New Macrolide-Lincosamide-Streptogramin B Resistance Gene erm(48) on the Novel Plasmid pJW2311 in Staphylococcus xylosus

ABSTRACT

Whole-genome sequencing of Staphylococcus xylosus strain JW2311 from bovine mastitis milk identified the novel 49.3-kb macrolide-lincosamide-streptogramin B (MLS_B) resistance plasmid pJW2311. It contained the macrolide resistance gene mph(C), the macrolide-streptogramin B resistance gene msr(A), and the new MLS_B resistance gene erm(48) and could be transformed into Staphylococcus aureus by electroporation. Functionality of erm(48) was demonstrated by cloning and expression in S. aureus.

TEXT

Staphylococcus xylosus is an important cause of subclinical bovine mastitis and is therefore in frequent contact with intramammary antibiotics used for mastitis treatment, such as macrolides and lincosamides (1). S. xylosus strain JW2311 was isolated from bovine mastitis milk in Switzerland in 2010. It was highly resistant to erythromycin, with an MIC of >256 μg/ml, and susceptible to clindamycin, with an MIC of 0.25 μg/ml, as determined by the broth dilution method (2). However, inducible clindamycin resistance was observed by D-test, suggesting the presence of an erm methylase (2). By use of a microarray, S. xylosus JW2311 was found to carry the macrolide phosphorylase gene mph(C) and the macrolide-streptogramin B ATP-binding-cassette (ABC) family efflux transporter gene msr(A) (3). The mechanism responsible for the inducible clindamycin resistance phenotype remained unknown. Whole-genome sequencing was performed to identify the nature of the inducible clindamycin resistance phenotype in S. xylosus strain JW2311.

Identification of erm(48) and plasmid pJW2311.

The whole-genome sequence of S. xylosus JW2311 was obtained using Illumina MiSeq sequencing (Nextera XT DNA library prep kit and MiSeq reagent kit v2; Illumina, San Diego, CA). Fastq reads (≥73.66% of bases above Q30) were trimmed and paired before being assembled de novo using default values of the Geneious in-house assembler version 6.1.5 (4). BLASTN alignment of the generated contigs to the nucleotide sequence of erm(A) identified an open reading frame (ORF) of 735-bp that exhibited 66% nucleotide (nt) identity to erm(A) and was the novel gene erm(48). This ORF was located on a 49,273-bp circular contig, which constituted plasmid pJW2311 (Fig. 1). To verify the assembly and its association with the MLS_B phenotype, plasmid DNA of JW2311 was transformed into S. aureus RN4220 by electrotransformation with 20 μg/ml of erythromycin in brain heart infusion (BHI) agar selective plates (5). The transformed plasmid was subsequently sequenced with Roche 454 GS Junior and assembled with Newbler software, confirming the pJW2311 plasmid structure. In S. aureus, plasmid pJW2311 confers high levels of resistance to erythromycin, as well as inducible clindamycin resistance (Table 1).

FIG 1.

Schematic representation of pJW2311 (ENA accession number LT223129). The inner circle plots the G+C content; the outer circle presents position and orientation of open reading frames (ORFs) of pJW2311. ORFs are indicated by arrows. ORFs coding for antibiotic resistance genes [erm(48), msr(A), mph(C)] are pink. Hypothetical functions of additional ORFs are listed beside the corresponding arrows and are color coded as follows: green, bacterial metabolism; blue, membrane proteins and transporters; black, regulatory proteins; yellow, transposase; red, plasmid replication; gray, unattributed. The circular map of pJW2311 was drawn using DNAPlotter (http://www.sanger.ac.uk/science/tools/dnaplotter).

TABLE 1.

MICs of erythromycin, clindamycin, and pristinamycin Ia with and without induction for different S. aureus and S. xylosus strains, determined by broth microdilution

Strain	Origin and characteristicsa	Reference	D-testb	MIC (μg/ml) ofc:
				ERY	CLI	iCLI	PIA	iPIA
S. aureus
RN4220	Plasmid-free recipient for electrotransformation	24	−	0.125	≤0.06	NA	4	NA
RN4220/pBUS1-HC	RN4220 containing cloning vector pBUS1-HC	12	−	0.125	≤0.06	NA	4	NA
RN4220/pBUS1-Pcap-HC	RN4220 containing cloning vector pBUS1-Pcap-HC	12	−	0.125	≤0.06	NA	2	NA
RN4220/pJW2311	RN4220 harboring a complete 49,273-bp plasmid pJW2311 [msr(A), mph(C), erm(48)]	This study	+	>256	≤0.06	0.25	4	8
RN4220/pJW37	RN4220 harboring a 1,465-bp fragment containing erm(48) cloned into SalI/SpeI restriction sites of pBUS1-HC [inducible erm(48) under control of its own promoter]	This study	+	64	≤0.06	0.25	4	4
RN4220/pJW23	RN4220 harboring a 826-bp fragment containing erm(48) cloned into NdeI/SpeI restriction sites of pBUS1-Pcap-HC [constitutively expressed erm(48) from cap1A promoter]	This study	−	>256	>256	NA	16	NA
S. xylosus
JW2311	Bovine mastitis milk [msr(A), mph(C), erm(48)]; cow 1, farm 1	This study	+	>256	0.25	0.5	32	64
M3134	Bovine mastitis milk [msr(A), mph(C), erm(48)]; cow 2, farm 2	This study	+	>256	0.25	0.25	16	64
M3201	Bovine mastitis milk [msr(A), mph(C), erm(48)]; cow 3, farm 2	This study	+	>256	0.25	0.25	16	32
M3597	Bovine mastitis milk [msr(A), mph(C), erm(48)]; cow 4, farm 2	This study	+	>256	0.25	0.25	16	32
M3551	Bovine mastitis milk [msr(A), mph(C), erm(48)]; cow 5, farm 2	This study	+	>256	0.25	0.25	16	64
M3766	Bovine mastitis milk [msr(A), mph(C), erm(48)]; cow 6, farm 2	This study	+	>256	0.25	0.25	16	32
M0232	Bovine mastitis milk [msr(A), mph(C), erm(48)]; cow 7, farm 2	This study	+	>256	0.25	0.25	16	32
M1595-2/10	Bovine mastitis milk; cow 8, farm 3	This study	−	0.25	0.125	NA	8	NA
M39-2/10	Bovine mastitis milk; cow 9, farm 4	This study	−	0.25	0.125	NA	8	NA

^aAntibiotic resistance genes and functions: msr(A), macrolide and streptogramin B efflux gene; mph(C), macrolide phosphotransferase gene; erm(48), 23S rRNA methylase gene. Vectors pBUS1-HC and pBUS1-P_cap-HC are high-copy pBUS1 derivatives (12); pBUS1-HC is a promoterless cloning vector, and pBUS1-P_cap-HC is an expression vector that harbors the strong cap1A promoter of the S. aureus type 1 capsular polysaccharide biosynthesis gene cluster.

^bD-test: +, positive; −, negative.

^cERY, erythromycin (macrolide); CLI, clindamycin (lincosamide); PIA, pristinamycin IA (streptogramin B); iCLI and iPIA, 1 μg/ml erythromycin added to broth for detection of inducible resistance to clindamycin (iCLI) and pristinamycin IA (iPIA). NA, not applicable.

Characterization of erm(48).

The erm(48) gene coded for a putative 23S rRNA methylase that contained the PS01131 PROSITE signature and showed the highest similarity to the Erm(43) determinant of S. lentus (Fig. 2) (6). Based on an amino acid (aa) identity level of <80% with the next closest Erm protein and an MLS_B phenotype, this represents a new erm methylase gene in S. xylosus, according to the nomenclature center for MLS genes (http://faculty.washington.edu/marilynr/MLSnomenclatureCenter.pdf) (7). Upstream of the erm(48) start codon, a regulatory region with putative −10 and −35 promoter sequences, as well as two pairs of inverted repeats (IRs), was found (see Fig. S1 in the supplemental material). Such IRs are hypothesized to play a key role in the translational attenuation and inducibility of MLS_B methylases (8). The regulatory region spanning from the −35 promoter sequence to the IR comprising the start codon of erm(48) shared 74% and the highest nt identity to the regulatory region of erm(44) in S. xylosus JW4341 (9) and 64% nt identity to the regulatory region of erm(A) (10). This regulatory region preceding the erm(48) gene contained two small ORFs encoding leader peptides 1 (Lp1) of 16 aa and Lp2 of 22 aa, similar to the regulatory region of erm(A) in Tn554 (10). Lp2 contains the amino acid pattern IFII, which is crucial for the induction mechanism of Erm methylases (11) (Fig. S1).

FIG 2.

Relatedness of the novel erythromycin resistance methylase Erm(48) detected in S. xylosus JW2311 to other Erm methylases in Staphylococcus species. Amino acid (aa) and nucleotide (nt) identity percentages were obtained by sequence alignment using Clustal Omega (http://clustal.org/omega/). The protein sequences used for comparison are indicated by their GenBank accession numbers and were chosen from the species for which the protein was initially described. Clustering of Erm amino acid sequences was performed by BioNumerics 7.5 (Applied Maths). The comparison settings were standard algorithm for pairwise alignment, open-gap penalty 100%, unit-gap penalty 0%, and the unweighted-pair group method using average linkages.

To analyze expression, the erm(48) gene of JW2311 was amplified with its leader region by PCR (Pfu DNA polymerase; Promega Corporation, Madison, WI) using primers erm(48)-Sal1-F (5′-cacatgtcgacCTGAAGTTAGTCAACCAATACC) and erm(48)-SpeI-R (5′-cacaggtctagaCACCTATTTCAATACTAGG) (annealing temperatures, 56°C for cycles 1 to 3 and 62°C for cycles 4 to 24; elongation time, 3 min), which contained overhangs (lowercase) with restriction site sequences (underlined), and cloned into the shuttle vector pBUS1-HC (12). Additionally, erm(48) without its leader region was amplified by PCR using primers erm(48)-Nde1-F (5′-cacacacggcatATGAATAACAAAAACCCAAAAGATTC) and erm(48)-SpeI-R at the same conditions and cloned into the shuttle vector pBUS1-P_cap-HC under the control of the strong constitutive promoter of S. aureus type 1 capsule gene 1A (P_cap) (Table 1). The resulting plasmids pJW37 and pJW23 were transformed by heat shock into Escherichia coli DH5α and were subsequently electroporated into S. aureus RN4220 (Table 1) (5). Transformation was obtained on BHI agar plates containing 10 μg/ml tetracycline and plasmids were confirmed by restriction digest and sequencing.

MIC values of erythromycin, clindamycin (Sigma-Aldrich, St. Louis, MO), and pristinamycin IA (Molcan Corporation, Richmond Hill, ON) of S. xylosus and S. aureus strains were determined by broth microdilution using Mueller-Hinton broth following CLSI guidelines (2). Prior to MIC measurement, erm(48)-containing S. xylosus strains were streaked on Mueller-Hinton agar plates containing 0.5 μg/ml erythromycin to induce the gene. Inducible resistance was measured in the presence of 1 μg/ml erythromycin in broth and by D-test (Table 1) (2).

When erm(48) was expressed in S. aureus RN4220 from its own promoter in plasmid pBJW37, the MIC of erythromycin increased to 64 μg/ml, whereas the MIC of clindamycin increased only slightly after induction with erythromycin to 0.25 μg/ml and the MIC of pristinamycin Ia remained unchanged even after induction (Table 1). On the other hand, a clear MLS_B phenotype was observed when erm(48) was expressed constitutively in pJW23, with MICs for erythromycin and clindamycin of >256 μg/ml and an MIC for pristinamycin Ia of 16 μg/ml (Table 1).

Overall, the induction mechanisms of erm(48)-carrying S. xylosus and S. aureus strains appeared delayed and were clearly detectable only in disk diffusion. Adaptation to high-level clindamycin resistance seems likely in erm(48)-carrying strains and would negatively affect the outcome of clindamycin treatment in S. xylosus infections.

Distribution of erm(48).

An additional 250 coagulase-negative staphylococcal strains isolated from bovine milk were screened by PCR (annealing temperature, 54°C; elongation time, 40 s) (FIREpol DNA polymerase; Solis BioDyne, Tartu, Estonia) using primers erm(48)-F (5′- CAAAATACTAATATAGAATCAAATGAC) and erm(48)-R (5′-TATCTTTTCATCTTTCTCTGAAAC), which amplified a 501-bp product of erm(48) in 6 S. xylosus strains. The closely related genes erm(43) and erm(44) were not amplified using these primers, and identification of erm(48) was confirmed by sequencing. The highest nt identity of the PCR product of erm(48) was 77.1% with that of erm(43). The six additional S. xylosus strains were found in a geographically distant farm from where JW2311 was originally isolated. All strains were resistant to erythromycin and streptogramin B and showed positive D-test results (Table 1).

Characterization of plasmid pJW2311.

The 49,273-bp plasmid pJW2311 contained 49 ORFs detected by the Prodigal program, Prokka software, and the RAST service, with priority given to predictions generated by Prodigal (Fig. 1) (13–15). Hypothetical function of the predicted ORFs was evaluated by alignment to protein sequences and conserved domains in the BLASTP program (http://blast.ncbi.nlm.nih.gov/Blast.cgi) and the Swiss Institute of Bioinformatics PROSITE database (http://prosite.expasy.org/). Next to macrolide resistance genes mph(C), msr(A), and erm(48), pJW2311 mainly carried ORFs encoding putative transport proteins and metabolic enzymes (Fig. 1; see also Table S1 in the supplemental material). Whether any of these detected putative ORFs on pJW2311 are involved in bacterial antimicrobial or heavy metal resistance, pathogenesis, or detoxification of physiological processes of S. xylosus has to be assessed experimentally.

The pJW2311 replication initiation protein gene (rep) contained the conserved regions of staphylococcal RepA proteins and the internally located RepA binding sites constituting the origin of replication oriV (see Fig. S2 in the supplemental material) (16). Replication of pJW2311 is therefore expected to occur via the theta-mode, using a mechanism previously described for large staphylococcal multiresistance plasmids, such as pSK41 and pI0789::Tn552 of S. aureus and pSX267 of S. xylosus (17). Compared to the rep family classification system for plasmids of Gram-positive bacteria, the pJW2311 rep gene showed the highest nt similarity (70%) to the rep₂₀ family (18).

The overall G+C content of plasmid pJW2311 is 30.7 mol%, which is similar to that of S. xylosus and other staphylococci (Fig. 1) (19). The region spanning from position 40,000 to 49,273 in pJW2311 and the surrounding erm(48) exhibited a lower G+C content, with an average of 29.7 mol%, potentially due to the acquisition of this region from a source different from the rest of the plasmid. Plasmid resolvase (ORF40) and bin recombinase (ORF41) found at the 5′ end of the low-GC region are involved in plasmid inheritance and segregational stability and are suggested hotspots for transposon insertion (20). Plasmid pJW2311 did not contain a conjugation transfer (tra) complex, which is common in large staphylococcal plasmids (21).

The novel gene erm(48) confers high resistance to macrolides and streptogramin B and inducible resistance to clindamycin detectable in disk diffusion. Along with the erm(44) and erm(45) genes, which were also recently identified in staphylococci from bovine mastitis milk (9, 22, 23), the discovery of erm(48) highlights the role of dairy cows as a source of new MLS_B resistance genes.

Accession number(s).

The nucleotide sequence of the erm(48)-carrying plasmid pJW2311 of S. xylosus JW2311 was deposited in the ENA database and assigned accession number LT223129.