Molecular and Biochemical Characterization of Cotton Epicuticular Wax in Defense Against Cotton Leaf Curl Disease

Abstract

Background

Gossypium arboreumis resistant to Cotton leaf curl Burewala virus and its cognate Cotton leaf curl Multan beta satellite (CLCuBuV and CLCuMB). However, the G. arboreum wax deficient mutant (GaWM3) is susceptible to CLCuV. Therefore, epicuticular wax was characterized both quantitatively and qualitatively for its role as physical barrier against whitefly mediated viral transmission and co-related with the titer of each viral component (DNA-A, alphasatellite and betasatellite) in plants.

Objectives

The hypothesis was the CLCuV titer in cotton is dependent on the amount of wax laid down on plant surface and the wax composition.

Results

Analysis of the presence of viral genes, namely alphasatellite, betasatellite and DNA-A, via real-time PCR in cotton species indicated that these genes are detectable in G. hirsutum, G. harknessii and GaWM3, whereas no particle was detected in G. arboreum. Quantitative wax analysis revealed that G. arboreum contained 183 μg.cm^-2 as compared to GaWM3 with only 95 μg.cm^-2. G. hirsutum and G. harknessii had 130 μg.cm^-2 and 146 μg.cm^-2, respectively. The GCMS results depicted that Lanceol, cis was 45% in G. harknessii. Heptadecanoic acid was dominant in G. arboreum with 25.6%. GaWM3 had 18% 1,2,-Benenedicarboxylic acid. G. hirsutum contained 25% diisooctyl ester. The whitefly feeding assay with Nile Blue dye showed no color in whiteflies gut fed on G. arboreum. In contrast, color was observed in the rest of whiteflies.

Conclusions

From results, it was concluded that reduced quantity as well as absence of (1) 3-trifluoroacetoxytetradecane, (2) 2-piperidinone,n-|4-bromo-n-butyl|, (3) 4-heptafluorobutyroxypentadecane, (4) Silane, trichlorodocosyl-, (5) 6- Octadecenoic acid, methyl ester, and (6) Heptadecanoicacid,16-methyl-,methyl ester in wax could make plants susceptible to CLCuV, infested by whiteflies.

1. Background

Plant viruses are major hindrance in yield improvement and productivity of plant products. Viruses that belong to family Geminiviridae, are economically important and transmitted by the members of the phylum Arthropoda (1).

Cotton plants are naturally affected by many stresses from which 75% are biotic (2). Among these pathogens, Cotton leaf curl virus (CLCuV and its cognate CLCuBuV and CLCuMB) is a common source of tension for cotton growers especially in Pakistan. CLCuV genome consists of a single stranded DNA particle i.e. DNA-A along with each of its associated DNA satellites, called alpha satellite and beta satellite (3).

The first and foremost physical barrier in plant pathogen interaction is epicuticular wax (4). This layer not only hinders the bacteria and fungi, but also create a first line of defense against insects (5). For instance, in wax deficient pea mutants the aphid spends more time (6). Wax can be defined as a polyester matrix of hydroxyl- and hydroxyl epoxy fatty acids C₁₆ and C₁₈ long (cutin) embedded and overlaid with epicuticular wax.

The Asiatic G. arboreum is resistant to CLCuV (7). Our hypothesis was to investigate that whether the wax plays a critical barrier in transmission of CLCuV by whitefly (Bemisia tabaci) in this plant. In 2009, a wax deficient mutant (GaWM3) of Asiatic G. arboreum with 50% less wax was produced (8).

2. Objectives

The aims of the present study was (1) to quantify the cuticular waxes and determine the biochemical composition of wax mutant GaWM3 in comparison with G. arboreum, G. hirsutum and G. harknessii, and (2) to determine the CLCuV titer and its correlation with quantity and composition of waxes through feeding of whiteflies on plants.

3. Materials and Methods

3.1. Plant Materials

Seeds of G. hirsutum less waxy and susceptible to CLCuV, G. arboreum, “desicotton” resistant to CLCuV with more epicuticular wax, G. harknessii, more waxy like and susceptible to CLCuV were planted along with wax deficient mutant of G. arboreum (GaWM3) in pots as well as in field. Upward or downward curling of the leaves, thickened veins and growth of plants was noted in inoculated and non-inoculated plants as indicated by Khan et al. (9).

3.2. CLCuV Titer Evaluation

Viruliferous whiteflies (100) were incubated overplants. Field trials have been conducted under natural infection condition with uncharacterized CLCuV isolates. However, it was found that CLCuBV was more dominant in the field than CLCuMB Primers were designed for alpha satellite (FR873751.1), beta satellite (HF567946.1) and DNA-A (X98995.1). The primers and probe (5'Fam and 3'Tamra) were designed from coat protein of DNA-A, C1 region of beta-satelliteand Rep gene of alpha-satellite (Table 1) using “Genscript” website software (https://www.genscript.com/ssl-bin/app/primer). The experiment was performed in 3 replicates. The reaction mixture (25 μL) contained 150 μg of plant DNA, 2.5 μL 10× PCR buffer (Fermentas, USA), 2.5 μL of 2 mM dNTPs, 1.5 μL of MgCl₂ (Fermentas, USA) 1 mL of 10 pmol.μL^-1 each forward and reverse primers (Table 1) and 0.5 μL of 5U Taq DNA-polymerase (Fermentas, USA). The PCR was initiated at 95ºC for 5 min, followed by 35 cycles of 95ºC for 30 s, 59ºC for 30 s, and 72ºC for 30 sec with final extension at 72ºC for 10 min. The concentrations of the viral particles were calculated through Real Time-PCR using standard curve through known standards of DNA-A, alpha satellites and beta satellites.

Table 1. Designing of primers and probe to detect DNA-A, alphasatellite and betasatellite .

DNA-A: Amplicon size 182 bp Tm: 55°C
CP-F CP-R CP-P	5'AAACAACAGGCATGGACAAA'3, 5'CCGACACCACGAGTAACATC '3 Fam-5'TGGGCCTTCACAACCCTTTGG '3-Tamra
Alphasatellite:Amplicon size 192 bp: 55°C
Alpha Rep-F Alpha Rep-R Alpha Rep-P	5'GTCTTCCGACGAGTTAAGGC '3 5'GTCTCTGGCAAAGGTGGATT '3 Fam-5'AACGGGACCCAGATGACCGC '3-Tamra
Betasatellite: Amplicon size 186 bp: 55°C
BetaC1-F BetaC1-R BetaC1-P	5'TTCCTATTCGCATACAACGG '3 5'ATGCATTGCTGGTTTGTGTT '3 Fam-5'ACGGTTCGATTACATCCATTCCCAA'3-Tamra

3.3. Wax Quantification

The isolation of plant epicuticular wax was performed according to “Decoction” method (10) and leaf surface area was calculated with Adobe Photoshop (11). The total isolated wax from each plant was converted into μg and divided by total leaf surface area (in cm²).

$$\text{Wax per unit area =}\frac{\text{Weight of wax (μg)}}{{\text{Total leaf surface area (cm}}^{\text{2}}\text{)}}$$

3.4. Determination of Biochemical Composition of Epicuticular Wax

Gas chromatograph mass spectrometry: wax samples (1 μg) in 3 replicates were dissolved in hexane and passed through impregnated carbon filter to remove any impurities. Internal standard, tetracosane (10 μg.mL^-1) was added to the testing samples prior to analysis. From the wax samples, 2 μL was taken and injected into the column at 50ºC and condition was held for 2 min. The samples were desorbed by increasing the temperature by 40°C.min^-1 to 200°C, 2 min at 200°C, 3°C.min^-1 to 310°C, and 30 min at 310°C. The Helium gas was used as the carrier and the gas flow was maintained at 2 mL.min^-1. The quantitative composition of the mixtures was studied by capillary GC (Agilent; 30 m HP-1, 0.32-mm i.d. df = 1 μm) and flame ionization detection under the same GC conditions as above but Helium (carrier gas) inlet pressure was programmed for 50 kPa at injection, held for 5 min, raised with 3 kPa.min^-1 to 150 kPa and held for 40 min at 150 kPa. Single compounds were quantified against the internal standard by manually integrating peak areas (12). Components were identified by the help of NIST library, 2005 (13).

3.5. Whitefly Feeding Assay

Two week old seedling of plants (i.e. G. arboreum, GaWM3, G. hirsutumand G. harknessii) were placed into Hoagland’s solution (14) with 1% Nile Blue (Sigma Aldrich, USA). The whiteflies (Bemisia tabaci) were incubated on plants for 3 days and observed under microscope (Zeiss, Imager A1) to observe the color of Nile Blue dye in their gut.

4. Results

4.1. Detection of CLCuV

Symptoms: The plants were exposed to whiteflies in random in field trials and 100 whiteflies per plant were incubated in greenhouse tests. The symptoms of cotton leaf curl disease appeared on G. hirsutum, G. harknessii and GaWM3 but not on G. arboreum. The typical symptoms of upward or downward curling of the leaves and thick enation were appeared on G. hirsutum and GaWM3 (Figure 1). The CLCuV components (alpha satellite, beta satellite and DNA-A) were quantified by real time PCR. The mean numbers of molecules per microliter of alpha satellite in betweengreenhouse and field samples were 5.9×10⁸, 4.8×10⁷and 4.6×10⁷for G. hirsutum, GaWM3 and G. harknessii, respectively. Whereas no alpha satellite was detected in G. arboreum (Figure 2A). Beta satellites were determined as 7.2×10⁸, 3.6×10⁷and 3.8×10⁷ molecules.μL^-1 in G. hirsutum, GaWM3 and G. harknessii, respectively. Similarly, beta satellite was not detected in G. arboreum (Figure 2B). The copy numbers of DNA-A in G. hirsutum, GaWM3 and G. harknessii were 8.7×10⁸, 6.6×10⁷and 6.3×10⁷ molecules.μL^-1, respectively. Again, DNA-A was not detected in G. arboreum (Figure 2C). In experimental plants, G. hirsutum: GaWM3: G. harknessii: G. arboreum, the ratio of a-satellite was 270:24:23:0 for alpha satellite, for beta satellite was 360:18:19:0, and for DNA-A was 290:22:21:0, respectively.

Figure 1 .

Symptoms on experimental plants after incubation of whiteflies A: severe symptoms were observed in G. hirsutum B: GaWM3 showed mild symptoms of upward curling C: mild symptoms of downward curling were also observed in G. harknessii D: no symptoms were observed on G. arboretum leaves

Figure 2 .

Real Time PCR to determine viral titer A: molecules. μL^-1 of b-satellite was maximum in G. hirsutum, while it was not detectable in G. arboreum. B: molecules.μL^-1 of β-satellite was maximum in G. hirsutum, while it was not detectable in G. arboreum C: molecules.μL^-1 of DNA-A was maximum in G. hirsutum, while it was not detectable in G. arboreum whereas the error bars represent the variation among 3 replicates

4.2. Epicuticular Wax per Unit Area

Maximum wax per unit area was obtained from G. arboreum (183 μg.cm^-2) as compared to its mutant that had 95 μg.cm^-2. In contrast, G. hirsutum and G. harknessii had130 μg.cm^-2 and 146 μg.cm^-2, respectively.

4.3. Biochemical Composition of Epicuticular Wax

Gas chromatograph mass spectrometry of plants (G. arboreum, GaWM3, G. hirsutum and G. harknessii (Figure 3A- D, respectively) was carried out to determine the biochemical composition of wax and their quantitative values. The chemical compounds were identified by comparing their retention time in the NIST mass spectra library, 2005 (13).

Figure 3 .

GC-MS TIC (total ion current trace) analysis for the compounds present in isolated wax of A: G. arboreum. B: GaWM3 C: G. hirsutum D: G. harknessii. Compounds were identified on the basis of the retention time through NIST library

The top 3 compounds that were dominant in G. arboreumare suspected to be (1) 25.6%heptadecanoicacid, 16-methyl-, methyl ester (2) 14.1% phenol, 2,5-bis [1,1- dimethyl] and (3) 10.12% 1,2-benzenedicarboxylic acid, diisooctyl ester. The dominant compounds in wax of GaWM3 were suspepcted to be (1) 18%1,2,- benenedicarboxylic acid, diisooctyl ester (2) 14% octadecane, 1-|2-(hexadecyloxy)ethoxy|- (3) 12%7,9-Di-tet-butyl-1-oxaspiro (4,5) deca-6, 9-diene-2,8-dione and (4) 11% nonadecane having percentage. The three major compounds found in the wax of G. hirsutumwere (1) 25% 1,2-benzenedicarboxlic acid, diisooctylester (2) 21% nonadecane and (3)14% phenol, 2,5-bis (1,1-dimethyletyhly)- with percentage of, Lanceol, cis- and caryophyllene were the two major wax compounds found in G. harknessii, having the percentage of 45% and 36%, respectively. Comparison of wax biochemical composition of experimental plants is shown in (Table 2).

Table 2. Comparison of chemical compounds present in experimental plants .

Sr. No	Biochemical Compounds	G. arboreum	GaWM3	G. hirsutum	G. harknessii
1	2-cyclopentene-1-ol, 1-phenyl-	+	-	+	-
2	Nonadecane	+	+	+	-
3	3-trifluoroacetoxytetradecane	+	-	-	-
4	Phenol, 2,5-bis [1,1-dimethyl]	+	+	+	-
5	Methoxyacetic acid, 2-tridecylester	+	+	-	-
6	2-piperidinone, n-[4-bromo-n-butyl]	+	-	-	-
7	4-heptafluorobutyroxypentadecane	+	-	-	-
8	Tetradecane, 2,6,10-trimethyl-	+	+	+	-
9	Silane, trichlorodocosyl-	+	-	-	-
10	6-Octadecenoic acid, methyl ester	+	-	-	-
11	Heptadecanoic acid, 16-methyl-, methyl ester	+	-	-	-
12	1,2-Benzenedicarboxylic acid, diisooctyl ester	+	+	+	-
13	Caryophyllene	-	+	-	+
14	a-Caryophyllene	-	+	-	+
15	Hexadecane	-	+	-	-
16	Eicosane, 2-methyl-	-	+	-	-
17	Diethyl phthalate	-	+	-	-
18	7,9-Di-tet-butyl-1-oxaspiro[4,5] deca -6, 9-diene-2,8-dione	-	+	-	-
19	Ethanol, 2-[octadecyloxy]	-	+	-	-
20	A-D-Glucopyranoside, methyl-2-[acetylamino]-2-deoxy-3-O-[trimethylsillyl]-,cyclic methyl bronate	-	+	-	-
21	Octadecane, 1-|2-[hexadecyloxy]ethoxy|-	-	+	-	-
22	15,17,19,21- Hexatriacontatetrayne	-	+	-	-
23	|5-[3-methoxymethoxy-10,13-dimethyl-2,3,4,9,10,11,13,14,15,16,17-dodecahydro-1Hcyclopenta|a|[phenanthren-17-yl]-hex-1-ynul|-trime	-	+	-	-
24	2-Trifluoroacetoxyteradecane	-	-	+	-
25	Trichloroacetic acid, hexadecylester	-	-	+	-
26	P-Xylenolpthalein	-	-	+	-
27	Lanceol, cis-	-	-	-	+
28	Napthalene,1,2,3,4,4a,5,6,8a-octahydro-7-methyl-4-4methylene-1-[1-methylethyl],[1a,4ab,8aa]-	-	-	-	+
29	2,6,10-dodecatriene-1-ol,3,7,11-tromethyl-acetate,[E,E]- 2,6,10- dodecatriene-1-ol,3,7,11-tromethyl-acetate,[E,E]-	-	-	-	+
30	2-napthalenemethanol,decahydro-α, α, 4a-trimethyl-8-methylene- ,|2R-[2α,4aα,8aβ]|-	-	-	-	+

4.4. Whiteflies Feeding Assay

Collected whiteflies on G. arboreum, similar to the negative control did not show any gut coloring (Figure 4 A,B), while on the other 3 plants, gut color was observed (Figure 4C-D).

Figure 4 .

Whiteflies feeding assay. Whiteflies under light microscope when fed on nile blue containing experimental plants A: negative control B: G. arboreum C: GaWM3 D: G. harknessii E: G. hirsutum. Dye was observed in the gut of whiteflies fed on G. hirsutum, G. harknessii and GaWM3 whereas no color was observed in negative control and the whiteflies fed on G. arboreum

5. Discussion

Here, a cotton wax mutant (GaWM3) next to 3 other wild type cotton species were analyzed to establish the role of wax in resistance against insects. The plant having less wax is more susceptible to insects, G. arboreum wax deficient mutant (GaWM3) was found susceptible to CLCuV (Figure 2) as opposed to the wild type (7).

The concentration of the isolated waxes were 183, 146, 130 and 95 μg.cm^-2 in G. arboreum, G. harknessii, G. hirsutum and GaWM3, respectively. The concentration of the wax was in accordance with the report of Bondada et al. (15) i.e. from 70 μg.cm^-2 to 154 μg.cm^-2 from normal condition to stress conditions in cotton.

The results of virus symptoms appearance were in accordance with (16) and (17). The role of beta satellite is well-defined in suppressing the phyto-immune system that ultimately results in development of severe viral symptoms (18,19). Our data support this hypothesis that increase in quantity of beta satellite results in increase of symptoms and vice versa. The positive correlation was found in the severity of the symptoms and titer of beta satellite particles along with DNA-A (Figure 1).

The ratio of different organic compounds varies in the epicuticular wax. Hydrocarbons, alcohols and acids were the major compounds found in the wax of red vine (Brunnichia ovata) and trumpet creeper plants (Campsis radicans) (20). In addition to these classes of compounds, esters, phenols and other aromatic compounds were also found in this study. The most dominant compounds were esters in G. arboreum, GaWM3 and G. hirsutum (25.6%, 18% and 25%, respectively) and lanceol, cis (45%) was dominant in G. harknessii.

The comparison of wax components of GaWM3 and G. arboreum clearly demonstrated that the following six organic compounds were only present in G. arboreum: 3-trifluoro acetoxy tetra decane, 2-piperidinone, n-[4-bromo-n-butyl], 4-heptafluorobutyroxypentadecane, silane, trichlorodocosyl-, 6-octadecenoic acid, methyl ester, and heptadecanoic acid, 16-methyl-, methyl ester,may create unique features in its wax and may be involved in its resistance against transmission of CLCuV (Table 2). The whitefly feeding assay also suggested that the quantity as well as quality of the wax has its role in feeding of whiteflies (Figure 4).

6. Conclusions

The characterization of cotton epicuticular wax and its role in transmition of CLCuV by whiteflies to plants were demonstrated. It was found that 50% reduction in wax (in leaves of GaWM3) made it possible for the whiteflies to transmit the virus and to develop the relevant symptoms. It is concluded that wax act like barrier in hindering the CLCuV transmission in cotton. Moreover, quantities as well as chemical composition of wax had impacts on feeding behavior in whiteflies and transmission of CLCuV.