats in the white box before and after training (Time scale: 0–900 s). * Compared with that before training, P<0.05; # compared with that before training, P>0.05.

Western blot analysis

Western blot results showed that in the CPP test and naloxone precipitated withdrawal experiment, in the virus control group and sham operation group, DRD1, DRD2, DRD3, and DAT levels in NAc decreased, and in the BDNF lentivirus group, DRD3 and DAT levels in NAc increased (Figures 8, 9).

Figure 8.

Figure 8

Protein expression of DRD1, DRD2, DRD3, and DAT in each group as determined by Western blot method. A – Control group, B – BDNF lentivirus group, C – Blank virus group, D – Sham operation group.

Figure 9.

Figure 9

Quantitation of the relative expression of DRD1, DRD2, DRD3, and DAT in each group by Western blot. A – Control group, B – BDNF lentivirus group, C – Blank virus group, D – Sham operation group. * Compared with the control group, P<0.05.

Discussion

In this study, we used PCR gene chip technology to detect the 84 genes associated with DA in the NAc brain region of heroin-addicted rats. We determined 20 genes showing expression changes. There were 2 signalling pathways that were most evidently showing gene expression changes, namely: the cAMP/PKA pathway (TH, DRD, DAT, BDNF, ADCY1, ADCY5, DUSP1, FOS, MAPK1, PPP1R1B), and the PLC pathway (TH, DRD, DAT, BDNF, ITPR1, PLCB1). The common genes in the 2 pathways were TH DRD, DAT, and BDNF. Therefore, we showed that the DA system and BDNF are involved in the regulation of the heroin addiction process.

The reward effect, sensitization, and craving of drug addiction were all related to the DA system. The common feature of addictive drugs is that these drugs can cause the increased release of DA from DA neuron endings in NAc, as well as cause reward effect of drugs on DRD, resulting in “heart addiction”. In addition, opioids not only promote the release of DA, but also inhibit the heavy absorption of transmitter DA for neurons [18], so that DA transmitters in synaptic gaps increase, thus enhancing the function of the DA system, resulting in a reward effect. This rewarding effect is the basis of the compulsive drug-seeking behavior of addicts [19,20]. DA transmitter can only play a role mediated through DAT, and DRD regulates DA nerve transmission. Moreover, DRD can control the DA homeostasis in neurons through the heavy intake of DA [8,21]. Therefore, the present research mainly focused on DRD and DAT. Inhibiting the increase of DA release or blocking reward effect may become a therapeutic tool for drug addiction.

It has been reported that BDNF has an important regulatory role for DA [22], and can also interact with DRD and DAT [2325]. BDNF injection for NAc can produce a similar abnormal reward circuit excitement induced by opioids [15]. Therefore, we put forward the hypothesis that by changing the expression of BDNF in NAc, interrupting the effect of BDNF on DA neurons may have therapeutic implications for heroin addiction. In this study, BDNF overexpression was induced by BDNF lentivirus transfection, then the heroin CPP model and naloxone withdrawal model were established, and the effect of CPP and naloxone withdrawal on the high level of BDNF was observed. CPP results showed that, in the blank virus group and sham operation group, rats showed preference for the CPP box, and in BDNF the lentivirus group, the residence time in the CPP box of rats had no statistical significance compared to that before training. This indicates that BDNF intervention can reduce the drug craving of rats induced by environmental factor stimulation.

DRD1, DRD2, DRD3, and NAc levels in the DAT brain regions of the blank virus and sham operation group were decreased, while in the BDNF lentivirus group, DRD3 and DAT levels in the NAc area were increased. Reports showed that DRD3 is regulated by BDNF regulation. If the role of BDNF receptor was blocked, it reduces the DRD3 expression [24], so we speculated that BDNF mainly regulates the body by acting on DRD3. Hence, the overexpression of BDNF could activate the DRD3 function [26], thus leading to a reward effect after combination with DA. BDNF and DRD3 can also enhance the function of DAT on DA re-uptake, so that DA levels in VTA and NAc are relatively stable [27,28]. DRD in the blank virus group and sham operation group were observed at low levels, which could not be combined with DA to produce enough reward and led to the appearance of the drug craving, as well as CPP behavior induced by environmental cues.

Naloxone precipitating in withdrawal can cause the body to change the secretion of neurotransmitter and increase the release of DA and its metabolites, which is speculated to participate in mediating withdrawal symptoms [2931]. It is also reported that drug withdrawal can enhance the inhibitory effect of GABA neurons on the VTA area, thus the postsynaptic potential of DA neurons was inhibited [32]. In addition, drug addiction also caused the binding force of DRD1, DRD2, and DRD3 to decrease [33,34]. Due to the inhibition of DA neuron function and DRD binding force reduction, DA cannot combine with DRD to play a physiological function, causing a sharp withdrawal reaction, which can drive addicts to drug-seeking and relapse [35]. In the naloxone withdrawal test, we observed that the DRD and DAT levels in the rats were lower than those in the control group, but the level of DAT and DRD3 of the NAc region in the BDNF lentivirus group was higher than that in the control and the sham operation group. The reasons for the mild withdrawal symptoms of rats with BDNF intervention were as follows: (1) BDNF can increase DA [36]; (2) BDNF increased the expression of DRD3 [26], which could combine with DA to produce partial physiological function; and (3) BDNF itself can produce a reward effect similar to that induced by opioid drugs [15].

Conclusions

Gene chip results showed that BDNF, DA, DRD1, DRD2, DRD3, and DAT in the NAc brain region are involved in the process of heroin addiction. BDNF overexpression in NAc can induce up-regulation of DRD3 and DAT, which is helpful to reduce the withdrawal symptoms and craving behavior induced by environmental cues in heroin-addicted rats.

Abbreviations

Adcy1

adenylatecyclase1

Adcy5

adenylatecyclase5

BDNF

brain-derived neurotrophic factor

CPP

conditioned place preference

DA

dopamine

DAT

dopamine transporter

Dusp1

dual-specificity phosphatase1

DRD

dopamine receptor

Fos

FBJ osteosarcoma oncogene

ITPR1

inositol triphosphate receptor1

Mapk1

mitogen-activated protein kinase1

NAc

nucleus accumbens

PLCB1

1-phosphatidylinositol 4, 5-bisphosphate phosphodiesterase beta-1

PPP1R1B

protein phosphatase 1 regulatory subunit 1B

TH

tyrosine hydroxylase

Footnotes

Source of support: This study was supported by the National Natural Science Foundation of China (No. 81060110), the Social Development Research Fund of Guizhou Province (No. [2012]3141 and [2015]7321), and the Scientific Research Fund of Guizhou Provincial Education Department (No. [2011]48 and [2014]268)

References

  • 1.Garcia-Pardo MP, Roger-Sanchez C, Rodriguez-Arias M, et al. Pharmacological modulation of protein kinases as a new approach to treat addiction to cocaine and opiates. Eur J Pharmacol. 2016;781:10–24. doi: 10.1016/j.ejphar.2016.03.065. [DOI] [PubMed] [Google Scholar]
  • 2.Hyman SE, Malenka RC, Nestler EJ. Neural mechanisms of addiction: The role of reward-related learning and memory. Ann Rev Neurosci. 2006;29:565–98. doi: 10.1146/annurev.neuro.29.051605.113009. [DOI] [PubMed] [Google Scholar]
  • 3.Fattore L, Diana M. Drug addiction: An affective-cognitive disorder in need of a cure. Neurosci Biobehav Rev. 2016;65:341–61. doi: 10.1016/j.neubiorev.2016.04.006. [DOI] [PubMed] [Google Scholar]
  • 4.Everitt BJ, Robbins TW. Neural systems of reinforcement for drug addiction: From actions to habits to compulsion. Nat Neurosci. 2005;8(11):1481–89. doi: 10.1038/nn1579. [DOI] [PubMed] [Google Scholar]
  • 5.Niehaus JL, Murali M, Kauer JA. Drugs of abuse and stress impair LTP at inhibitory synapses in the ventral tegmental area. Eur J Neurosci. 2010;32(1):108–17. doi: 10.1111/j.1460-9568.2010.07256.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Tsai HC, Zhang F, Adamantidis A, et al. Phasic firing in dopaminergic neurons is sufficient for behavioral conditioning. Science. 2009;324(5930):1080–84. doi: 10.1126/science.1168878. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Gingrich JA, Caron MG. Recent advances in the molecular biology of dopamine receptors. Ann Rev Neurosci. 1993;16:299–321. doi: 10.1146/annurev.ne.16.030193.001503. [DOI] [PubMed] [Google Scholar]
  • 8.Schmitt KC, Reith ME. Regulation of the dopamine transporter: Aspects relevant to psychostimulant drugs of abuse. Ann NY Acad Sci. 2010;1187:316–40. doi: 10.1111/j.1749-6632.2009.05148.x. [DOI] [PubMed] [Google Scholar]
  • 9.Gainetdinov RR, Caron MG. Monoamine transporters: From genes to behavior. Ann Rev Pharmacol Toxicol. 2003;43:261–84. doi: 10.1146/annurev.pharmtox.43.050802.112309. [DOI] [PubMed] [Google Scholar]
  • 10.Altar CA, Cai N, Bliven T, et al. Anterograde transport of brain-derived neurotrophic factor and its role in the brain. Nature. 1997;389(6653):856–60. doi: 10.1038/39885. [DOI] [PubMed] [Google Scholar]
  • 11.Lu Y, Christian K, Lu B. BDNF: A key regulator for protein synthesis-dependent LTP and long-term memory? Neurobiol Learn Mem. 2008;89(3):312–23. doi: 10.1016/j.nlm.2007.08.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Hatami H, Oryan S, Semnanian S, et al. Alterations of BDNF and NT-3 genes expression in the nucleus paragigantocellularis during morphine dependency and withdrawal. Neuropeptides. 2007;41(5):321–28. doi: 10.1016/j.npep.2007.04.007. [DOI] [PubMed] [Google Scholar]
  • 13.Chu NN, Zuo YF, Meng L, et al. Peripheral electrical stimulation reversed the cell size reduction and increased BDNF level in the ventral tegmental area in chronic morphine-treated rats. Brain Res. 2007;1182:90–98. doi: 10.1016/j.brainres.2007.08.086. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Koo JW, Mazei-Robison MS, Chaudhury D, et al. BDNF is a negative modulator of morphine action. Science. 2012;338(6103):124–28. doi: 10.1126/science.1222265. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Vargas-Perez H, Ting AKR, Walton CH, et al. Ventral tegmental area BDNF induces an opiate-dependent-like reward state in naive rats. Science. 2009;324(5935):1732–34. doi: 10.1126/science.1168501. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Liao DL, Cheng MC, Lai CH, et al. Comparative gene expression profiling analysis of lymphoblastoid cells reveals neuron-specific enolase gene (ENO2) as a susceptibility gene of heroin dependence. Addict Biol. 2014;19(1):102–10. doi: 10.1111/j.1369-1600.2011.00390.x. [DOI] [PubMed] [Google Scholar]
  • 17.Paxinos G, Watson C. The rat brain in stereotaxic coordinates. Academic Press; 1997. [DOI] [PubMed] [Google Scholar]
  • 18.Di Chiara G, Imperato A. Drugs abused by humans preferentially increase synaptic dopamine concentrations in the mesolimbic system of freely moving rats. Proc Natl Acad Sci USA. 1988;85(14):5274–78. doi: 10.1073/pnas.85.14.5274. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Willuhn I, Wanat MJ, Clark JJ, Phillips PE. Dopamine signaling in the nucleus accumbens of animals self-administering drugs of abuse. Curr Top Behav Neurosci. 2010;3:29–71. doi: 10.1007/7854_2009_27. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Clay SW, Allen J, Parran T. A review of addiction. Postgrad Med. 2008;120(2):E01–7. doi: 10.3810/pgm.2008.07.1802. [DOI] [PubMed] [Google Scholar]
  • 21.Zhu J, Reith ME. Role of the dopamine transporter in the action of psychostimulants, nicotine, and other drugs of abuse. CNS Neurol Dis Drug Targets. 2008;7(5):393–409. doi: 10.2174/187152708786927877. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Hyman C, Hofer M, Barde YA, et al. BDNF is a neurotrophic factor for dopaminergic neurons of the substantia nigra. Nature. 1991;350(6315):230–32. doi: 10.1038/350230a0. [DOI] [PubMed] [Google Scholar]
  • 23.Hasbi A, Fan T, Alijaniaram M, et al. Calcium signaling cascade links dopamine D1–D2 receptor heteromer to striatal BDNF production and neuronal growth. Proc Natl Acad Sci. 2009;106(50):21377–82. doi: 10.1073/pnas.0903676106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Guillin O, Diaz J, Carroll P, et al. BDNF controls dopamine D3 receptor expression and triggers behavioural sensitization. Nature. 2001;411(6833):86–89. doi: 10.1038/35075076. [DOI] [PubMed] [Google Scholar]
  • 25.Fumagalli F, Racagni G, Colombo E, Riva MA. BDNF gene expression is reduced in the frontal cortex of dopamine transporter knockout mice. Mol Psychiatry. 2003;8(11):898–99. doi: 10.1038/sj.mp.4001370. [DOI] [PubMed] [Google Scholar]
  • 26.Razgado-Hernandez LF, Espadas-Alvarez AJ, Reyna-Velazquez P, et al. The transfection of BDNF to dopamine neurons potentiates the effect of dopamine D3 receptor agonist recovering the striatal innervation, dendritic spines and motor behavior in an aged rat model of Parkinson’s disease. PLoS One. 2015;10(2):e0117391. doi: 10.1371/journal.pone.0117391. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Zapata A, Shippenberg TS. D(3) receptor ligands modulate extracellular dopamine clearance in the nucleus accumbens. J Neurochem. 2002;81(5):1035–42. doi: 10.1046/j.1471-4159.2002.00893.x. [DOI] [PubMed] [Google Scholar]
  • 28.Hyman C, Juhasz M, Jackson C, et al. Overlapping and distinct actions of the neurotrophins BDNF, NT-3, and NT-4/5 on cultured dopaminergic and GABAergic neurons of the ventral mesencephalon. J Neurosci. 1994;14(1):335–47. doi: 10.1523/JNEUROSCI.14-01-00335.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Rauf K, Subhan F, Sewell RD. A Bacoside containing Bacopa monnieri extract reduces both morphine hyperactivity plus the elevated striatal dopamine and serotonin turnover. Phytother Res. 2012;26(5):758–63. doi: 10.1002/ptr.3631. [DOI] [PubMed] [Google Scholar]
  • 30.Trigub M, Kudrin V, Bashkatova V, et al. Biogenic amine neurotransmitter response to morphine in the anterior cingulate cortex predicts propensity for acquiring self-administration and the intensity of the withdrawal syndrome. Pharmacology and Pharmacy. 2014:1006–14. [Google Scholar]
  • 31.Fuertes G, Laorden ML, Milanes MV. Noradrenergic and dopaminergic activity in the hypothalamic paraventricular nucleus after naloxone-induced morphine withdrawal. Neuroendocrinology. 2000;71(1):60–67. doi: 10.1159/000054521. [DOI] [PubMed] [Google Scholar]
  • 32.Bonci A, Williams JT. Increased probability of GABA release during withdrawal from morphine. J Neurosci. 1997;17(2):796–803. doi: 10.1523/JNEUROSCI.17-02-00796.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Di Chiara G, Bassareo V. Reward system and addiction: What dopamine does and doesn’t do. Curr Opin Pharmacol. 2007;7(1):69–76. doi: 10.1016/j.coph.2006.11.003. [DOI] [PubMed] [Google Scholar]
  • 34.Georges F, Stinus L, Bloch B, Le Moine C. Chronic morphine exposure and spontaneous withdrawal are associated with modifications of dopamine receptor and neuropeptide gene expression in the rat striatum. Eur J Neurosci. 1999;11(2):481–90. doi: 10.1046/j.1460-9568.1999.00462.x. [DOI] [PubMed] [Google Scholar]
  • 35.Lee B, London ED, Poldrack RA, et al. Striatal dopamine d2/d3 receptor availability is reduced in methamphetamine dependence and is linked to impulsivity. J Neurosci. 2009;29(47):14734–40. doi: 10.1523/JNEUROSCI.3765-09.2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Feng L, Wang CY, Jiang H, et al. Differential effects of GDNF and BDNF on cultured ventral mesencephalic neurons. Brain Res Mol Brain Res. 1999;66(1–2):62–70. doi: 10.1016/s0169-328x(99)00015-7. [DOI] [PubMed] [Google Scholar]

Articles from Medical Science Monitor : International Medical Journal of Experimental and Clinical Research are provided here courtesy of International Scientific Information, Inc.

RESOURCES