Skip to main content
Antimicrobial Agents and Chemotherapy logoLink to Antimicrobial Agents and Chemotherapy
. 2017 Jun 27;61(7):e02587-16. doi: 10.1128/AAC.02587-16

Role of psl Genes in Antibiotic Tolerance of Adherent Pseudomonas aeruginosa

Keiji Murakami a,✉, Tsuneko Ono b, Darija Viducic a, Yoko Somiya b, Reiko Kariyama c,d, Kenji Hori e, Takashi Amoh a, Katsuhiko Hirota a, Hiromi Kumon c, Matthew R Parsek f, Yoichiro Miyake a
PMCID: PMC5487641  PMID: 28438927

ABSTRACT

Bacteria attached to a surface are generally more tolerant to antibiotics than their planktonic counterparts, even without the formation of a biofilm. The mechanism of antibiotic tolerance in biofilm communities is multifactorial, and the genetic background underlying this antibiotic tolerance has not yet been fully elucidated. Using transposon mutagenesis, we isolated a mutant with reduced tolerance to biapenem (relative to that of the wild type) from adherent cells. Sequencing analysis revealed a mutation in the pslL gene, which is part of the polysaccharide biosynthesis operon. The Pseudomonas aeruginosa PAO1ΔpslBCD mutant demonstrated a 100-fold-lower survival rate during the exposure of planktonic and biofilm cells to biapenem; a similar phenotype was observed in a mouse infection model and in clinical strains. Transcriptional analysis of adherent cells revealed increased expression of both pslA and pelA, which are directly regulated by bis-(3′,5′)-cyclic dimeric GMP (c-di-GMP). Inactivation of wspF resulted in significantly increased tolerance to biapenem due to increased production of c-di-GMP. The loss of pslBCD in the ΔwspF mutant background abolished the biapenem-tolerant phenotype of the ΔwspF mutant, underscoring the importance of psl in biapenem tolerance. Overexpression of PA2133, which can catalyze the degradation of c-di-GMP, led to a significant reduction in biapenem tolerance in adherent cells, indicating that c-di-GMP is essential in mediating the tolerance effect. The effect of pslBCD on antibiotic tolerance was evident, with 50- and 200-fold-lower survival in the presence of ofloxacin and tobramycin, respectively. We speculate that the psl genes, which are activated by surface adherence through elevated intracellular c-di-GMP levels, confer tolerance to antimicrobials.

KEYWORDS: Pseudomonas aeruginosa, adherent cells, antibiotic tolerance, c-di-GMP, psl

INTRODUCTION

Eradication of bacterial biofilms with antibiotics is particularly difficult, and antibiotic tolerance is thought to be one of the reasons. The concept of antibiotic tolerance was first introduced in 1944 through the work of Bigger, who focused on the mechanism of penicillin tolerance in Staphylococcus (1). Antibiotic tolerance is the ability of bacteria to survive, but not to grow, in the presence of an antibiotic at concentrations above the MIC. Antibiotic tolerance is a physiological condition that does not involve a mutation but rather is characterized by the presence of a subpopulation of cells that can persist in the presence of high concentrations of antibiotics. These cells are called persister cells. They are dormant or slowly dividing cells that are less vulnerable to antibiotics than the majority of the cell population. Additional mechanisms that contribute to antibiotic tolerance include restricted antimicrobial diffusion, differential physiological activity, and the induction of specific antibiotic tolerance mechanisms (2).

In bacteria, significant physiological changes occur depending on environmental conditions, including heat shock, nutrient starvation, the presence of hydrogen peroxide, high osmolarity, and the growth phase. Our previous work demonstrated that the alternative sigma factors RpoS and RpoN, the LasR-LasI quorum-sensing (QS) system (3–6), and the bacterial second messenger guanosine tetraphosphate (ppGpp) all contribute to antibiotic tolerance (7). In addition, we have reported previously that adherent bacteria on solid surfaces are already tolerant to antibiotics before forming biofilms (8). Aaron et al. have shown for clinical isolates from cystic fibrosis patients that bacteria grown as adherent cells or biofilms were less susceptible to several antibiotics than bacteria grown planktonically (9).

It is therefore plausible to assume that physiological changes that have occurred in adherent cells as a response to stress might lead to tolerance when the cells are exposed to antibiotics. However, little is known about the mechanisms of antibiotic tolerance in adherent cells.

The aim of this study was to investigate the mechanisms of antibiotic tolerance in adherent cells of Pseudomonas aeruginosa, an important opportunistic pathogen that causes chronic infections. In this study, we screened transposon mutants of P. aeruginosa and identified the psl genes, which are activated by surface adherence through elevated intracellular bis-(3′,5′)-cyclic dimeric GMP (c-di-GMP) levels and are involved in the antibiotic tolerance of adherent P. aeruginosa.

RESULTS

Susceptibility testing.

Initially, we compared the susceptibilities of several growth modes of the wild-type strain PAO1: planktonic, adherent, and biofilm cells (Table 1). Bacteria attached to the bottom of a 96-well plate were used for testing the susceptibility of adherent cells, and bacteria grown on 96-peg lids for 24 h were used for testing the susceptibility of biofilm cells. The MIC for adherent cells (MICAD) of the parental strain was similar to the MIC for planktonic cells. For planktonic cells, the minimal bactericidal concentration (MBC) was only 2 times higher than the MIC. However, the MBC for adherent cells (MBCAD) was 64 times higher than the MICAD, and the MBC for biofilm cells (MBCBF) was 128 times higher than the MICBF. The concentration of antibiotics required to kill adherent or biofilm cells was far higher than that required to kill planktonic cells, and adherent cells were almost as tolerant to biapenem (BIPM) as biofilm cells.

TABLE 1.

Susceptibility of PAO1 to BIPM

Mode of growth MIC MBC MBC/MIC ratio
Planktonic 0.25 0.5 2
Adherent 0.5 32 64
Biofilm 1 128 128

In order to investigate the mechanism of antibiotic tolerance in adherent cells, we performed transposon mutagenesis. Among approximately 3,000 transposon insertion mutants, we selected a mutant, KM50, with a low tolerance to BIPM. While the MIC and MBC values for KM50 were equal to those for the parental strain, the MBCAD for KM50 was only 4 times higher than the MICAD (Table 2). Inverse-PCR amplification and sequencing revealed that the Tn1737KH transposon had been inserted into the 1,068-bp open reading frame of KM50 referred to as the pslL gene (PA2242) in the Pseudomonas Genome Database (http://www.pseudomonas.com/).

TABLE 2.

Susceptibilities of various strains to BIPM

Strain Planktonic cells
Adherent cells
MIC MBC MBC/MIC ratio MICAD MBCAD MBCAD/MICAD ratio
SM7 (parent) 0.5 1 2 1 128 128
KM50 (pslL::Tn1737KH) 0.5 1 2 0.5 2 4
PAO1 (wild type) 0.25 0.5 2 0.5 64 128
KMB12 (pslL::Gmr) 0.5 1 2 0.25 0.5 2
KMB12C2 (pslL::Gmr/pslL+ plasmid) 1 2 2 1 32 32
PAO1ΔpslBCD 1 2 2 0.5 2 4
PAO1ΔpelA 0.5 1 2 0.5 16 32
YS1 (clinical isolate) 0.25 0.25 1 0.25 32 128
YS1ΔpslBCD 0.25 0.25 1 0.25 2 8

Next, we constructed a pslL knockout mutant by use of homologous recombination and complemented the mutant with a plasmid expressing pslL. In planktonic cells, the MBC/MIC ratio for the pslL::Gmr mutant and the complemented strain was 2. In adherent cells, however, the MBCAD/MICAD ratio for the wild type was 128, but for the pslL::Gmr mutant, this ratio was as low as that for KM50. Since both Psl and Pel have been implicated in biofilm development (10), we constructed two mutants, PAO1ΔpslBCD and PAO1ΔpelA, and determined the BIPM MICAD and MBCAD. For PAO1ΔpslBCD, the MBCAD/MICAD ratio was almost equal to that observed for KM50 and pslL::Gmr; however, the MBCAD/MICAD ratio for PAO1ΔpelA remained high (Table 2). In biofilm cells, though, the MBCBF/MICBF ratio for the wild type was 128; for pslL::Gmr and PAO1ΔpslBCD, it was only 16 (Table 3). These results suggest that psl plays an important role in antibiotic tolerance in adherent and biofilm cells.

TABLE 3.

Susceptibility of biofilm cells to BIPM

Strain MICBF MBCBF MBCBF/MICBF ratio
PAO1 (wild type) 1 128 128
KMB12 (pslL::Gmr) 1 16 16
KMB12C2 (pslL::Gmr/pslL+ plasmid) 2 512 256
PAO1ΔpslBCD 2 32 16

Biapenem killing assays for planktonic cells.

The time-dependent killing curves for PAO1, PAO1ΔpslBCD, and PAO1ΔpelA in the presence of BIPM are presented in Fig. 1A. The CFU count of PAO1ΔpslBCD at 24 h after the addition of biapenem (32 μg/ml) was more than 100 times lower than that of the wild-type strain. Minimal differences in the survival rate were observed between the wild type and the PAO1ΔpelA mutant.

FIG 1.

FIG 1

(A) Time-dependent killing assay for PAO1, PAO1ΔpelA, and PAO1ΔpslBCD in the presence of 32 μg/ml biapenem. The CFU count was converted to a percentage of the survival rate at time zero, which was assumed to be 100%. (B) Time-dependent killing assay for YS1 and YS1ΔpslBCD in the presence of 32 μg/ml biapenem. The CFU count was converted to a percentage of the survival rate at time zero, which was assumed to be 100%. (C) Biofilm formation and killing assay for biofilm-formed cells of PAO1, PAO1ΔpelA, and PAO1ΔpslBCD. Biofilms were grown in the MBEC physiology and genetics assay kit for 24 h at 37°C with aeration. Biofilms were exposed to 32 μg/ml of BIPM for 6 h. Cells that were not exposed to BIPM served as a negative control. Biofilm cells were disrupted by sonication, and bacterial viability was determined by serial dilution with saline. Asterisks indicate results significantly different from those for PAO1 (*, P < 0.05; **, P < 0.01). Data are means ± standard deviations (n = 3).

Antibiotic tolerance in a clinical isolate.

We generated a psl deletion mutant of the clinical isolate YS1 and determined the MICAD and MBCAD. For YS1, the MBCAD/MICAD ratio was 128; however, for the YSΔpslBCD mutant, the ratio was only 8 (Table 2). In planktonic cells, the survival of the YS1ΔpslBCD mutant at 24 h after the addition of biapenem (32 μg/ml) was more than 100 times lower than that of strain YS1 (Fig. 1B).

Biofilm formation and killing assay for biofilm cells.

To investigate the impact of different PAO1 mutations on biofilm formation, we employed a Medical & Biological Engineering & Computing (MBEC) physiology and genetics assay. PAO1 biofilms reached concentrations of 8.7 × 106 CFU/peg after 24 h, and the PAO1ΔpslBCD and PAO1ΔpelA mutants reached 2.7 × 106 and 3.0 × 106 CFU/peg, respectively. The numbers of PAO1ΔpslBCD and PAO1ΔpelA cells were almost one-third lower than the number of PAO1 cells (Fig. 1C). While the survival rates of PAO1 and the PAO1ΔpelA mutant after BIPM exposure were 0.57 and 0.18%, respectively, the survival rate of the PAO1ΔpslBCD mutant was only 0.018% (Fig. 1C). These results suggest that the psl and pel genes are related to biofilm formation and that psl is primarily involved in antibiotic tolerance.

Effects of c-di-GMP degradation on antibiotic tolerance.

Our data suggest that psl genes play an important role in antibiotic tolerance. In accordance with previously published observations (11, 12), which demonstrated that Psl synthesis is regulated by the intracellular concentration of c-di-GMP, we hypothesized that surface attachment promotes the intracellular concentration of c-di-GMP, resulting in Psl induction. To test this hypothesis, we introduced plasmid pJN105 expressing PA2133 (pJN2133) (11, 13), which encodes the c-di-GMP-degrading phosphodiesterase with an EAL domain, into PAO1 (PAO1/pJN2133). The MBCAD/MICAD ratio was only 4, and the survival rate was about 100 times lower than that of PAO1/pJN105 (Table 4).

TABLE 4.

Susceptibility of a c-di-GMP-degrading mutant to BIPM

Strain Planktonic cells
Adherent cells
MIC MBC MBC/MIC ratio MICAD MBCAD MBCAD/MICAD ratio
PAO1/pJN105 0.5 1 2 0.5 32 128
PAO1/pJN2133 0.5 1 2 0.5 2 4

These results suggest that strains known to have elevated c-di-GMP levels have a higher tolerance to antibiotics under certain conditions.

Transcription of pelA and pslA genes in adherent cells.

Quantitative real-time PCR (qRT-PCR) demonstrated that adherent cells have 5.1- and 6.1-times-higher transcription of pslA and pelA genes, respectively, than planktonic cells (Fig. 2A). Since FleQ has a dual function as both a repressor and an activator of Pel expression in response to c-di-GMP (14), we propose that surface adherence increases the levels of pslA and pelA through elevated intracellular c-di-GMP levels.

FIG 2.

FIG 2

(A) Expression of pslA and pelA genes in adherent cells. Asterisks indicate expression levels significantly different (*, P < 0.05; **, P < 0.01) from those for the control (planktonic cells). (B) Time-dependent killing assay for PAO1 (squares), PAO1ΔwspF (triangles), PAO1ΔwspFΔpelA (diamonds), and PAO1ΔwspFΔpslBCD (circles) in the presence of 32 μg/ml biapenem. The CFU count was converted to a percentage of the survival rate at time zero, which was assumed to be 100%. Data are means ± standard deviations (n = 3).

Effects of accumulation of c-di-GMP on antibiotic tolerance.

Next, we used the PAO1ΔwspF mutant, which has constitutive activation of WspR, resulting in elevated c-di-GMP levels (11). Interestingly, the survival rate of this PAO1ΔwspF mutant in the presence of BIPM (32 μg/ml) was about 100 times higher than that of PAO1; however, the survival rate of the PAO1ΔwspFΔpslBCD mutant was about 100 times lower than that of PAO1 (Fig. 2B). These results confirm that Psl confers tolerance to BIPM through its induction by elevated c-di-GMP levels.

Detection of the pslA gene in clinical isolates.

A total of 150 clinical strains of P. aeruginosa were collected from Tokushima University Hospital. PCR screening demonstrated the presence of a 293-bp fragment of the pslA gene in 147 clinical isolates (98%) and the absence of psl in 3 strains (2%).

Antibiotic tolerance of adherent cells of clinical isolates.

From the panel of 150 clinical isolates, we selected 40—of which 32 were BIPM-sensitive strains (MIC, ≤2), including 3 psl-deficient strains, and 8 were BIPM-resistant strains (MIC, ≥8)— and measured the BIPM MICAD and MBCAD. For 21 BIPM-sensitive strains (66%), the MBCAD/MICAD ratio was >16; however, for the BIPM-resistant strains, the MBCAD/MICAD ratios were between 2 and 8 (Fig. 3A). The MBCAD/MICAD ratio for 2 of the 3 psl-deficient strains was only 2, similar to the ratio observed for the PAO1ΔpslBCD mutant, but the ratio for the third strain was 64 (Table 5). These results demonstrate that antibiotic tolerance in adherent cells enables them to survive in the presence of high concentrations of antibiotics. For the antibiotic-resistant strains, the MBCAD was almost the same as the MICAD, since the MICAD was already extremely high.

FIG 3.

FIG 3

(A) Forty clinical isolates were tested for the BIPM MBCAD/MICAD ratio. (B) Time-dependent killing assay for psl gene-deficient clinical isolates in the presence of 32 μg/ml biapenem. The CFU count was converted to a percentage of the survival rate at time zero, which was assumed to be 100%. Squares, PAO1; circles, TH20; triangles, TH33; diamonds, TUH13. Data are means ± standard deviations (n = 3).

TABLE 5.

Susceptibilities of psl-deficient clinical isolates to BIPM

Strain MICAD MBCAD MBCAD/MICAD ratio
TH20 0.5 32 64
TH33 0.125 0.25 2
TUH13 0.063 0.125 2

Killing assay for clinical isolates.

To confirm the phenotypes observed during the MBCAD/MICAD assays, we performed a killing assay for three psl-deficient clinical isolates: TH20, TH33, and TUH13. The survival rate of TH20 cells at 24 h after the addition of BIPM at a concentration corresponding to 128× MIC was about 10 times lower than that of PAO1 cells. The survival rates of TH33 and TUH13 cells at 24 h after the addition of biapenem at the same concentration were about 100 times lower than that of PAO1 (Fig. 3B).

Killing assay for planktonic cells exposed to ofloxacin or tobramycin.

To investigate whether psl plays a key role in mediating tolerance to structurally diverse antibiotics, we performed a killing assay for wild-type PAO1 and the PAO1ΔpslBCD mutant in the presence of ofloxacin (OFLX) or tobramycin (TOB). The number of surviving PAO1ΔpslBCD cells at 24 h after the addition of ofloxacin (8 μg/ml) was >50 times lower than the number of wild-type cells (Fig. 4A), and the number of surviving PAO1ΔpslBCD cells at 24 h after the addition of tobramycin (32 μg/ml) was 200 times lower than the number of wild-type cells (Fig. 4B). These results support the role of psl genes in tolerance to a wide range of antibiotics.

FIG 4.

FIG 4

Time-dependent killing assay for PAO1 and the PAO1Δpsl mutant in the presence of 8 μg/ml ofloxacin (A), 32 μg/ml tobramycin (B), or 8 μg/ml hydrogen peroxide (C). The CFU count was converted to a percentage of the survival rate at time zero, which was assumed to be 100%. Squares, PAO1; circles, PAO1ΔpslBCD. Data are means ± standard deviations (n = 3).

Killing assay in the presence of H2O2.

We sought to determine whether psl genes play a protective role in the presence of H2O2. The number of surviving PAO1ΔpslBCD cells at 6 h after the addition of 3 mM H2O2 was 8 times lower than the number of cells of the wild-type strain PAO1 (Fig. 4C).

Efficacy of antibiotic therapy as determined by in vivo bioluminescence imaging.

To assess the effects of antibiotics on P. aeruginosa strains in an in vivo model, we employed a construct carrying Plac::lux integrated onto the chromosome of PAO1 or PAO1ΔpslBCD and monitored survival in the presence of biapenem. In each control group, without BIPM treatment, there was no difference in bioluminescent intensity between PAO1 Plac::lux and PAO1ΔpslBCD Plac::lux. In the BIPM-treated groups, at 10 h after inoculum injection, the bioluminescent intensity of PAO1ΔpslBCD Plac::lux decreased relative to that of PAO1 Plac::lux (Fig. 5).

FIG 5.

FIG 5

Real-time monitoring of the effect of BIPM on PAO1 Plac::lux or PAO1ΔpslBCD Plac::lux in infected mice. Two hours after inoculum injection, mice were either left untreated or were treated subcutaneously with biapenem (1.56 mg/kg of body weight) for 8 h (4 times). At 0, 2, 4, 6, 8, and 10 h after inoculum injection, bioluminescence images were acquired using an IVIS Lumina system. The photons emitted by the mice per second were quantified.

DISCUSSION

In this report, we present evidence that Psl plays an important role in the antibiotic tolerance of adherent, planktonic, and biofilm cells, as well as in an in vivo model, through the intracellular accumulation of c-di-GMP, not only in PAO1 but also in clinical isolates (Fig. 6).

FIG 6.

FIG 6

Proposed model for the mechanism of antibiotic tolerance in adherent cells. The psl gene, activated by surface adherence through elevated intracellular c-di-GMP levels, leads to tolerance to antimicrobials in P. aeruginosa PAO1.

The psl operon is involved in exopolysaccharide biosynthesis and biofilm formation (15). The present study provides evidence that the psl gene is conserved in major clinical isolates. Utilizing an inducible psl construct, Ma et al. demonstrated that, in addition to cell-surface and cell-cell interactions, Psl is also required for the maintenance of the biofilm postattachment structure (16). As it moves on a surface, P. aeruginosa deposits a trail of Psl, which influences the surface motility of cells that subsequently encounter the trail and thus generates positive feedback (17). Psl also acts as a signal to stimulate two diguanylate cyclases, SiaD and SadC, resulting in increased c-di-GMP levels (18). Billings et al. (19) revealed that Psl promotes the initial stages of biofilm tolerance to antibiotics, especially colistin. As evidenced by the fact that the MIC of colistin for the PAO1ΔpslAB mutant decreased by 4-fold, even in the planktonic state, Psl can bind to colistin (a cationic antibiotic) and act as a barrier to absorption. In our study, however, we demonstrate that Psl can assume additional roles in antibiotic tolerance without affecting the MIC for planktonic cells (Table 2).

The regulation of psl genes is very complex. Psl is transcriptionally regulated by RpoS and RpoD and is translationally regulated by the posttranscriptional regulator RsmA (12, 20). Expression of the psl genes is repressed by the global regulator RetS, which is a hybrid sensor kinase–response regulator protein. Another regulatory system controlling psl expression is the GacS-GacA-rsmZ system (21). Petrova and Sauer (22) demonstrated that the two–component hybrid SagS (PA2824) controls Psl production through the small RNA rsmYZ by modulating rsmYZ activity in planktonically growing cells. Hickman et al. showed that psl transcripts were 2- to 3-fold more abundant in the wspF mutant, with high intracellular c-di-GMP levels, than in the wild type (11). In this way, Psl expression is regulated by c-di-GMP at the transcriptional and posttranscriptional levels, either directly or indirectly.

Recently, a cell-surface signaling (CSS) system, which transduces an extracellular stimulus into a coordinated transcriptional response, has received a great deal of attention as the first step in biofilm formation (23, 24). Two-component regulatory systems, which are usually composed of a sensor kinase and a response regulator, enable bacteria to adapt rapidly to environmental changes. In Escherichia coli, CpxA-CpxR, a two-component signal transduction system, is a known stress response system (25, 26). The Cpx pathway “responds specifically to stress caused by disturbances in the cell envelope and activates genes encoding periplasmic protein folding and degrading factors” (25). Otto and Silhavy presented evidence that “the expression of Cpx-regulated genes is induced during initial adhesion of E. coli to abiotic surfaces” (25). In Vibrio parahaemolyticus, ScrC is a cytoplasmic membrane protein that contains both GGDEF and EAL conserved protein domains and plays a dominant role during surface translocation and in biofilms (27). P. aeruginosa has at least two types of surface-sensing systems. One is a Wsp chemosensory system, which contains WspR, a hybrid response regulator-diguanylate cyclase that is important in regulating biofilm formation through the modulation of c-di-GMP (28). P. aeruginosa PAO1 encodes 17 GGDEF, 14 GGDEF/EAL, and 6 EAL domain proteins. WspA is the membrane-bound receptor that anchors associated Wsp proteins and is related to surface sensing (29). The other surface-sensing system is the PilY-SadC transduction system. PilY is a type IV pilus-associated protein and is localized in the outer membrane. PilY on the cell surface can signal SadC, an inner-membrane-localized diguanylate cyclase, to boost c-di-GMP levels (24, 30–32). However, in the wspR and sadC mutants that we have constructed, no significant change in the MBCAD was observed (data not shown). The CSS system may have multiple pathways to elevate intracellular c-di-GMP levels.

With regard to the mechanism of antibiotic tolerance, in E. coli, the hipA7 allele confers 1,000-fold-higher persistence after ampicillin treatment (33). HipA, a toxin of the hipBA operon, is part of a toxin-antitoxin (TA) module. RelE and MazF, which are toxins, are reported to be closely related to antibiotic tolerance. Balaban et al. have demonstrated that the duration of the nongrowth of persister cells is a function of the activity of the toxin of a TA system (34). Although P. aeruginosa has three putative TA modules, as determined by bioinformatic analysis (35), their function is not well understood. Nguyen et al. reported that the antibiotic tolerance of nutrient-limited and biofilm cells is mediated by active responses to starvation rather than by the passive effects of growth arrest (36). Wakamoto et al. showed that persistence is not correlated with the single-cell growth rate in Mycobacterium smegmatis exposed to the drug isoniazid (INH), which inhibits cell wall biogenesis (37). For E. coli, Orman and Brynildsen found that bacteria that are growing rapidly prior to antibiotic exposure can give rise to persisters, and a lack of significant growth or metabolic activity does not guarantee persistence, since the majority of even dormant subpopulations were not persister cells, as determined by fluorescence-activated cell sorting (FACS) (38). The effect of the psl gene on dormancy remains unclear.

In the present study, psl plays an important role in multidrug tolerance (BIPM, OFLX, and TOB) (Fig. 4). There could be a common mechanism leading to antibiotic tolerance such as that observed in our study. The primary drug-target interactions stimulate the oxidation of NADH through the electron transport chain, which is dependent on the tricarboxylic acid (TCA) cycle (39). Shan et al. found that the TCA cycle and the electron transport chain contributed to gentamicin tolerance in E. coli (40). We found that the PAO1ΔpslBC mutant had decreased tolerance to hydrogen peroxide (Fig. 4), and oxidative stress may be related to multidrug antibiotic tolerance through the Psl polysaccharide.

Taking the findings together, our work demonstrates that Psl has a critical function in antibiotic tolerance and is therefore a prospective target for antibacterial treatment.

MATERIALS AND METHODS

Ethics.

Mouse infection studies were approved by the Animal Care and Use Committee, Okayama University (approval number OKU-2013055). All procedures were performed according to the Policy on the Care and Use of the Laboratory Animals, Okayama University.

Bacterial strains and growth conditions.

The bacterial strains and plasmids used in this study are shown in Table S1 in the supplemental material. Luria-Bertani (LB) medium was used for culturing, and the following supplements were added as required: ampicillin, 50 μg ml−1; gentamicin, 15 μg ml−1 (for E. coli) or 200 μg ml−1 (for P. aeruginosa); streptomycin, 200 μg ml−1 (for P. aeruginosa); sucrose, 5% (for P. aeruginosa).

Reagents.

Biapenem was purchased from Meiji Seika Pharma Co., Ltd. (Tokyo, Japan). Tobramycin and ofloxacin were purchased from Sigma-Aldrich (St. Louis, MO, USA).

Transposon mutagenesis.

The transposon insertion mutants were constructed as follows. E. coli strain CT726 harboring Tn1737KH in plasmid pMT6121 (41), a plasmid with a temperature-sensitive origin of replication, was mobilized to P. aeruginosa SM7 cells (42). The kanamycin-resistant and temperature-sensitive transconjugant of P. aeruginosa SM7 was isolated. The Tn1737KH insertion site was determined by inverse-PCR amplification using primers galK-s (CGCAGAACAGGCAGCAGAGCGTTT) and galK-a (GCAGCAGAGGCGGATAAAAGTGCG) and the dye terminator cycle sequencing method (Thermo Fisher Scientific, MA, USA).

Strain construction.

In order to produce a pslL mutant, we amplified the pslL gene by PCR using primers pslL-1s (5′-CGCATCGACGGTATCTGGCTGCAA-3′) and pslL-1a (5′-TAGGGAAAAGGGAGACGGGAGG-3′) and cloned it into the pGEM-T vector (Promega, Madison, WI). The Ω fragment from pACΩGm (43) containing the gentamicin resistance cassette was inserted into the KpnI site of pslL, resulting in plasmid pKMB2 (pGEM-pslL::ΩGm). Plasmid pKMB3 was constructed by inserting a NotI fragment from pMOB3 (44) containing the MOB cassette into NotI-digested pKMB2, and this construct was further transformed into mobilizer strain S17-1 (45). After conjugal transfer of pKMB3 into P. aeruginosa PAO1, we selected the gentamicin-resistant strain KMB12, which contains the pslL::Gmr insertion in place of the pslL gene. For complementation experiments, a 1.4-kb PstI-HindIII fragment encompassing the pslL gene was amplified and was digested with PstI and HindIII. The fragment generated was subsequently ligated into a PstI-HindIII-digested broad-host-range vector, pMMB67HE (46), to yield pMMB4-1.

pel, pslBCD, and wspF deletion mutants were constructed as described previously (11, 47, 48).

For in vivo bioluminescence imaging, a miniCTX-lux plasmid was constructed by ligating SacI/BamHI-digested mini-CTX2 (49) with a SacI/BamHI fragment digested from pXen13 (Xenogen, CA, USA), encompassing the lux operon. The lac promoter region was then amplified by PCR using the pUCP18 plasmid (50) as the template. The amplified lac promoter region and miniCTX-lux were digested with XhoI/BamHI and were ligated, resulting in miniCTX-Plac::lux. PAO1 Plac::lux and PAO1ΔpslBCD Plac::lux were created by the integration of miniCTX-Plac::lux at the attB site of PAO1 and PAO1ΔpslBCD, followed by FLP recombinase-mediated excision of the plasmid backbone (51). Colonies were screened for tetracycline and carbenicillin sensitivity and for loss of sucrose sensitivity.

Susceptibility testing for planktonic bacteria.

The MIC and the minimal bactericidal concentration (MBC) for planktonic cells were determined by a standard broth microdilution method (52).

Susceptibility testing for adherent bacteria.

The log-phase culture was diluted with saline to give a concentration of 2 × 106 CFU/ml. A 96-well tissue culture plate (Corning Incorporated, NY, USA) was used, and each well received 50 μl of the bacterial suspension. The plate was centrifuged at 450 × g for 15 min at 25°C. After incubation at 37°C for 1 h, the saline was removed, and 100 μl of the serially diluted antibiotic solution was transferred to each well of the round-bottom plate. Bacterial growth was assessed after 24 h of incubation at 37°C, and the MIC for adherent bacteria (MICAD) was defined as the lowest concentration of antibiotic at which there was no bacterial growth. The antibiotic solution was then removed, and 200 μl of fresh LB medium without antibiotics was added to each well, followed by a further 24 h of incubation at 37°C. The MBC for adherent bacteria (MBCAD) was defined as the lowest concentration of antibiotic at which there was no bacterial growth. Only bacterial growth covering the entire bottom of the well was judged to be positive (8).

Time-dependent killing assay.

Liquid cultures were incubated at 37°C for 16 h with aeration to reach the stationary phase. Cells were harvested by centrifugation and were resuspended in fresh LB broth at the original concentration of ∼109 CFU/ml. Cells were incubated with a given antibiotic for various periods (0 to 24 h). Viable cell numbers were determined before and after drug addition by subculturing the cells on LB agar plates for 24 h.

Susceptibility testing for biofilm cells.

For peg biofilm susceptibility testing, biofilms were grown using the MBEC physiology and genetics assay kit (Innovotech Inc., Edmonton, Canada) at 37°C for 24 h with aeration. This system consists of a polystyrene lid with 96 downward-protruding pegs that fit into standard 96-well microtiter plates.

Bacterial cells (150 μl) were transferred to the wells of a 96-well growth plate, and bacterial biofilms were formed by immersing the pegs in the growth plate. Following incubation at 37°C for 24 h, the biofilms were washed in 0.9% NaCl and were exposed to serially diluted antibiotic solutions at 37°C for 24 h. The MIC for biofilm cells (MICBF) was defined as the lowest concentration of antibiotic at which there was no bacterial growth. Biofilms were then washed in 0.9% NaCl, transferred to a new plate containing 200 μl of fresh LB medium without antibiotics, and disrupted by sonication, followed by a further 24 h of incubation at 37°C. The MBC for biofilm cells (MBCBF) was defined as the lowest concentration of antibiotic at which there was no bacterial growth (53).

Biofilm formation and killing assay for biofilm cells.

For the determination of biofilm formation and the killing assay, the biofilms were allowed to form in 2 separate plates using the MBEC physiology and genetics assay kit at 37°C for 24 h with aeration. One plate was used for measuring the cell numbers in the biofilm. For this purpose, the biofilms were washed in 0.9% NaCl and were disrupted by sonication. The other plate was used for the killing assay for biofilm cells. Biofilms were washed in 0.9% NaCl and were exposed to 32 μg/ml of BIPM for 6 h. Subsequently, the biofilm cells were washed in 0.9% NaCl and were disrupted by sonication, and bacterial viability was determined by serial dilution with saline and plating on an LB agar plate for bacterial enumeration.

H2O2 killing assay.

The H2O2 killing assay was performed as described by Khakimova et al. (54). Briefly, 2 × 106-CFU/ml stationary-phase cultures were incubated with 3 mM H2O2 at 37°C with aeration. The number of viable cells was determined before and after H2O2 addition by subculturing the cells on LB agar plates for 24 h.

Detection of the pslA gene in clinical isolates.

For detection of the pslA gene, primers pslA-s (CAGGCACTGGACGTCTACTC) and pslA-a (GTTGCGTACCAGGTATTCGG) were designed to amplify a 309-bp fragment within the coding sequence of pslA gene.

Expression of the pelA and pslA genes.

PAO1 was incubated at 37°C with aeration in LB broth until the culture reached log phase (optical density at 595 nm [OD595], 0.25). For analysis of gene expression in adherent cells, the log-phase culture was diluted with saline to reach a concentration of 2 × 106 CFU/ml. Each well of a 6-well tissue culture plate (Becton Dickinson, NJ, USA) received 1.5 ml of the bacterial suspension, and the plate was centrifuged at 450 × g for 15 min at 25°C. After centrifugation, the saline was removed, and 500 μl of RNAprotect Bacteria reagent (Qiagen, Valencia, CA, USA) was added to the wells. The cells were removed with a cell scraper. For analysis of gene expression in planktonic cells, the log-phase cells were used as a control. Total RNA was isolated using an RNeasy kit (Qiagen). Genomic DNA was eliminated by treatment with RNase-free DNase (Promega, Madison, WI) during the isolation procedure. Reverse transcription was performed by using the SuperScript III First-Strand cDNA synthesis system (Thermo Fisher Scientific, MA, USA) according to the manufacturer's instructions. Real-time PCR was performed in a StepOnePlus real-time PCR system (Thermo Fisher Scientific) with the Fast SYBR green master mix (Thermo Fisher Scientific). The expression level of each gene was normalized to that of rpsL, which had constant expression throughout the experiment. The threshold cycle (CT) values were determined, and data analysis was performed, with StepOne software, v2.2 (Applied Biosystems). The relative expression levels of the pslA and pelA genes were determined after normalization using the ΔΔCT method. The result for each gene was expressed as the fold change from the value for the control planktonic cell samples.

In vivo bioluminescence imaging.

PAO1 Plac::lux and PAO1ΔpslBCD Plac::lux were inoculated into neutropenic ICR mice aged 5 to 7 weeks (n, 3/group). An inoculum containing approximately 106 CFU was injected into each thigh. Two hours after the inoculum injection, mice were subcutaneously administered selected concentrations of biapenem (0.78 mg/kg of body weight) 4 times over a period of 8 h. At 0, 2, 4, 6, 8, and 10 h after the inoculum injection, mice were anesthetized using a constant flow of 2.5% isoflurane mixed with oxygen, and bioluminescence images were acquired using an IVIS Lumina system (Caliper, Alameda, CA, USA).

Statistical analysis.

The data in the figures are presented as means ± standard deviations (SDs). All comparisons between populations were performed by Student's t test. P values less than 0.05 or 0.01 were considered to be significant. Statistical analysis was performed using GraphPad Prism, version 5.01 (GraphPad Software, Inc., La Jolla, CA, USA).

Supplementary Material

Supplemental material

ACKNOWLEDGMENTS

This work was supported by a grant-in-aid for scientific research (no. 26462787) from the Japan Society for the Promotion of Science.

Footnotes

Supplemental material for this article may be found at https://doi.org/10.1128/AAC.02587-16.

REFERENCES

  • 1.Bigger JW. 1944. Treatment of staphylococcal infections with penicillin by intermittent sterilisation. Lancet 244:497–500. doi: 10.1016/S0140-6736(00)74210-3. [DOI] [Google Scholar]
  • 2.Lewis K. 2005. Persister cells and the riddle of biofilm survival. Biochemistry (Mosc) 70:267–274. doi: 10.1007/s10541-005-0111-6. [DOI] [PubMed] [Google Scholar]
  • 3.Murakami K, Ono T, Viducic D, Kayama S, Mori M, Hirota K, Nemoto K, Miyake Y. 2005. Role for rpoS gene of Pseudomonas aeruginosa in antibiotic tolerance. FEMS Microbiol Lett 242:161–167. doi: 10.1016/j.femsle.2004.11.005. [DOI] [PubMed] [Google Scholar]
  • 4.Kayama S, Murakami K, Ono T, Ushimaru M, Yamamoto A, Hirota K, Miyake Y. 2009. The role of rpoS gene and quorum-sensing system in ofloxacin tolerance in Pseudomonas aeruginosa. FEMS Microbiol Lett 298:184–192. doi: 10.1111/j.1574-6968.2009.01717.x. [DOI] [PubMed] [Google Scholar]
  • 5.Viducic D, Ono T, Murakami K, Susilowati H, Miyake Y. 2007. rpoN gene of Pseudomonas aeruginosa alters its susceptibility to quinolones and carbapenems. Antimicrob Agents Chemother 51:1455–1462. doi: 10.1128/AAC.00348-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Viducic D, Murakami K, Amoh T, Ono T, Miyake Y. 2016. RpoN modulates carbapenem tolerance in Pseudomonas aeruginosa through Pseudomonas quinolone signal and PqsE. Antimicrob Agents Chemother 60:5752–5764. doi: 10.1128/AAC.00260-16. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Viducic D, Ono T, Murakami K, Susilowati H, Kayama S, Hirota K, Miyake Y. 2006. Functional analysis of spoT, relA and dksA genes on quinolone tolerance in Pseudomonas aeruginosa under nongrowing condition. Microbiol Immunol 50:349–357. doi: 10.1111/j.1348-0421.2006.tb03793.x. [DOI] [PubMed] [Google Scholar]
  • 8.Miyake Y, Fujiwara S, Usui T, Suginaka H. 1992. Simple method for measuring the antibiotic concentration required to kill adherent bacteria. Chemotherapy 38:286–290. doi: 10.1159/000239015. [DOI] [PubMed] [Google Scholar]
  • 9.Aaron SD, Ferris W, Ramotar K, Vandemheen K, Chan F, Saginur R. 2002. Single and combination antibiotic susceptibilities of planktonic, adherent, and biofilm-grown Pseudomonas aeruginosa isolates cultured from sputa of adults with cystic fibrosis. J Clin Microbiol 40:4172–4179. doi: 10.1128/JCM.40.11.4172-4179.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Ryder C, Byrd M, Wozniak DJ. 2007. Role of polysaccharides in Pseudomonas aeruginosa biofilm development. Curr Opin Microbiol 10:644–648. doi: 10.1016/j.mib.2007.09.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Hickman JW, Tifrea DF, Harwood CS. 2005. A chemosensory system that regulates biofilm formation through modulation of cyclic diguanylate levels. Proc Natl Acad Sci U S A 102:14422–14427. doi: 10.1073/pnas.0507170102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Irie Y, Starkey M, Edwards AN, Wozniak DJ, Romeo T, Parsek MR. 2010. Pseudomonas aeruginosa biofilm matrix polysaccharide Psl is regulated transcriptionally by RpoS and post-transcriptionally by RsmA. Mol Microbiol 78:158–172. doi: 10.1111/j.1365-2958.2010.07320.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Newman JR, Fuqua C. 1999. Broad-host-range expression vectors that carry the l-arabinose-inducible Escherichia coli araBAD promoter and the araC regulator. Gene 227:197–203. doi: 10.1016/S0378-1119(98)00601-5. [DOI] [PubMed] [Google Scholar]
  • 14.Baraquet C, Murakami K, Parsek MR, Harwood CD. 2012. The FleQ protein from Pseudomonas aeruginosa functions as both a repressor and an activator to control gene expression from the operon promoter in response to c-di-GMP. Nucleic Acids Res 40:7207–7218. doi: 10.1093/nar/gks384. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Matsukawa M, Greenberg EP. 2004. Putative exopolysaccharide synthesis genes influence Pseudomonas aeruginosa biofilm development. J Bacteriol 186:4449–4456. doi: 10.1128/JB.186.14.4449-4456.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Ma L, Jackson KD, Landry RM, Parsek MR, Wozniak DJ. 2006. Analysis of Pseudomonas aeruginosa conditional Psl variants reveals roles for the Psl polysaccharide in adhesion and maintaining biofilm structure postattachment. J Bacteriol 188:8213–8221. doi: 10.1128/JB.01202-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Zhao K, Tseng BS, Beckerman B, Jin F, Gibiansky ML, Harrison JJ, Luijiten E, Parsek MR, Wong GC. 2013. Psl trails guide exploration and microcolony formation in Pseudomonas aeruginosa biofilm. Nature 497:388–391. doi: 10.1038/nature12155. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Irie Y, Borlee BR, O'Connor JR, Hill PJ, Harwood CS, Wozniak DJ, Parsek MR. 2012. Self-produced exopolysaccharide is a signal that stimulates biofilm formation in Pseudomonas aeruginosa. Proc Natl Acad Sci U S A 109:20632–20636. doi: 10.1073/pnas.1217993109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Billings N, Millan M, Caldara M, Rusconi R, Tarasova Y, Stocker R, Ribbeck K. 2013. The extracellular matrix component Psl provides fast-acting antibiotic defense in Pseudomonas aeruginosa biofilms. PLoS Pathog 9:e1003526. doi: 10.1371/journal.ppat.1003526. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Overhage J, Schemionek M, Webb JS, Rehm BH. 2005. Expression of the psl operon in Pseudomonas aeruginosa PAO1 biofilms: PslA performs an essential function in biofilm formation. Appl Environ Microbiol 71:4407–4413. doi: 10.1128/AEM.71.8.4407-4413.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Goodman AL, Kaulasekara B, Rietsch A, Boyd D, Smith RS, Lory S. 2004. A signaling network reciprocally regulates genes associated with acute infection and chronic persistence in Pseudomonas aeruginosa. Dev Cell 7:745–754. doi: 10.1016/j.devcel.2004.08.020. [DOI] [PubMed] [Google Scholar]
  • 22.Petrova OE, Sauer K. 2011. SagS contributes to the motile-sessile switch and acts in concert with BfiSR to enable Pseudomonas aeruginosa biofilm formation. J Bacteriol 193:6614–6628. doi: 10.1128/JB.00305-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Llamas MA, Imperi F, Visca P, Lamont IL. 2014. Cell-surface signaling in Pseudomonas: stress responses, iron transport, and pathogenicity. FEMS Microbiol Rev 38:569–597. doi: 10.1111/1574-6976.12078. [DOI] [PubMed] [Google Scholar]
  • 24.O'Toole GA, Wong GC. 2016. Sensational biofilms: surface sensing in bacteria. Curr Opin Microbiol 30:139–146. doi: 10.1016/j.mib.2016.02.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Otto K, Silhavy TJ. 2002. Surface sensing and adhesion of Escherichia coli controlled by the Cpx-signaling pathway. Proc Natl Acad Sci U S A 99:2287–2292. doi: 10.1073/pnas.042521699. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Dorel C, Lejeune P, Rodrigue A. 2006. The Cpx system of Escherichia coli, a strategic signaling pathway for confronting adverse conditions and for settling biofilm communities? Res Microbiol 157:306–314. doi: 10.1016/j.resmic.2005.12.003. [DOI] [PubMed] [Google Scholar]
  • 27.Gode-Potratz CJ, Kustusch RJ, Breheny PJ, Weiss DS, McCarter LL. 2011. Surface sensing in Vibrio parahaemolyticus triggers a programme of gene expression that promotes colonization and virulence. Mol Microbiol 79:240–263. doi: 10.1111/j.1365-2958.2010.07445.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Huangyutitham V, Guvener ZT, Harwood CS. 2013. Subcellular clustering of the phosphorylated WspR response regulator protein stimulates its diguanylate cyclase activity. mBio 4(3):e00242-13. doi: 10.1128/mBio.00242-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.O'Connor JR, Kuwada NJ, Huangyutitham V, Wiggins PA, Harwood CS. 2012. Surface sensing and lateral subcellular localization of WspA, the receptor in a chemosensory-like system leading to c-di-GMP production. Mol Microbiol 86:720–729. doi: 10.1111/mmi.12013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Merritt JH, Brothers KM, Kuchma SL, O'Toole GA. 2007. SadC reciprocally influences biofilm formation and swarming motility via modulation of exopolysaccharide production and flagellar function. J Bacteriol 189:8154–8164. doi: 10.1128/JB.00585-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Kuchma SL, Ballok AE, Merritt JH, Hammond JH, Lu W, Rabinowitz JD, O'Toole GA. 2010. Cyclic-di-GMP-mediated repression of swarming motility by Pseudomonas aeruginosa: the pilY1 gene and its impact on surface-associated behaviors. J Bacteriol 192:2950–2964. doi: 10.1128/JB.01642-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Luo Y, Zhao K, Baker AE, Kuchma SL, Coggan KA, Wolfgang MC, Wong GCL, O'Toole GA. 2015. A hierarchical cascade of second messengers regulates Pseudomonas aeruginosa surface behaviors. mBio 6(1):e02456-14. doi: 10.1128/mBio.02456-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Moyed HS, Bertrand KP. 1983. hipA, a newly recognized gene of Escherichia coli K-12 that affects frequency of persistence after inhibition of murein synthesis. J Bacteriol 155:768–775. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Balaban NQ, Merrin J, Chait R, Kowalik L, Leibler S. 2004. Bacterial persistence as a phenotypic switch. Science 305:1622–1625. doi: 10.1126/science.1099390. [DOI] [PubMed] [Google Scholar]
  • 35.Pandey DP, Gerdes K. 2005. Toxin-antitoxin loci are highly abundant in free-living but lost from host-associated prokaryotes. Nucleic Acids Res 33:966–976. doi: 10.1093/nar/gki201. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Nguyen D, Joshi-Datar A, Lepine F, Bauerle E, Olakanmi O, Beer K, McKay G, Siehnel R, Schafhauser J, Wang Y, Britigan BE, Singh PK. 2011. Active starvation responses mediate antibiotic tolerance in biofilms and nutrient-limited bacteria. Science 334:982–986. doi: 10.1126/science.1211037. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Wakamoto Y, Dhar N, Chait R, Schneider K, Signorino-Gelo F, Leibler S, McKinney JD. 2013. Dynamic persistence of antibiotic-stressed mycobacteria. Science 339:91–95. doi: 10.1126/science.1229858. [DOI] [PubMed] [Google Scholar]
  • 38.Orman MA, Brynildsen MP. 2013. Dormancy is not necessary or sufficient for bacterial persistence. Antimicrob Agents Chemother 57:3230–3239. doi: 10.1128/AAC.00243-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Kohanski MA, Dwyer DJ, Hayete B, Lawrence CA, Collins JJ. 2007. A common mechanism of cellular death induced by bactericidal antibiotics. Cell 130:797–810. doi: 10.1016/j.cell.2007.06.049. [DOI] [PubMed] [Google Scholar]
  • 40.Shan Y, Lazinski D, Rowe S, Camilli A, Lewis K. 2015. Genetic basis of persister tolerance to aminoglycosides in Escherichia coli. mBio 6(2):e00078-15. doi: 10.1128/mBio.00078-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Tsuda M. 1998. Use of a transposon-encoded site-specific resolution system for construction of large and defined deletion mutations in bacterial chromosome. Gene 207:33–41. doi: 10.1016/S0378-1119(97)00601-X. [DOI] [PubMed] [Google Scholar]
  • 42.Taniguchi K, Ono T, Murakami K, Viducic D, Kayama S, Hirota K, Nemoto K, Miyake Y. 2003. Novel Pseudomonas aeruginosa gene that suppresses tolerance to carbapenems. Antimicrob Agents Chemother 47:2997–3001. doi: 10.1128/AAC.47.9.2997-3001.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Schweizer HP. 1993. Small broad-host-range gentamicin resistance gene cassette for site-specific insertion and deletion mutagenesis. BioTechniques 15:831–834. [PubMed] [Google Scholar]
  • 44.Schweizer HP. 1992. Allelic exchange in Pseudomonas aeruginosa using novel ColE1-type vectors and a family of cassettes containing a portable oriT and the counter-selectable Bacillus subtilis sacB marker. Mol Microbiol 6:1195–1204. doi: 10.1111/j.1365-2958.1992.tb01558.x. [DOI] [PubMed] [Google Scholar]
  • 45.Simon R, Priefer U, Pühler A. 1983. A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in gram negative bacteria. Nat Biotechnol 1:784–791. doi: 10.1038/nbt1183-784. [DOI] [Google Scholar]
  • 46.Fürste JP, Pansegrau W, Frank R, Blocker H, Scholz P, Bagdasarian M, Lanka E. 1986. Molecular cloning of plasmid RP4 primer region in multi-host-range tacP expression vector. Gene 48:119–131. doi: 10.1016/0378-1119(86)90358-6. [DOI] [PubMed] [Google Scholar]
  • 47.Kirisits MJ, Prost L, Starkey M, Parsek MR. 2005. Characterization of colony morphology variants isolated from Pseudomonas aeruginosa biofilms. Appl Environ Microbiol 71:4809–4821. doi: 10.1128/AEM.71.8.4809-4821.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Starkey M, Hickman JH, Ma L, Zhang N, Long SD, Hinz A, Palacios S, Manoil C, Kirisitis MJ, Starner TD, Wozniak DJ, Harwood CS, Parsek MR. 2009. Pseudomonas aeruginosa rugose small-colony variants have adaptations that likely promote persistence in the cystic fibrosis lung. J Bacteriol 191:3492–3503. doi: 10.1128/JB.00119-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Hoang TT, Kutchma AJ, Becher A, Schweizer HP. 2000. Integration-proficient plasmids for Pseudomonas aeruginosa: site-specific integration and use for engineering of reporter and expression strains. Plasmid 43:59–72. doi: 10.1006/plas.1999.1441. [DOI] [PubMed] [Google Scholar]
  • 50.Schweizer HP. 1991. Improved broad-host-range lac-based plasmid vectors for the isolation and characterization of protein fusions in Pseudomonas aeruginosa. Gene 103:87–92. doi: 10.1016/0378-1119(91)90396-S. [DOI] [PubMed] [Google Scholar]
  • 51.Hoang TT, Karkhoff-Schweizer RR, Kutchma AJ, Schweizer HP. 1998. A broad-host-range Flp-FRT recombination system for site-specific excision of chromosomally-located DNA sequences: application for isolation of unmarked Pseudomonas aeruginosa mutants. Gene 212:77–86. doi: 10.1016/S0378-1119(98)00130-9. [DOI] [PubMed] [Google Scholar]
  • 52.Clinical and Laboratory Standards Institute. 2009. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically. Approved standard, 8th ed CLSI document M07-A8 Clinical and Laboratory Standards Institute, Wayne, PA. [Google Scholar]
  • 53.Harrison JJ, Stremick CA, Turner RJ, Allan ND, Olson ME, Ceri H. 2010. Microtiter susceptibility testing of microbes growing on peg lids: a miniaturized biofilm model for high-throughput screening. Nat Protoc 5:1236–1254. doi: 10.1038/nprot.2010.71. [DOI] [PubMed] [Google Scholar]
  • 54.Khakimova M, Ahlgren HG, Harrison JJ, English AM, Nguyen D. 2013. The stringent response controls catalases in Pseudomonas aeruginosa and is required for hydrogen peroxide and antibiotic tolerance. J Bacteriol 195:2011–2020. doi: 10.1128/JB.02061-12. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental material

Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES