Skip to main content
Iranian Journal of Biotechnology logoLink to Iranian Journal of Biotechnology
. 2015 Dec;13(4):17–24. doi: 10.15171/ijb.1175

An Alternative Bacterial Expression System Using Bacillus pumilus SG2 Chitinase Promoter

Kambiz Morabbi Heravi 1, Garshasb Rigi 2, Maryam Rezaei Arjomand 3, Amin Rostami 3, Gholamreza Ahmadian 3,*
PMCID: PMC5492237  PMID: 28959305

Abstract

Background

Chitin is an abundant natural polysaccharide found in fungi, algae, and exoskeleton of insects. Several bacterial species are capable of utilizing chitin as their carbon source. These bacteria produce chitinases for degradation of chitin into N-acetyl-D-glucosamine. So far, regulation of the chitinase encoding genes has been studied in different bacterial species. Among Bacillus species, B. pumilus strain SG2 encodes two chitinases, ChiS and ChiL. The promoter region of chiSL genes (PchiS) is mainly regulated by the general carbon catabolite repression (CCR) system in B. subtilis due to the presence of a catabolite responsive element (cre).

Objectives

Use of PchiS in constructing an inducible expression system in B. subtilis was investigated.

Materials and Methods

In the first step, complete and shortened versions of PchiS were inserted upstream of the lacZ on a pBS72/pUC18 shuttle plasmid. The β-galactosidase activity of B. subtilis carrying one of the relevant plasmids was measured in the presence of different carbon sources.

Results

An expression system based on the chitinase promoter of B. pumilus SG2 was established. Modification of PchiS and the culture medium resulted in production of β-galactosidase in B. subtilis up to 1,800 Miller unit (MU) activity.

Conclusions

The chitinase promoter developed in this study, has potential to be used in an expression vector that could be induced by chitin. In addition, compared to the other inducers like IPTG and lactose, chitin is definitely cheaper and more available as an inducer.

Keywords: Carbon catabolite repression, Chitin, Induction, N-acetylglucoseamine , Regulation

1. Background

Chitin (C8H13O5N)n is the second most abundant natural polysaccharide composed of N-acetyl-D-glucosamine (GlcNAc) monomers. Chitin is found in many species including outer skeleton of crustaceans, insects, and as a component of fungi and algae cell walls (1-4). Chitinases (EC.3.2.1.14) are hydrolases able to degrade chitin into GlcNAc. There are endo- and exo-chitinases that degrade chitin as a substrate (2). Different organisms including bacteria, protozoa, fungi, and plants produce chitinases (1, 5, 6). These enzymes have several biological roles in different organisms. For instance, these enzymes are produced to provide carbon and nitrogen sources in bacteria (2, 3, 5, 6).

Generally, heterotrophic bacteria utilize glucose as a preferred carbon source. Meanwhile, in the presence of glucose, transcription of many genes that use other carbon sources are repressed in a mechanism called carbon catabolite repression (CCR) (7, 8). Most of reported chitinase encoding genes are also regulated by CCR. In Streptomyces plicatus, characterization of the promoter region of two chitinase genes, namely chi63 and chi35, showed their induction by chitin and repression in the presence of glucose (9, 10). Several other chitinase genes including chiA and chiC of Streptomyces lividans and chiA, chiB, chiC, chiD and chiF of Streptomyces coelicolor A3 (5) are similarly regulated by chitin and glucose. In Bacillus subtilis, most of the genes or operons that are under the control of CCR have a cis-acting catabolite responsive element (cre) (7, 11-14). This cre site (WTGNAANCGNWNNCW) located within, upstream or downstream of a promoter region and interact with a trans-acting complex, carbon catabolite protein A (CcpA) and HPr (S46~P) complex. CcpA is a DNA binding protein that belongs to LacI/GalR transcriptional regulators, which is able to repress or activate the transcription of genes depending on the location of cre site at the target promoter (11, 14-16). HPr is a histidine containing protein that forms a complex with CcpA, when it is phosphorylated at its serine residue number 46 (17).

B. pumilus strain SG2 is a halophilic and chitinolytic bacterium that produces two chitinases, ChiS and ChiL (18, 19). The expression of chiSL genes is induced by chitin as a sole carbon source, while it is repressed in the presence of glucose. In other words, B. pumilus SG2 chitinase encoding genes is controlled by carbon catabolite repression (CCR) (20). In the current study, activity of PchiS from B. pumilus SG2 was evaluated on a low copy plasmid in B.subtilis in order to investigate the possibility of construction of an expression system.

2. Materials and Methods

2.1. Strains, Media and Growth Condition

All strains are listed in (Table 1). The original genes and promoter are from B. pumilus SG2 strain which was isolated from high salt ecosystem, but cloning and experimental works were carried out in a standard B. subtilis called 3NA as explained in (Table 1). Escherichia coli JM109 was used for plasmid propagation. LB-agar supplemented with ampicillin (100 μg.mL-1), chloramphenicol (5 μg.mL-1), or spectinomycin (100 μg.mL-1) were used for selection of E. coli and B. subtilis 3NA transformants. Minimal medium (MI) for transformation of B. subtilis was prepared by mixing 97.5 mL of Spizizen’s minimal salts containing 2 g.L-1 (NH4)2SO4, 14 g.L-1 K2HPO4, 6 g.L-1KH2PO4, 1 g.L-1Na3C6H5O7.2H2O, 0.2 g.L-1MgSO4.7H2O, 5 g.L-1 glucose, supplemented with 0.02% (w/v) casamino acids, and 5 mM MgSO4 (21).

Table 1. Primers, plasmids and strains were used in this study .

Name Description Reference
Oligonucleotides
ChiSLF10
ChiSR1J
UP-CRE1
UP-CRE2
s5767
s5768

Plasmids
pDHAFB
pSUN279.2
pUP-Chi2
pUP-Chi2Δcresig
pUP-Chi2Δcre
pChi1
pChi2
pChi3

Strains
E. coli
JM109


B. subtilis
3NA
Chi7
Chi8
Chi9

GGGCCCGGGTCATCAAGACGCAGATGTC
GGGGCATGCGAGCCCACTCTCTCTTTA
TATGAAAACTAGAAATGTTGTTGTCTTCAGTGC
GCACTGAAGACAACAACATTTCTAGTTTTCATATGC
AAAGCTAGCTCATCAAGACGCAGATGTC
AAACTTAAGCCCCTTTTCATTAATTTTT


bla, amyE::[cat, lacI, Pspac]
oripBS72, oripUC18, ter-PmanR-manR-PmanP-lacZ, spcR
bla, amyE::[PchiS-chiS, cat]
bla, amyE::[PchiSΔcresig-chiS, cat]
bla, amyE::[PchiSΔcre-chiS, cat]
oripBS72, oripUC18, ter-PchiS-lacZ, spcR
oripBS72, oripUC18, ter-PchiSΔcre-lacZ, spcR
oripBS72, oripUC18, ter--PchiSΔcresig-lacZ, spcR



recA1, endA1, gyrA96, thi-1, hsdR17(rK-, mk+), mcrA,
supE44, gyrA96, relA1, λ-, Δ(lac-proAB), F' (traD36,
proAB+, lacIq, (ΔlacZ)M15)

spo0A3
spo0A3 amyE::[PchiSΔcresig-chiS, cat]
spo0A3 amyE::[PchiSΔcresig-chiS, cat]
spo0A3 amyE::[PchiSΔcresig-chiS, cat]

(20)
(20)
This study
This study
This study
This study


(22)
(36)
(20)
(20)
This study
This study
This study
This study



(37)



(38)
pUP-Chi2Δcresig →3NA pChi1
pUP-Chi2Δcresig →3NA pChi2
pUP-Chi2Δcresig →3NA pChi3

Induction of strain 3NA containing pChi1, pChi2 or pChi3 was carried out using LB medium. LB medium (85 mL) in a 500 mL Erlenmeyer flask was inoculated by 1.7 mL of the overnight culture and incubated at 37°C with 200 rpm shake. Cells were grown to an optical density of 0.4 at 600 nm. Aliquots of 8 mL were divided in 100 mL Erlenmeyer flasks and induced with 0.2% (w/v) inducers, i.e. chitin, chitin+glucose, N-acetylglucosamine (GlcNAc), GlcNAc+glucose or without any inducer as the negative control. Colloidal chitin was prepared as described (18). Samples were collected 1 h after the addition of carbohydrates.

Minimal medium (96.5 mL of MI medium (without glucose) + 0.02% v/v glycerol) was used to study the β-galactosidase activity of prepared strains, namely 3NA pChi1, 3NA pChi2, 3NA pChi3, Chi7, Chi8 and Chi9. The inducers were 0.2% (w/v) chitin + 0.2% v/v glycerol, 0.2% (w/v) chitin + 0.2% (w/v) glucose, 0.2% (w/v) glucose, and 0.2% (v/v) glycerol. Sample collection was performed at 2 h intervals until 11 h after the induction. All experiments were performed three times and mean values were used for comparison.

2.2. Construction of Expression Plasmids and Strains

Plasmids and oligonucleotide primers are listed in (Table 1). Construction of pUP-Chi2Δcre was carried out using overlapping PCR to fuse the chitinases promoter to the coding region of β-galactosidase gene. PCR1 was performed using ChiSLF10 and UP-CRE2 primer pairs and plasmid pUPChi2 as a template. PCR2 was performed using primers (ChiSR1J and UP-CRE1) and plasmid pUPChi2 as a template. PCR3 was performed using primers (ChiSLF10 and ChiSR1J) and 20 ng of each PCR1 and PCR2 amplicons as templates. The final PCR product was inserted into pDHAFB via Cfr9I and SphI restriction sites. The final cassette was integrated into the amyE locus of B. subtilis chromosome to have a constitutive expression of chitinase. Using this method, the a-amylase encoding gene was inactivated and the transformants were selected based on their chloramphenicol resistance (22). In order to create pChi1, pChi2 and pChi3 constructions, promoter of chitinase gene of B. pumilus SG2 was amplified in a PCR using s5767 and s5768 oligonucleotides and pUP-Chi2, pUP-Chi2Dcre, and pUP-Chi2Dcresig as the templates. The amplified fragment was inserted into a derivative of the theta replicating pBS72 plasmid (pSUN279.2), which is a low copy number plasmid in B. subtilis, upstream of the lacZ as the reporter gene using NheI (NEB) and AflII (NEB) restriction enzymes (Figure 1). The pSUN279.2 has also a pUC18 origin of replication for plasmid propagation in E. coli.

Figure 1 .


Figure 1

The plasmid maps of pSUN279.2 used as the parental vector and its derivative pChi1. The PchiS DNA sequence was inserted into pSUN279.1 via NheI and AflII restriction sites

To integrate the PchiSDcresig-chiS cassette into the chromosome of B. subtilis 3NA, plasmid pUP-Chi2Dcresig was used containing an amyE integration cassette. In this way, strain 3NA containing pChi1, pChi2 or pChi3 was transformed to create Chi7, Chi8, and Chi9, respectively.

2.3. Enzyme Activity

Production of α-amylase was detected by the addition of iodine solution (0.5% iodine in 1% potassium iodide solution) in nutrient agar containing 1% (w/v) starch (23), while production of chitinase was detected using MI agar plates containing 0.5% (w/v) chitin and 0.001% (v/v) Congo Red (24). β-galactosidase activity was measured y using o-nitrophenyl-D-galactopyranoside (ONPG) as substrate according to Miller assay (25) and the result was given as Miller unit (MU). T-test statistical analysis was used to demonstrate the significance and reliability of the quantitative results.

3. Results

3.1. Activity of the Chitinase Promoter on a pBS72 Derivative in B. subtilis

Regulation of PchiS and its derivative PchiSDcresig has been already investigated in B. subtilis using an integrated PchiS-lacZ cassette (20). To develop a new gene expression system for B. subtilis, PchiS was inserted upstream of lacZ, as a reporter gene, on pSUN279. Plasmid pSUN279 is an E. coli (oripUC18)-B. subtilis (oripBS72) stable low copy number shuttle vector in B. subtilis. Transformation of B. subtilis 3NA with pChi1 (PchiS) was followed by induction of the transformed mutants in LB in the presence of chitin or GlcNAc with (out) glucose. Measurement of the β-galactosidase activity of the 3NA pChi1 strain showed low amount of the β-galactosidase activity up to 18 MU after 1 h of induction in LB. Since there was not a significant difference in the β-galactosidase activity with chitin or GlcNAc as an inducer compared to the uninduced culture, it was concluded that the expression from the PchiS promoter was constitutive (Figure 2). In contrast, the addition of glucose reduced β-galactosidase activity of 3NA pChi1 by 2.6- and 2.5-fold in the presence of chitin and GlcNAc, respectively (Figure 2). In order to investigate the effect of the cre site on the activity of PchiS, two shortened versions of PchiS, namely PchiSDcre and PchiSDcresig, were inserted upstream of lacZ. The PchiSDcre lacked only the cre site, whereas PchiSDcresig had an additional deletion upstream of the cre site (for the exact promoter sequence see Heravi, Shali (20)). Like 3NA pChi1, the β-galactosidase activities of strains 3NA pChi2 (PchiSDcre) and 3NA pChi3 (PchiSDcresig) were measured. The results revealed that the deletion of the cre site increased the activity in all culture conditions (Figure 2). Unlike 3NA pChi1, in both 3NA pChi2 and 3NA pChi3, PchiS was constitutive. As expected, glucose had no effect on the production of β-galactosidase and the level of enzyme was significantly increased up to 67 MU in 3NA pChi2 and 3NA pChi3. Likewise, no drastic difference was observed between the β-galactosidase activity of 3NA pChi2 and 3NA pChi3 (Figure 2). Altogether, the results indicated that PchiSDcre and PchiSDcresig had higher activities than PchiS. In between, only PchiS was regulated by glucose.

Figure 2 .


Figure 2

β-galactosidase activity of the B. subtilis strains 3NA pChi1 (A), 3NA pChi2 (B) and 3NA pChi3 (C) in LB medium with chitin (0.2%) or GlcNAc (0.2%) alone or together with glucose (0.2%). As the control, no additional carbohydrate was added to the medium (uninduced). The β- galactosidase measurements were carried out 1 h after the addition of carbohydrates. The experiment was performed three times and mean values and standard deviations (error bar) are shown

3.2. Strain and Media Optimization for the Activity of PchiS and its Derivatives

Since the β-galactosidase activities of strains 3NA pChi1, 3NA pChi2 and 3NA pChi3 were too low in LB, MI medium containing glycerol was used with the addition of different carbohydrates (glycerol, glucose and chitin). The β-galactosidase activity of each strain was measured with 2 h intervals up to 11 h (Figure 3A-C ). Comparing to LB medium, the results indicated an increase in β-galactosidase activity. Moreover, the β-galactosidase activity of each construct was similar in different conditions, showing that the PchiS and its derivatives were constitutive in minimal medium with the defined composition. The higher β-galactosidase activities were obtained for 3NA pChi2 and 3NA pChi3 after 11 h of induction with about 800-1,100 MU.

Figure 3 .


Figure 3

β-galactosidase activity of the strains A: 3NA pChi1, B: 3NA pChi2, C: 3NA pChi3, D: Chi7, E: Chi8 and F: Chi9 in the minimal MI medium containing 0.02% glycerol. Different carbohydrates, i.e. chitin, glucose and glycerol (0.2%), were added to the culture media. β-galactosidase activity was measured 3, 5, 7, 9 and 11 h after induction. All the experiments were performed three times and mean values and standard deviations (error bar) are shown

Plasmid pUP-Chi2Dcresig with the PchiSDcresig-chiS cassette was integrated into the genome of strain 3NA pChi1, 3NA pChi2 and 3NA pChi3 at amyE locus. The newly constructed strains Chi7, Chi8 and Chi9 were able to degrade chitin and use it as carbon source. The integration of PchiSDcresig-chiS into the amyE gene was confirmed using starch agar (Figure 4A-F). As a result, strains 3NA pChi1, 3NA pChi2 and 3NA pChi3 showed a halo around their colonies resulted by starch degradation (negative controls; Figure 4A-C), whereas strains Chi7, Chi8 and Chi9 showed no amylase activity and therefore, they showed no halo around the colonies (Figure 4D-F). Likewise, expression of chitinase was confirmed using chitinase-Congo Red agar. The production of clear halos around the colonies of Chi7, Chi8 and Chi9 showed the chitinase activity compared to strains 3NA pChi1, 3NA pChi2 and 3NA pChi3 (Figure 4A' -F').

Figure 4 .


Figure 4

Production of α-amylase was detected on the starch agar (A-F), while chitinase production was tested on the chitin-Congo Red agar (A′-F′). Strains 3NA pChi1 (A), 3NA pChi2 (B), 3NA pChi3 (C), Chi7 (D), Chi8 (E) and Chi9 (F) were streaked on the agar plates. Production of clear halos around the colonies was tested after 48 h of incubation at 37ºC.

Given that chitinase breaks the chitin branches increasing the amount of GlcNAc as carbon source, the activity of PchiS in strain Chi7 with the addition of different carbohydrates was investigated with 2 h interval up to 11 h (Figure 3D). Strain Chi7 showed identical activity with different carbon sources similar to 3NA pChi1. Overall, the β-galactosidase activity of Chi7 was 2- to 3-fold higher than 3NA pChi1. Additionally, the activities of PchiSΔcre and PchiSΔcresig from strains Chi8 and Chi9 in the same growth condition were measured. The β-galactosidase activities of both Chi8 and Chi9 in different carbohydrate sources were similar and greater than Chi7 (Figure 3D -4F). Comparison of Chi8 and Chi9 with their parental strains 3NA pChi2 and 3NA indicated that the integration of chiS enhanced the β-galactosidase activity in Chi9 (Figure 3B-F). Furthermore, the β-galactosidase activity of Chi9 was slightly increased in the presence of glycerol and chitin glycerol compared to chitin with (out) glucose reaching up to 1,800 MU (Figure 3F). Overall, the β-galactosidase activity was significantly increased by changing the medium to a defined medium. Moreover, the PchiS and its derivatives showed constitutive activity in the minimal medium.

4. Discussion

Since chitin is an abundant polysaccharide in nature, it can be used as a cheap carbon source in growth media. Nevertheless, the genome of B. subtilis 3NA which was used to analyse the promoter in this study, contains no chitinase encoding gene to secret into the surrounding environment and sense the chitin and degrade it, the chitinase gene of B. pumilus SG2 plus its upstream promoter was inserted into the genome of this standard B. subtilis. promoter. Therefore, Chitinase encoding genes of B. pumilus SG2 are expressed by two promoters with a cre site in between. The activity of this promoter region is inducible by chitin and repressible by glucose in B. pumilus SG2, while the promoter activity is only repressible by glucose in B. subtilis (20). In the present study, the activity of chitinase promoter was investigated on a low copy plasmid using lacZ (encodes β-galactosidase), as a reporter gene. In addition to the wild type PchiS, two deletions were carried out in the cis-regulatory element of the PchiS to test the possible effect of these deletions on the promoter activity.

Firstly, LB medium was used as the basal medium, which resulted in a weak activity of the wild type promoter in B. subtilis (max. 18 MU). Deletion of the cre site and its flanking region increased the activity slightly although the level of lacZ expression was low and constitutive (approx. 70 MU). This could be due to the shortened untranslated region of the lacZ mRNA on pChi2 and pChi3. Similarly, shortening of the untranslated region of lacZ mRNA expressed by PmtlA increased the β-galactosidase activity in the B. subtilis host strain (26). Replacing the LB medium with M9 medium led to weak growth of the strains (data not shown). Hence, MI minimal medium containing casamino acids was utilized as the basal media for the chitinases producing strains. In the latter medium, stronger activity of the chitinase promoter was observed. Comparison of the different growth conditions with the negative control showed that the activities of these promoters neither can be regulated nor was strong in B. subtilis. Besides, catabolite repression was not observed in the presence of glucose in minimal medium. Integration of the chitinase had increased the β-galactosidase activity in the presence of chitin and chitin + glucose in strain Chi7 compared with Chi1 as well as Chi3 compared with Chi9. B. subtilis contains no chitin degradation system (27, 28); however, it has only an N-acetylglucosamine utilization system (29). Therefore, the over-produced chitinase could provide further N-acetylglucosamine for the growth of the cells. Nevertheless, the increase of the β-galactosidase activity in the absence of chitin remains unclear.

In current study, B. subtilis selected as a host organism for recombinant protein expression. B. subtilis has significant potential for production of industrial enzyme including proteases, α-amylase and lipases (30). Using B. subtilis as an expression system has several advantages. The genome of this species has been sequenced. In addition, B. subtilis classified as a GRAS organism and without production of any harmful exotoxins or endotoxins. In addition, it could naturally secret recombinant proteins into the extracellular medium, which facilitate purification stage. Despite these benefits, using B. subtilis has several drawbacks including lack of suitable expression vectors (31-33). Until now several expression systems have been developed in B. subtilis. Among these expression systems are the starch-inducible amylase promoter, xylose-inducible xylA promoter, Pglv promoter, prophage-derived heat-inducible gene expression systems and B. subtilis expression system involving the mannose operon (34). In addition E. coli lac repressor-based expression system has been developed for B. subtilis that could produce very high levels of recombinant proteins after induction using IPTG (30, 34, 35).

The chitinase promoter developed in this study, has potential to be used in an expression vector that could be induced by chitin. In addition, compared to the other inducers like IPTG and lactose, chitin is definitely cheaper and more available as an inducer.

Acknowledgments

Authors would like to thank Dr. J. Altenbuchner (Institut für Industrielle Genetik, Universität Stuttgart) for his suggestions throughout the study. Funding for the project was provided by the Iran National Science Foundation (Project no. 90004656).

References

  • 1.Tsujibo H, Kubota T, Yamamoto M, Miyamoto K, Inamori Y. Characterization of chitinase genes from an alkaliphilic actinomycete, Nocardiopsis prasina OPC-131. Appl Environ Microbiol. 2003;69(2):894–900. doi: 10.1128/AEM.69.2.894-900.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Swiontek M, Brzezinska WD. Occurrence and Activity of the Chitinolytic Bacteria of Aeromonas Genus. Pol J Environ Stud. 2001;10(1):27–31. [Google Scholar]
  • 3.Nisa Rachmania Mubarik IM. Chitinolytic Bacteria Isolated from Chili Rhizosphere: Chitinase Characterization and Its Application as Biocontrol for Whitefly (Bemisia tabaci Genn) Am J Agr Biol Sci. 2010;5(4):430–435. doi: 10.3844/ajabssp.2010.430.435. [DOI] [Google Scholar]
  • 4.Li H, Greene LH. Sequence and structural analysis of the chitinase insertion domain reveals two conserved motifs involved in chitin-binding. PLOS One. 2010;5(1):0008654. doi: 10.1371/journal.pone.0008654. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Patil RS, Ghormade VV, Deshpande MV. Chitinolytic enzymes: an exploration. Enzyme Microb Technol. 2000;26(7):473–483. doi: 10.1016/S0141-0229(00)00134-4. [DOI] [PubMed] [Google Scholar]
  • 6.Zhu XF, Zhou Y, Feng JL. Analysis of both chitinase and chitosanase produced by Sphingomonas sp CJ-5. J Zhejiang Univ Sci B. 2007;8(11):831–838. doi: 10.1631/jzus.2007.B0831. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Singh KD, Schmalisch MH, Stulke J, Gorke B. Carbon catabolite repression in Bacillus subtilis: quantitative analysis of repression exerted by different carbon sources. J Bacteriol. 2008;190(21):7275–7284. doi: 10.1128/JB.00848-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Luesink EJ, van Herpen RE, Grossiord BP, Kuipers OP, de Vos WM. Transcriptional activation of the glycolytic las operon and catabolite repression of the gal operon in Lactococcus lactis are mediated by the catabolite control protein CcpA. Mol Microbiol. 1998;30(4):789–798. doi: 10.1046/j.1365-2958.1998.01111.x. [DOI] [PubMed] [Google Scholar]
  • 9.Delic I, Robbins P, Westpheling J. Direct repeat sequences are implicated in the regulation of two Streptomyces chitinase promoters that are subject to carbon catabolite control. Proc Natl Acad Sci USA. 1992;89(5):1885–1889. doi: 10.1073/pnas.89.5.1885. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Fujii T, Miyashita K, Ohtomo R, Saito A. DNA-binding protein involved in the regulation of chitinase production in Streptomyces lividans. Biosci Biotechnol Biochem. 2005;69(4):790–799. doi: 10.1271/bbb.69.790. [DOI] [PubMed] [Google Scholar]
  • 11.Kim JH, Yang YK, Chambliss GH. Evidence that Bacillus catabolite control protein CcpA interacts with RNA polymerase to inhibit transcription. Mol Microbiol. 2005;56(1):155–162. doi: 10.1111/j.1365-2958.2005.04496.x. [DOI] [PubMed] [Google Scholar]
  • 12.Deutscher J, Francke C, Postma PW. How phosphotransferase system-related protein phosphorylation regulates carbohydrate metabolism in bacteria. Microbiol Mol Biol Rev. 2006;70(4):939–1031. doi: 10.1128/MMBR.00024-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Fujita Y. Carbon catabolite control of the metabolic network in Bacillus subtilis. Biosci Biotechnol Biochem. 2009;73(2):245–259. doi: 10.1271/bbb.80479. [DOI] [PubMed] [Google Scholar]
  • 14.Hueck CJ, Hillen W. Catabolite repression in Bacillus subtilis: a global regulatory mechanism for the gram-positive bacteria? Mol Microbiol. 1995;15(3):395–401. doi: 10.1111/j.1365-2958.1995.tb02252.x. [DOI] [PubMed] [Google Scholar]
  • 15.Zalieckas JM, Wray LV, Jr Jr, Fisher SH. Expression of the Bacillus subtilis acsA gene: position and sequence context affect cre-mediated carbon catabolite repression. J Bacteriol. 1998;180(24):6649–6654. doi: 10.1128/jb.180.24.6649-6654.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Henkin TM. The role of CcpA transcriptional regulator in carbon metabolism in Bacillus subtilis. FEMS Microbiol Lett. 1996;135(1):9–15. doi: 10.1111/j.1574-6968.1996.tb07959.x. [DOI] [PubMed] [Google Scholar]
  • 17.Deutscher J, Reizer J, Fischer C, Galinier A, Saier MH, Jr Jr, Steinmetz M. Loss of protein kinase-catalyzed phosphorylation of HPr, a phosphocarrier protein of the phosphotransferase system, by mutation of the ptsH gene confers catabolite repression resistance to several catabolic genes of Bacillus subtilis. J Bacteriol. 1994;176(11):3336–3344. doi: 10.1128/jb.176.11.3336-3344.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Ahmadian G, Degrassi G, Venturi V, Zeigler DR, Soudi M, Zanguinejad P. Bacillus pumilus SG2 isolated from saline conditions produces and secretes two chitinases. J Appl Microbiol. 2007;103(4):1081–1089. doi: 10.1111/j.1365-2672.2007.03340.x. [DOI] [PubMed] [Google Scholar]
  • 19.Vahed M, Motalebi E, Rigi G, Akbari Noghabi K, Soudi MR, Sadeghi M, Ahmadian G. Improving the Chitinolytic Activity of Bacillus pumilus SG2 by Random Mutagenesis. J Microbiol Biotechnol. 2013;23(11):1519–1528. doi: 10.4014/jmb.1301.01048. [DOI] [PubMed] [Google Scholar]
  • 20.Heravi KM, Shali A, Naghibzadeh N, Ahmadian G. Characterization of cis-acting elements residing in the chitinase promoter of Bacillus pumilus SG2. World J Microbiol Biotechnol. 2013:1–9. doi: 10.1007/s11274-013-1569-9. [DOI] [PubMed] [Google Scholar]
  • 21. Harwood C. R. CSM. Plasmids. in Molecular biological methods for Bacillus: John Wiley and Sons, Chichester, England; 1990. p.57-144.
  • 22.Yamamoto H, Mori M, Sekiguchi J. Transcription of genes near the sspE locus of the Bacillus subtilis genome. Microbiology (Reading, England) 1999;145(Pt8):2171–2180. doi: 10.1099/13500872-145-8-2171. [DOI] [PubMed] [Google Scholar]
  • 23.Fuwa H. A new method for microdetermination of amylase activity by the use of amylose as the substrate. J Biochem. 1954;41(5):583–603. [Google Scholar]
  • 24.Teather RM, Wood PJ. Use of Congo red-polysaccharide interactions in enumeration and characterization of cellulolytic bacteria from the bovine rumen. Appl Environ Microbiol. 1982;43(4):777–780. doi: 10.1128/aem.43.4.777-780.1982. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Miller JH. Experiments in Molecular Genetics: Cold Spring Harbor Laboratory Press; 1972. p. 982.
  • 26.Heravi KM, Wenzel M, Altenbuchner J. Regulation of mtl operon promoter of Bacillus subtilis: Requirements of its use in expression vectors. Microb Cell Fact. 2011;10 doi: 10.1186/1475-2859-10-83. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Kunst F, Ogasawara N, Moszer I, Albertini AM, Alloni G, Azevedo V. et al. The complete genome sequence of the Gram-positive bacterium Bacillus subtilis. Nature. 1997;390(6657):249–256. doi: 10.1038/36786. [DOI] [PubMed] [Google Scholar]
  • 28.Barbe V, Cruveiller S, Kunst F, Lenoble P, Meurice G, Sekowska A, Vallenet D, Wang T, Moszer I, Médigue C, Danchin A. From a consortium sequence to a unified sequence: the Bacillus subtilis 168 reference genome a decade later. Microbiology (Reading, England) 2009;155(Pt 6):1758–1775. doi: 10.1099/mic.0.027839-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Reizer J, Bachem S, Reizer A, Arnaud M, Saier MH, Jr Jr, Stülke J. Novel phosphotransferase system genes revealed by genome analysis - the complete complement of PTS proteins encoded within the genome of Bacillus subtilis. Microbiology (Reading, England) 1999;145(Pt12):3419–3429. doi: 10.1099/00221287-145-12-3419. [DOI] [PubMed] [Google Scholar]
  • 30.Bongers RS, Veening JW, Van Wieringen M, Kuipers OP, Kleerebezem M. Development and characterization of a subtilin-regulated expression system in Bacillus subtilis: strict control of gene expression by addition of subtilin. Appl Environ Microbiol. 2005;71(12):8818–8824. doi: 10.1128/AEM.71.12.8818-8824.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Demain AL, Vaishnav P. Production of recombinant proteins by microbes and higher organisms. Biotechnol Adv. 2009;27(3):297–306. doi: 10.1016/j.biotechadv.2009.01.008. [DOI] [PubMed] [Google Scholar]
  • 32.Lam KH, Chow KC, Wong WK. Construction of an efficient Bacillus subtilis system for extracellular production of heterologous proteins. J Biotechnol. 1998;63(3):167–177. doi: 10.1016/S0168-1656(98)00041-8. [DOI] [PubMed] [Google Scholar]
  • 33.Westers L, Westers H, Quax WJ. Bacillus subtilis as cell factory for pharmaceutical proteins: a biotechnological approach to optimize the host organism. Biochim Biophys Acta. 2004;11:1–3. doi: 10.1016/j.bbamcr.2004.02.011. [DOI] [PubMed] [Google Scholar]
  • 34.Wenzel M, Muller A, Siemann-Herzberg M, Altenbuchner J. Self-inducible Bacillus subtilis expression system for reliable and inexpensive protein production by high-cell-density fermentation. Appl Environ Microbiol. 2011;77(18):6419–6425. doi: 10.1128/AEM.05219-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Ming YM, Wei ZW, Lin CY, Sheng GY. Development of a Bacillus subtilis expression system using the improved Pglv promoter. Microb Cell Fact. 2010;9(55):1475–2859. doi: 10.1186/1475-2859-9-55. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Sun T, Altenbuchner J. Characterization of a mannose utilization system in Bacillus subtilis. J Bacteriol. 2010;192(8):2128–2139. doi: 10.1128/JB.01673-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Yanisch-Perron C, Vieira J, Messing J. Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene. 1985;33(1):103–119. doi: 10.1016/0378-1119(85)90120-9. [DOI] [PubMed] [Google Scholar]
  • 38.Michel JF, Millet J. Physiological studies on early-blocked sporulation mutants of Bacillus subtilis. J Appl Bacteriol. 1970;33(1):220–227. doi: 10.1111/j.1365-2672.1970.tb05246.x. [DOI] [PubMed] [Google Scholar]

Articles from Iranian Journal of Biotechnology are provided here courtesy of Iran National Institute of Genetic Engineering and Biotechnology

RESOURCES