Skip to main content
PMC home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2018 Feb 1.
Published in final edited form as: Genes Chromosomes Cancer. 2016 Oct 26;56(2):168–174. doi: 10.1002/gcc.22424

Germline BAP1 Alterations in Familial Uveal Melanoma

Karan Rai 1, Robert Pilarski 1, Getachew Boru 2, Muneeb Rehman 2, Ahmad H Saqr 2, James B Massengill 2, Arun Singh 3, Meghan J Marino 3, Frederick H Davidorf 2, Colleen M Cebulla 2, Mohamed H Abdel-Rahman 1,2,*
PMCID: PMC5490375  NIHMSID: NIHMS831390  PMID: 27718540

Abstract

Uveal melanoma (UM) is the most commonly diagnosed primary intraocular tumor in adults. Familial UM (FUM), defined as two or more family members diagnosed with UM, is rare and estimated at less than 1% of all UM. Currently, BAP1 is the only gene known to contribute significant risk for UM. In this study we aimed to estimate the frequency of BAP1 mutation in FUM and to characterize the family and personal histories of other cancers in these families. We identified 32 families with FUM, including seven families previously reported by our group. BAP1 mutation testing was carried out by direct sequencing of the coding exons and the adjacent untranslated regions of the gene. Germline deletion and duplication analysis of BAP1 was assessed by multiplex ligation-dependent probe amplification (MLPA). Germline BAP1 mutations were found in 6/32 (19%) families. No deletions or duplications were identified in any of the 24 samples tested by MLPA. Combined with published studies, the frequency of BAP1 mutations was 14/64 (22%) in FUM. FUM families without BAP1 mutations have distinct family histories with high rates of prostate cancer in first- and second-degree relatives. It is likely that additional genes conferring risk for FUM exist. It is important to understand key shared features of FUM to focus future research on identifying these additional tumor predisposition syndromes. Though BAP1 should be tested first in these families, FUM families without BAP1 mutation should be explored for additional predisposition genes.

INTRODUCTION

Uveal melanoma (UM) is the most commonly diagnosed primary intraocular cancer in adults (Singh et al., 2011). While the disease is relatively rare in the general population, with an incidence rate of 5.1 per million, there is strong support for the role of heredity in familial UM (FUM), defined as two or more family members diagnosed with UM (Singh et al., 1996b, 2011; Abdel-Rahman et al., 2010). The chance of two or more first degree relatives with UM occurring in a family by chance is very low and estimated at 0.00018 (Singh et al., 1996c). Approximately 12% of patients with UM have family history characteristics suggestive of a hereditary syndrome (Abdel-Rahman et al., 2010), and evidence of an autosomal dominant mode of inheritance has been suggested (Singh et al., 1996b). In addition, multiple reports have described the association of UM and other cancers, especially cutaneous melanoma (CM) and breast cancer (Henkind and Roth, 1971; Rednam et al., 1981;Harvey and Brinton, 1985; van Hees et al., 1998; Hemminki and Jiang, 2001; Diener-West et al., 2005b; Bergman et al., 2006). Only a few genes that play a role in FUM have been identified, of which the BRCA-associated-protein 1 (BAP1) gene appears to have the strongest association. The frequency of BAP1 mutations in FUM is currently unknown, however, complicating genetic testing decisions in high-risk families. Furthermore, currently known genes account for only a fraction of hereditary UM, and it is likely that additional genes exist. A close analysis of families with multiple UM diagnoses can uncover shared features that may point to new cancer predisposition syndromes. Thus, the aims of this study were to estimate the prevalence of BAP1 mutations and deletions or duplications in FUM, and to demonstrate features of these families that may aid in the discovery of new genes predisposing to UM and other cancers.

MATERIALS AND METHODS

Germline Mutation Testing

Data on 25 previously unreported families with multiple individuals diagnosed with UM were included (Table 1). Three of these 25 families were accrued at the Cole Eye Institute at the Cleveland Clinic Foundation and the remaining families were accrued at The Ohio State University. Probands were accrued prospectively and personal and family cancer histories were collected in addition to peripheral blood. Samples were sequenced for all coding exons of BAP1 and the 5’untranslated region (UTR) according to our previously described protocol (Abdel-Rahman et al., 2011a). The following three primer sets were used to sequence the 3’UTR (F1 ACATTCCTTCCATCGTGCCC, R1 TGGGACACCCTACTCCCAAC, F2 AGGTCCTTGTATCATGCCACG, R2: GCAACCCTGTCTCTGCTACC, F3: GTT CTAGGGCTCTTCGCCTTC and R3: AGCAACCACAGGAGGGTTCAT). Sequences were aligned per the reference sequence provided by GenBank accession number NM_004656.2. All research was approved by the Institutional Review Boards at The Ohio State University and Cole Eye Institute and informed consents were obtained prior to testing. Results were combined with those from five FUM families previously reported by our group (Abdel-Rahman et al., 2011a; Pilarski et al., 2014; Cebulla et al., 2015) for a total n = 32.

TABLE 1.

Summary of Personal History of Cancer and Family History of Uveal Melanoma in Patients Included in the Study

Family/
Case #		 Proband
UM (age/sex)		 Proband (other
cancer/age)		 Family history
UM (Age/Sex)		 BAP1 Status Reference
FUM036a 52/F Lung Ca Maternal first cousin (50F), Maternal first cousin once removed (N/A M) c. 799C>T, p. Gly267*, c.650-26T>A c. 931 170A>G, c.931 1117_118delCC, rs28997577, c.1891-30G>C Abdel-Rahman et al., 2011
FUM064a 41/F Liver Ca (42), Soft Tissue Carcinoma (42) Father (49M), Paternal 3rd cousin (N/A F) c.2050C>T, p.Gln684* Pilarski et al., 2014
FUM104 67/F Colon Ca (71) Son (49M), Maternal uncle (N/A M) c.1180_1183delACTC, p.Tyr627Tyrfs* 9 Pilarski et al., 2014
FUM152 18/F None Father (45M) c. 1717delC, p.L573fs* 3, rs71651686 Cebulla et al. 2015
FUM327 62/M None Maternal first cousin (N/A F), Maternal grandfather (N/A M) c.1938T>A, Y646* This study
FUM340 22/F None Paternal great uncle (40’s M), Paternal great uncle (40’s M), Paternal second cousinonce-removed (40’s F) c.458_459delCT P153Rfs* 7 This study
FUM011a 55/M Cutaneous melanoma (63) Mother (62F) WT Abdel-Rahman et al., 2010
FUM012a 27/M None Maternal 1st cousin once removed (10–19M) WT Abdel-Rahman et al., 2011
FUM033a 37/F None Paternal aunt (N/A F) WT Abdel-Rahman et al., 2011
FUM058a 74/F None Maternal first cousin (50’s M) WT This study
FUM062 42/F None Paternal first cousin once removed (58M) WT This study
FUM073 72/M None Brother (62M) WT This study
FUM074 73/M None Father (58M) WT This study
FUM075 51/M None Maternal aunt (N/A F) WT This study
FUM144a 76/M None Paternal second cousin (N/A F) WT This study
FUM230 67/F Renal Cell Ca (57) Unknown relative (N/A M) WT This study
FUM306 46/F Uterine Ca (51) Maternal aunt (55F) WT This study
FUM312 64/F None Maternal first cousin (50F) WT This study
FUM315 66, 78/F (ipsilateral) None Paternal first cousin (N/A M), Paternal first cousin (N/A M) WT This study
FUM317 38/F Uterine Ca (68) Father (75M) WT This study
FUM318 51/M None Paternal 2nd cousin once removed (N/A M) WT This study
FUM319 44/M Skin Ca (30’s) Maternal great uncle (60’s–70’s M), Maternal 1st cousin (50’s M) WT This study
FUM326 54/F None Maternal grandfather (70’sM) WT This study
FUM328 76/M None Brother (50’s M) WT This study
FUM330 48/F None Father (50M) WT This study
FUM331 51/M Thyroid Ca Maternal grandmother (N/A F) WT This study
FUM332 49/F Breast Ca Brother (45M) WT This study
FUM329 75/M None Maternal 3rd cousin (75F) WT This study
FUM313 36/M None Paternal aunt (N/A F) WT This study
CCE 4516 69/M None Mother (80F) WT This study
CCE 4518 N/A/F Breast Ca (N/A) Mother (N/A F) WT This study
CCE 4587 62/M None Son (32M) WT This study
Open in a new tab

WT:wild type, Ca: Cancer.

a

These patients were also tested for CDKN2A, CDKN2B and CDK4. FUM011 showed a VUS in CDKN2A (chr9:21994399G>A).

Deletion/Duplication Analysis

Deletions and duplications were assessed in 24 patients with no detected germline BAP1 sequence mutation utilizing multiplex ligation-dependent probe amplification analysis (SALSA MLPA P417 BAP1 probemix, MRC-Holland) according to the manufacturer’s protocol.

Literature Review

We conducted a literature review of all English language peer-reviewed articles on FUM. A PubMed search was directed with the key words “familial uveal melanoma,” “familial ocular melanoma,” and “familial eye melanoma”. Excluding reports by our own group, a total of 28 articles describing 115 independent families with multiple UM diagnoses were identified (https://docs.google.com/spreadsheets/d/1rb0qu-4d_rPjW7qs6G1-GyfE-sepWtas40QM230_4Dfg/edit?usp=sharing: Lynch et al., 1968; Green et al., 1978; Oosterhuis et al., 1982; Canning and Hungerford, 1988; Jay and McCartney, 1993; Young et al., 1994; Wang et al., 1996; Singh et al., 1996a, 1996b, 2000; van Hees et al., 1998; Soufir et al., 2000; Krygier et al., 2001; Hearle et al., 2003b; Kodjikian et al., 2003; Barker-Griffith and Streeten, 2004; Jonsson et al., 2005; Smith et al., 2007; Njauw et al., 2012; Wadt et al., 2012, 2014; Aoude et al., 2013; Cheung et al., 2013; Hoiom et al., 2013; Popova et al., 2013; Maerker et al., 2014; Gupta et al., 2015; Turunen et al., 2016). Out of those, 39 families had undergone BAP1 testing; seven of these were single case reports. Single case reports were excluded from our assessment of the frequency of BAP1 mutation in familial cases to avoid introducing selection and testing bias. Thus, 32 FUM families with known BAP1 mutation status, from three published series of unselected families, were combined with our series for a meta-analysis to estimate the frequency of BAP1 mutation in FUM.

Out of the 115 reported families no genetic testing was reported in 59 probands; genetic testing results for one or more of other candidate genes (CDKN2A, CDKN2B, CDK4 and BRCA2), but not BAP1, were available in 16 additional probands (Singh et al., 1996a; Soufir et al., 2004; Hearle et al., 2003a). No mutation was identified in any of these candidate genes. In one familial case a mutation in TP53 was suggested based on immunohistochemistry assessment (Jay and McCartney, 1993). To evaluate the frequency of other cancers in FUM and effect of BAP1 mutation status, we combined data from our series with that from the literature. We excluded the family with putative TP53 mutation as well as those missing full reports of family histories. As such, only 53 out of the 115 families from the literature were used in the family history analysis (Lynch et al., 1968; Green et al., 1978; Oosterhuis et al., 1982; Young et al., 1994; Singh et al., 1996b, 2000; van Hees et al., 1998; Soufir et al., 2000; Krygier et al., 2001; Hearle et al., 2003b; Kodjikian et al., 2003; Jonsson et al., 2005; Smith et al., 2007; Njauw et al., 2012; Wadt et al., 2012, 2014; Aoude et al., 2013; Cheung et al., 2013; Hoiom et al., 2013; Popova et al., 2013; Maerker et al., 2014; Gupta et al., 2015; Turunen et al., 2016). A two-tailed Fisher’s exact test was used to measure the statistical significance of variance in family cancer histories.

Systematic data abstraction from the articles included family history of cancer, age of cancer diagnosis, degree of relation, and genetic testing results. Unpublished material was not consulted and supplemental material was consulted if available. Data were collated and analyzed by the authors to produce relevant results.

RESULTS

Frequency of BAP1 Alterations in FUM

The mean age of primary uveal melanoma diagnosis in probands in our cohort of 32 families was 54 years (range 18–76). Our cohort had 56% female probands. Among probands, 11/32 (34%) had a second primary cancer diagnosis in addition to UM.

Out of the 25 unreported FUM we identified two patients FUM327 and FUM340 with germline truncating mutation in BAP1 (Table 1). Combined with our previously published families the overall BAP1 mutations frequency in our cohort was 6/32 (19%; Table 1). Deletions and duplications were successfully assessed by MLPA in 24 patients, with no such alterations detected in BAP1. A variant in the 3’UTR, rs123598, was identified in 3/28 (11%) patients. The variant has been reported in the 1000 Genomes Project with a global minor allele frequency (MAF) of 0.03 (A) and Caucasian MAF of 0.06 suggesting that this is a benign variant.

The BAP1 mutation frequency in our cohort is similar to the frequency of BAP1 mutations in FUM (20–29%) found by other groups in smaller cohorts. Popova et al. found a BAP1 mutation frequency of 29% in a cohort of 14 families, while Gupta et al. and Turunen et al. found frequencies of 20% and 25% in cohorts of 10 and eight families respectively (Popova et al., 2013; Gupta et al., 2015; Turunen et al., 2016). These previous reports sequenced the coding region of BAP1 and no reports of germline deletions or duplications were available. When our data are combined with these previous reports the frequency of BAP1 mutation in FUM is estimated to be approximately 22% (95% CI 21–23%).

Family Cancer History in FUM

Family history information collected in our prospective cohort of 32 families ranged from three to five generations. Thirteen out of all 32 families (41%) and 10 out of our 26 BAP1 mutation-negative families (38%) had a second UM diagnosis in a first-degree relative. This is approximately consistent with an autosomal dominant inheritance pattern as has been suggested (Singh et al., 1996b). Fifteen of the 53 FUM families in the literature with adequate family cancer history information had a BAP1 mutation, 10 families tested negative, and 28 families were untested. Table 2 summarizes the cancer family histories reported in families with and without BAP1 mutations, in our cohort and in the literature. As expected, families with BAP1 mutations have significantly higher rates of malignant mesothelioma (MMe, p = 0.0001) and renal cell carcinoma (RCC, p = 0.0003). Interestingly, higher rates of lung cancer approached significance (p = 0.09) in families with BAP1 mutation while higher rates of CM, a cancer with known predisposition conferred by BAP1, did not reach statistical significance (p = 0.2114). In FUM families without BAP1 mutation, the family history rates of MMe and RCC are significantly lower.

TABLE 2.

Non-UM Cancer Prevalence in Proband and First- and Second-Degree Relatives in Familial UM Families, With Comparison of Overall Cancer Rates Between BAP1-Positive and BAP1-Negative Families

Prospective
cohort (n = 32)		 Literature (n = 53)a Combined (n = 57)
Family history BAP1+
Mut (n = 6)		 BAP1 WT
(n = 26)		 BAP1 + Mut
(n = 15)b 		BAP1 WT
(n = 10)c 		Untested
(n = 28)		 BAP1 + Mut
(n = 21)		 BAP1 WT
(n = 36)		 p-value
(Fisher’s
exact test)
Basal cell carcinoma 0 12% 27% 0 7% 19% 8% 0.4042
Breast cancer 33% 19% 20% 20% 14% 24% 19% 0.7439
CM 33% 15% 40% 30% 21% 38% 19% 0.2114
Cholangiocarcinoma 0 0 7% 0 4% 5% 0 0.3684
Colon cancer 17% 19% 7% 10% 7% 10% 17% 0.6966
Lung cancer 67% 23% 40% 30% 14% 48% 25% 0.0918
Malignant Mesothelioma 50% 0 33% 0 4% 38% 0 0.0001
Meningioma 17% 0 0% 0 0 5% 0 0.3684
Pancreatic cancer 17% 0 0% 10% 0 5% 3% 1
Prostate cancer 17% 35% 7% 20% 0 10% 31% 0.1027
Renal cell carcinoma 17% 4% 47% 0 0 43% 3% 0.0003
Open in a new tab
b

Seven studies didn’t report family histories of cancer other than uveal melanoma.

c

Only one study reported family histories of BAP1 negative familial UM patients. Mut: mutant, WT: wild type.

DISCUSSION

BAP1 has been identified as a significant UM predisposition gene. However, until now there have been few estimates as to the prevalence of germline BAP1 mutations in FUM. We estimate that BAP1 mutations are present in approximately 22% of FUM families overall, compared with 2–4% in unselected UM (Gupta et al., 2015; Turunen et al., 2016). However, the history of other cancers in the family can significantly alter the chance of finding a BAP1 mutation. In FUM families with no other history of BAP1-associated cancers, the chance of BAP1 mutation may be as low as 8%. Conversely, the chance of BAP1 mutation in FUM families with additional family history of CM, MMe, and/or RCC can be as high as 50%. Families with multiple UM diagnoses should be referred for germline genetic testing for BAP1, even though it explains only a subset of FUM. We did not identify deletions or duplications in any of the samples tested, suggesting that large gene rearrangement is not a major contributor to germline BAP1 alterations.

There are a number of characteristics that FUM families share that point to the existence of hereditary cancer syndromes beyond BAP1. Approximately 38% of the BAP1 negative families have two UM diagnoses in first-degree relatives, consistent with autosomal dominant inheritance and suggesting that relatives are at high-risk for developing tumors. In addition, FUM families appear to have a higher cancer burden overall. For instance, the rate of second primary cancers in the probands was about 3-fold higher than in unselected UM (31% versus 10%; Diener-West et al., 2005a). The tumor spectrum reported in the family histories is distinct between those that have germline BAP1 mutations and those that do not. Specifically, families without BAP1 mutations have lower rates of MMe and RCC as compared to those with BAP1 mutations. Comparison to rates of these cancers expected in family histories in the general population is difficult, however. It is also unclear if there is a strong association between FUM, breast cancer, and CM in these families, though this has been previously reported (Henkind and Roth, 1971; Rednam et al., 1981; Harvey and Brinton, 1985; van Hees et al., 1998; Hemminki and Jiang, 2001; Diener-West et al., 2005b; Bergman et al., 2006). Interestingly, lung cancer may be a minor phenotype of the BAP1 syndrome, though this should be confirmed in future studies. One of the major challenges in evaluating published data on FUM is that many of the publications either listed only UM patients, UM but no other cancers or described only BAP1 positive FUM but provided no information on those with no BAP1 mutation. Establishing a registry for this rare cancer that captures such crucial information is highly warranted. Fortunately, there is a serious effort in the ocular oncology community in the US and other parts of the world to establish such a registry.

In one of the FUM families we confirmed BAP1 mutation in two family members (FUM036). In other families another family member with UM was not available for testing; however in several we confirmed BAP1 mutations in family members with other cancers. One of the mutations identified c.1717_1717delC, p.Leu573fs_3 (FUM152) was recently reported as a founder mutation in several families in North America (Carbone et al., 2015; Cebulla et al., 2015). A synonymous rare variant rs71651686 in linkage disequilibrium with the founder mutation was also observed in the proband of FUM152 suggesting that the FUM152 is linked to the same founder mutation. We should note that we recently identified another family with the same founder mutation and the rs71651686 variant (unpublished data) and the family presented with UM and other cancers linked to the BAP1-tumor predisposition syndrome. This suggests that this founder mutation is likely underdiagnosed in the US.

Few genes have previously been implicated in predisposition for UM. The best described is BAP1, with UM risk estimated at up to 29% (Rai et al., 2016). UM is the most frequent and earliest presenting cancer (age 16) reported in the BAP1 tumor predisposition syndrome. Interestingly, although UM was the first cancer-type associated with the gene, several other cancers were found to be associated with the syndrome upon further research (Harbour et al., 2010; Abdel-Rahman et al., 2011a; Testa et al., 2011; Wiesner et al., 2011). As such, what first appeared as a narrow phenotype was actually a rather broad tumor predisposition syndrome. BRCA2, although primarily associated with breast and ovarian cancer risk, has been implicated in risk for UM (Sinilnikova et al., 1999; Iscovich et al., 2002; Scott et al., 2002; Hearle et al., 2003b; Liede et al., 2004), with estimated risk between 0 and 4.8% in males (Liede et al., 2004). The CM gene CDKN2A has also been implicated in predisposition to UM, with a single case of a pathogenic mutation in a UM patient with family history of CM (Kannengiesser et al., 2003). Eight of our families were also tested for CDKN2A, CDKN2B and CDK4, Table 1. One of them, FUM011, showed a variant of uncertain significance that is predicted benign (Abdel-Rahman et al., 2011b). There has been one case report associating TP53 with UM (Jay and McCartney, 1993), but the specific mutation was not identified. In addition, linkage studies have also identified a locus at 9q21.32 that may segregate with the UM phenotype (Jonsson et al., 2005; Bishop et al., 2009).

In conclusion, the overall frequency of BAP1 mutation in FUM is estimated at 22%, although this can vary between 8% and 50% depending on additional family history of CM, MMe, and/or RCC. While BAP1 is the most frequent known genetic cause of FUM, it is likely that other genes exist. Future research should focus on FUM families to identify novel cancer predisposition syndromes and genes.

Supplementary Material

Supplemental File

Acknowledgments

The authors thank Peter G. Hovland, MD, PhD, Mary E. Aronow, MD, and other providers for referring patients to the study. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health, National Cancer Institute, or National Eye Institute.

Supported by: Patti Blow Research Fund in Ophthalmology; Grant sponsor: American Cancer Society, Grant number: #IRG-67-003-47; Grant sponsors: Ohio Lions Eye Research Foundation, Ocular Melanoma Foundation, Melanoma Know More Foundation; Grant sponsor: National Cancer Institute (PI: Abdel-Rahman, MH), Grant number: R21CA191943; Grant sponsor: National Eye Institute; Grant number: K08EY022672 (to C.M.C.).

References

  1. Abdel-Rahman MH, Pilarski R, Ezzat S, Sexton J, Davidorf FH. Cancer family history characterization in an unselected cohort of 121 patients with uveal melanoma. Fam Cancer. 2010;9:431–438. doi: 10.1007/s10689-010-9328-7. [DOI] [PubMed] [Google Scholar]
  2. Abdel-Rahman MH, Pilarski R, Cebulla CM, Massengill JB, Christopher BN, Boru G, Hovland P, Davidorf FH. Germline BAP1 mutation predisposes to uveal melanoma, lung adenocarcinoma, meningioma, and other cancers. J Med Genet. 2011a;48:856–859. doi: 10.1136/jmedgenet-2011-100156. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Abdel-Rahman MH, Pilarski R, Massengill JB, Christopher BN, Noss R, Davidorf FH. Melanoma candidate genes CDKN2A/p16/INK4A, p14ARF, and CDK4 sequencing in patients with uveal melanoma with relative high-risk for hereditary cancer predisposition. Melanoma Res. 2011b;21:175–179. doi: 10.1097/CMR.0b013e328343eca2. [DOI] [PubMed] [Google Scholar]
  4. Aoude LG, Wadt K, Bojesen A, Cruger D, Borg A, Trent JM, Brown KM, Gerdes AM, Jonsson G, Hayward NK. A BAP1 mutation in a Danish family predisposes to uveal melanoma and other cancers. PLoS One. 2013;8:e72144. doi: 10.1371/journal.pone.0072144. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Barker-Griffith A, Streeten B. Familial uveal melanoma: A report of four cases in two families and literature review. Can J Ophthalmol. 2004;39:403–408. doi: 10.1016/s0008-4182(04)80012-7. [DOI] [PubMed] [Google Scholar]
  6. Bergman L, Nilsson B, Ragnarsson-Olding B, Seregard S. Uveal melanoma: A study on incidence of additional cancers in the Swedish population. Invest Ophthalmol Vis Sci. 2006;47:72–77. doi: 10.1167/iovs.05-0884. [DOI] [PubMed] [Google Scholar]
  7. Bishop DT, Demenais F, Iles MM, Harland M, Taylor JC, Corda E, Randerson-Moor J, Aitken JF, Avril MF, Azizi E, Bakker B, Bianchi-Scarra G, Bressac-de Paillerets B, Calista D, Cannon-Albright LA, Chin AWT, Debniak T, Galore-Haskel G, Ghiorzo P, Gut I, Hansson J, Hocevar M, Hoiom V, Hopper JL, Ingvar C, Kanetsky PA, Kefford RF, Landi MT, Lang J, Lubinski J, Mackie R, Malvehy J, Mann GJ, Martin NG, Montgomery GW, van Nieuwpoort FA, Novakovic S, Olsson H, Puig S, Weiss M, van Workum W, Zelenika D, Brown KM, Goldstein AM, Gillanders EM, Boland A, Galan P, Elder DE, Gruis NA, Hayward NK, Lathrop GM, Barrett JH, Bishop JA. Genome-wide association study identifies three loci associated with melanoma risk. Nat Genet. 2009;41:920–925. doi: 10.1038/ng.411. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Canning CR, Hungerford J. Familial uveal melanoma. Br J Ophthalmol. 1988;72:241–243. doi: 10.1136/bjo.72.4.241. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Carbone M, Flores EG, Emi M, Johnson TA, Tsunoda T, Behner D, Hoffman H, Hesdorffer M, Nasu M, Napolitano A, Powers A, Minaai M, Baumann F, Bryant-Greenwood P, Lauk O, Kirschner MB, Weder W, Opitz I, Pass HI, Gaudino G, Pastorino S, Yang H. Combined genetic and genealogic studies uncover a large BAP1 cancer syndrome kindred tracing back nine generations to a common ancestor from the 1700s. PLoS Genet. 2015;11:e1005633. doi: 10.1371/journal.pgen.1005633. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Cebulla CM, Binkley EM, Pilarski R, Massengill JB, Rai K, Liebner DA, Marino MJ, Singh AD, Abdel-Rahman MH. Analysis of BAP1 germline gene mutation in young uveal melanoma patients. Ophthalmic Genet. 2015:1–6. doi: 10.3109/13816810.2015.1010734. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Cheung M, Talarchek J, Schindeler K, Saraiva E, Penney LS, Ludman M, Testa JR. Further evidence for germline BAP1 mutations predisposing to melanoma and malignant mesothelioma. Cancer Genet. 2013;206:206–210. doi: 10.1016/j.cancergen.2013.05.018. [DOI] [PubMed] [Google Scholar]
  12. Diener-West M, Reynolds SM, Agugliaro DJ, Caldwell R, Cumming K, Earle JD, Hawkins BS, Hayman JA, Jaiyesimi I, Kirkwood JM, Koh WJ, Robertson DM, Shaw JM, Straatsma BR, Thoma J. Second primary cancers after enrollment in the COMS trials for treatment of choroidal melanoma: COMS Report No. 25. Arch Ophthalmol. 2005a;123:601–604. doi: 10.1001/archopht.123.5.601. [DOI] [PubMed] [Google Scholar]
  13. Diener-West M, Reynolds SM, Agugliaro DJ, Caldwell R, Cumming K, Earle JD, Hawkins BS, Hayman JA, Jaiyesimi I, Kirkwood JM, Wui-Jin K, Robertson DM, Shaw JM, Straatsma BR, Thoma J. Second primary cancers after enrollment in the COMS trials for treatment of choroidal melanoma. Arch Ophthalmol. 2005b;123:604–604. doi: 10.1001/archopht.123.5.601. [DOI] [PubMed] [Google Scholar]
  14. Green GJ, Hong WK, Everett JR, Bhutani R, Amick RM. Familial intraocular malignant melanoma: A case report. Cancer. 1978;41:2481–2483. doi: 10.1002/1097-0142(197806)41:6<2481::aid-cncr2820410658>3.0.co;2-b. [DOI] [PubMed] [Google Scholar]
  15. Gupta MP, Lane AM, DeAngelis MM, Mayne K, Crabtree M, Gragoudas ES, Kim IK. Clinical characteristics of uveal melanoma in patients with germline BAP1 mutations. JAMA Ophthalmol. 2015;133:881–887. doi: 10.1001/jamaophthalmol.2015.1119. [DOI] [PubMed] [Google Scholar]
  16. Harbour JW, Onken MD, Roberson ED, Duan S, Cao L, Worley LA, Council ML, Matatall KA, Helms C, Bowcock AM. Frequent mutation of BAP1 in metastasizing uveal melanomas. Science. 2010;330:1410–1413. doi: 10.1126/science.1194472. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Harvey EB, Brinton LA. Second cancer following cancer of the breast in Connecticut, 1935–82. Natl Cancer Inst Monogr. 1985;68:99–112. [PubMed] [Google Scholar]
  18. Hearle N, Damato BE, Humphreys J, Wixey J, Green H, Stone J, Easton DF, Houlston RS. Contribution of germline mutations in BRCA2, P16(INK4A), P14(ARF) and P15 to uveal melanoma. Invest Ophthalmol Vis Sci. 2003a;44:458–462. doi: 10.1167/iovs.02-0026. [DOI] [PubMed] [Google Scholar]
  19. Hearle N, Damato BE, Humphreys J, Wixey J, Green H, Stone J, Easton DF, Houlston RS. Contribution of germline mutations in BRCA2, p16INK4A, p14ARF and p15to uveal melanoma. Invest Opthalmol Vis Sci. 2003b;44:458. doi: 10.1167/iovs.02-0026. [DOI] [PubMed] [Google Scholar]
  20. Hemminki K, Jiang Y. Association of ocular melanoma with breast cancer but not with cutaneous melanoma: Results from the Swedish family-cancer database. Int J Cancer. 2001;94:907–909. doi: 10.1002/ijc.1542. [DOI] [PubMed] [Google Scholar]
  21. Henkind P, Roth MS. Breast carcinoma and concurrent uveal melanoma. Am J Ophthalmol. 1971;71:198–203. doi: 10.1016/0002-9394(71)90390-4. [DOI] [PubMed] [Google Scholar]
  22. Hoiom V, Edsgard D, Helgadottir H, Eriksson H, All-Ericsson C, Tuominen R, Ivanova I, Lundeberg J, Emanuelsson O, Hansson J. Hereditary uveal melanoma: A report of a germline mutation in BAP1. Genes Chromosomes Cancer. 2013;52:378–384. doi: 10.1002/gcc.22035. [DOI] [PubMed] [Google Scholar]
  23. Iscovich J, Abdulrazik M, Cour C, Fischbein A, Pe’er J, Goldgar DE. Prevalence of the BRCA2 6174 del T mutation in Israeli uveal melanoma patients. Int J Cancer. 2002;98:42–44. doi: 10.1002/ijc.10155. [DOI] [PubMed] [Google Scholar]
  24. Jay M, McCartney ACE. Familial malignant melanoma of the uvea and p53: A Victorian detective story. Surv Ophthalmol. 1993;37:457–462. doi: 10.1016/0039-6257(93)90142-t. [DOI] [PubMed] [Google Scholar]
  25. Jonsson G, Bendahl PO, Sandberg T, Kurbasic A, Staaf J, Sunde L, Cruger DG, Ingvar C, Olsson H, Borg A. Mapping of a novel ocular and cutaneous malignant melanoma susceptibility locus to chromosome 9q21.32. J Natl Cancer Inst. 2005;97:1377–1382. doi: 10.1093/jnci/dji280. [DOI] [PubMed] [Google Scholar]
  26. Kannengiesser C, Avril MF, Spatz A, Laud K, Lenoir GM, Bressac-de-Paillerets B. CDKN2A as a uveal and cutaneous melanoma susceptibility gene. Genes Chromosomes Cancer. 2003;38:265–268. doi: 10.1002/gcc.10286. [DOI] [PubMed] [Google Scholar]
  27. Kodjikian L, Nguyen K, Lumbroso L, Gauthier-Villars M, Chauvel P, Plauchu H, Sterkers M, Devouassoux M, Grange J. Familial uveal melanoma: A report on two families and a review of the literature. Acta Ophthalmol. Scand. 2003;81:389–395. doi: 10.1034/j.1600-0420.2003.00081.x. [DOI] [PubMed] [Google Scholar]
  28. Krygier G, Lombardo K, Vargas C, Alvez I, Costa R, Ros M, Echenique M, Navarro V, Delgado L, Viola A, Muse I. Familial uveal melanoma: Report on three sibling cases. Br J Ophthalmol. 2001;85:1007–1008. doi: 10.1136/bjo.85.8.1007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Liede A, Karlan BY, Narod SA. Cancer risks for male carriers of germline mutations in BRCA1 or BRCA2: A review of the literature. J Clin Oncol. 2004;22:735–742. doi: 10.1200/JCO.2004.05.055. [DOI] [PubMed] [Google Scholar]
  30. Lynch HT, Anderson DE, Krush AJ. Heredity and intraocular malignant melanoma: Study of two families and review of forty-five cases. Cancer. 1968;21:119–125. doi: 10.1002/1097-0142(196801)21:1<119::aid-cncr2820210118>3.0.co;2-w. [DOI] [PubMed] [Google Scholar]
  31. Maerker DA, Zeschnigk M, Nelles J, Lohmann DR, Worm K, Bosserhoff AK, Krupar R, Jagle H. BAP1 germline mutation in two first grade family members with uveal melanoma. Br J Ophthalmol. 2014;98:224–227. doi: 10.1136/bjophthalmol-2013-303814. [DOI] [PubMed] [Google Scholar]
  32. Njauw CN, Kim I, Piris A, Gabree M, Taylor M, Lane AM, DeAngelis MM, Gragoudas E, Duncan LM, Tsao H. Germline BAP1 inactivation is preferentially associated with metastatic ocular melanoma and cutaneous-ocular melanoma families. PLoS One. 2012;7:e35295. doi: 10.1371/journal.pone.0035295. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Oosterhuis JA, Went LN, Lynch HT. Primary choroidal and cutaneous melanomas, bilateral choroidal melanomas, and familial occurrence of melanomas. Br J Ophthalmol. 1982;66:230–233. doi: 10.1136/bjo.66.4.230. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Pilarski R, Cebulla CM, Massengill JB, Rai K, Rich T, Strong L, McGillivray B, Asrat MJ, Davidorf FH, Abdel-Rahman MH. Expanding the clinical phenotype of hereditary BAP1 cancer predisposition syndrome, reporting three new cases. Genes Chromosomes Cancer. 2014;53:177–182. doi: 10.1002/gcc.22129. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Popova T, Hebert L, Jacquemin V, Gad S, Caux-Moncoutier V, Dubois-d’Enghien C, Richaudeau B, Renaudin X, Sellers J, Nicolas A, Sastre-Garau X, Desjardins L, Gyapay G, Raynal V, Sinilnikova OM, Andrieu N, Manie E, de Pauw A, Gesta P, Bonadona V, Maugard CM, Penet C, Avril MF, Barillot E, Cabaret O, Delattre O, Richard S, Caron O, Benfodda M, Hu HH, Soufir N, Bressac-de Paillerets B, Stoppa-Lyonnet D, Stern MH. Germline BAP1 mutations predispose to renal cell carcinomas. Am J Hum Genet. 2013;92:974–980. doi: 10.1016/j.ajhg.2013.04.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Rai K, Pilarski R, Cebulla CM, Abdel-Rahman MH. Comprehensive review of BAP1 tumor predisposition syndrome with report of two new cases. Clin Genet. 2016;89:285–294. doi: 10.1111/cge.12630. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Rednam KRV, Jampol LM, Levine RA, Goldberg MF. Uveal melanoma in assication with multiple malignancies. Retina. 1981;1:100–106. doi: 10.1097/00006982-198101020-00005. [DOI] [PubMed] [Google Scholar]
  38. Scott RJ, Vajdic CM, Armstrong BK, Ainsworth CJ, Meldrum CJ, Aitken JF, Kricker A. BRCA2 mutations in a population-based series of patients with ocular melanoma. Int J Cancer. 2002;102:188–191. doi: 10.1002/ijc.10693. [DOI] [PubMed] [Google Scholar]
  39. Singh AD, Croce CM, Wary KK, Shields JA, Donoso LA, Shields CL, Huebner K, Ohta M. Familial uveal melanoma: Absence of germline mutations involving the cyclin-dependent-kinase-4 inhibitor gene (p16) Ophthalmic Genet. 1996a;17:39–40. doi: 10.3109/13816819609057868. [DOI] [PubMed] [Google Scholar]
  40. Singh AD, Shields CL, De Potter P, Shields JA, Trock B, Cater J, Pastore D. Familial uveal melanoma: Clinical observations on 56 patients. Arch Ophthalmol. 1996b;114:392–399. doi: 10.1001/archopht.1996.01100130388005. [DOI] [PubMed] [Google Scholar]
  41. Singh AD, Wang MX, Donoso LA, Shields CL, De Potter P, Shields JA, Elston RC, Fijal B. Familial uveal melanoma, III: Is the occurrence of familial uveal melanoma coincidental? Arch Ophthalmol. 1996c;114:1101–1104. doi: 10.1001/archopht.1996.01100140303008. [DOI] [PubMed] [Google Scholar]
  42. Singh AD, Demirci H, Shields CL, Shields JA, Smith AF. Concurrent choroidal melanoma in son and father. Am J Ophthalmol. 2000;130:679–680. doi: 10.1016/s0002-9394(00)00612-7. [DOI] [PubMed] [Google Scholar]
  43. Singh AD, Turell ME, Topham AK. Uveal melanoma: Trends in incidence, treatment, and survival. Ophthalmology. 2011;118:1881–1885. doi: 10.1016/j.ophtha.2011.01.040. [DOI] [PubMed] [Google Scholar]
  44. Sinilnikova OM, Egan KM, Quinn JL, Boutrand L, Lenoir GM, Stoppa-Lyonnet D, Desjardins L, Levy C, Goldgar D, Gragoudas ES. Germline brca2 sequence variants in patients with ocular melanoma. Int J Cancer. 1999;82:325–328. doi: 10.1002/(sici)1097-0215(19990730)82:3<325::aid-ijc3>3.0.co;2-g. [DOI] [PubMed] [Google Scholar]
  45. Smith JH, Padnick-Silver L, Newlin A, Rhodes K, Rubinstein WS. Genetic study of familial uveal melanoma: Association of uveal and cutaneous melanoma with cutaneous and ocular nevi. Ophthalmology. 2007;114:774–779. doi: 10.1016/j.ophtha.2006.08.041. [DOI] [PubMed] [Google Scholar]
  46. Soufir N, Bressac-de Paillerets B, Desjardins L, Levy C, Bombled J, Gorin I, Schlienger P, Stoppa-Lyonnet D. Individuals with presumably hereditary uveal melanoma do not harbour germline mutations in the coding regions of either the P16INK4A, P14ARF or cdk4 genes. Br J Cancer. 2000;84:818–822. doi: 10.1054/bjoc.1999.1005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Soufir N, Lacapere JJ, Bertrand G, Matichard E, Meziani R, Mirebeau D, Descamps V, Gerard B, Archimbaud A, Ollivaud L, Bouscarat F, Baccard M, Lanternier G, Saiag P, Lebbe C, Basset-Seguin N, Crickx B, Cave H, Grandchamp B. Germline mutations of the INK4a-ARF gene in patients with suspected genetic predisposition to melanoma. Br J Cancer. 2004;90:503–509. doi: 10.1038/sj.bjc.6601503. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Testa JR, Cheung M, Pei J, Below JE, Tan Y, Sementino E, Cox NJ, Dogan AU, Pass HI, Trusa S, Hesdorffer M, Nasu M, Powers A, Rivera Z, Comertpay S, Tanji M, Gaudino G, Yang H, Carbone M. Germline BAP1 mutations predispose to malignant mesothelioma. Nat Genet. 2011;43:1022–1025. doi: 10.1038/ng.912. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Turunen JA, Markkinen S, Wilska R, Saarinen S, Raivio V, Tall M, Lehesjoki AE, Kivela TT. BAP1 germline mutations in finnish patients with uveal melanoma. Ophthalmology. 2016;123:1112–1117. doi: 10.1016/j.ophtha.2016.01.008. [DOI] [PubMed] [Google Scholar]
  50. van Hees CLM, Jager MJ, Bleeker JC, Kemme H, Bergman W. Occurence of cutaneous and uveal melanoma in patients with uveal melanoma and their first degree relatives. Melanoma Res. 1998;8:175–180. doi: 10.1097/00008390-199804000-00013. [DOI] [PubMed] [Google Scholar]
  51. Wadt K, Choi J, Chung JY, Kiilgaard J, Heegaard S, Drzewiecki KT, Trent JM, Hewitt SM, Hayward NK, Gerdes AM, Brown KM. A cryptic BAP1 splice mutation in a family with uveal and cutaneous melanoma, and paraganglioma. Pigment Cell Melanoma Res. 2012;25:815–818. doi: 10.1111/pcmr.12006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Wadt KA, Aoude LG, Johansson P, Solinas A, Pritchard A, Crainic O, Andersen MT, Kiilgaard JF, Heegaard S, Sunde L, Federspiel B, Madore J, Thompson JF, McCarthy SW, Goodwin A, Tsao H, Jonsson G, Busam K, Gupta R, Trent JM, Gerdes AM, Brown KM, Scolyer RA, Hayward NK. A recurrent germline BAP1 mutation and extension of the BAP1 tumor predisposition spectrum to include basal cell carcinoma. Clin Genet. 2015;88:267–272. doi: 10.1111/cge.12501. [DOI] [PubMed] [Google Scholar]
  53. Wang X, Egan KM, Gragoudas ES, Kelsey KT. Constitutional alterations in p16 in patients with uveal melanoma. Melanoma Res. 1996;6:405–410. doi: 10.1097/00008390-199612000-00001. [DOI] [PubMed] [Google Scholar]
  54. Wiesner T, Obenauf AC, Murali R, Fried I, Griewank KG, Ulz P, Windpassinger C, Wackernagel W, Loy S, Wolf I, Viale A, Lash AE, Pirun M, Socci ND, Rutten A, Palmedo G, Abramson D, Offit K, Ott A, Becker JC, Cerroni L, Kutzner H, Bastian BC, Speicher MR. Germline mutations in BAP1 predispose to melanocytic tumors. Nat Genet. 2011;43:1018–1021. doi: 10.1038/ng.910. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Young LH, Egan KM, Walsh SM, Gragoudas ES. Familial uveal melanoma. Am J Ophthalmol. 1994;117:516–520. doi: 10.1016/s0002-9394(14)70014-5. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental File
NIHMS831390-supplement-Supplemental_File.xlsx (29.6KB, xlsx)

RESOURCES