Abstract
Krüppel-like factor 4 (KLF4) is a kind of zinc finger transcription factor, which is involved in terminal differentiation of epithelial cells and reprogramming of somatic cells to induced pluripotent stem (iPS) cells in mammals. In the present study, we identified a full-length cDNA of Klf4 in Zhikong scallop Chamys farreri (Cf-Klf4) and found that Cf-Klf4 presented a sexual dimorphic expression characteristic in C. farreri gonads. Cf-Klf4 expression was significantly higher in testes than in ovaries from growing stage to mature stage detected by quantitative real-time PCR, and was located in male gametes, except for spermatozoa during spermatogenesis through in situ hybridization and immunohistochemistry, while no positive signal was visible in female gametes during oogenesis. Furthermore, the knockdown of Cf-Klf4 in testes by means of in vivo RNA interference led to an obviously developmental retardance, lower gonadosomatic index, less male gametes and more apoptotic spermatocytes. Interestingly, we found that two out of eight scallops showed a hermaphroditic phenotype characteristic of male-to-female sex reversal when the Klf4 mRNA and protein levels were knocked down in males. These results verified that Klf4 plays an important role in testis functional maintenance and is necessary in spermatogenesis of C. farreri.
Introduction
Krüppel-like factor 4 (KLF4), a gut-enriched Krüppel-like factor (GKLF) or epithelial zinc finger (EZF), was firstly identified from the mouse serum-deprivation fibroblast cell cDNA library [1]. It has the highly conversed domains of KLF family, the DNA-binding domains with three classical Cys2/His2 zinc fingers at the C-terminus binding GC-box or CACCC-box of the target DNA [2, 3], and two Krüppel-links, TGEKP(Y/F) X which connect zinc fingers [4]. The distinctions between KLF4 and other KLF members are some functional domains, including transcriptional activation domain, transcriptional repression domain, nuclear localization signal (NLS), and a potential PEST domain in mammals [5, 6]. These specific functional domains enable KLF4 to work as transcription regulators. Segre, et al. [7] and Katz, et al. [8] reported that losing of KLF4 leads to the deficiency of skin barrier and the reduction of goblet cells, indicating its indispensability in epidermal differentiation. During tumorigenesis, KLF4 works as a crucial transcription factor playing distinctive roles, such as in gastrointestinal and lung cancers, as a tumor suppressor, it regulates the expression of cell cycle-related genes [9], induces cell apoptosis [6] or inhibits the activity of telomerase [10]; or as an oncogene, it suppresses the cdh1/skp2/p27 pathway to promote cell proliferation in breast cancer [11, 12]. Moreover, KLF4 is also an important reprogramme factor which can induce some somatic cells to generate the induced pluripotent stem (iPS) cells [13, 14].
Up to now, studies about Klf4 related to sexual development were only reported in mouse and human. Researchers found that Klf4 is strongly expressed in post-meiotic germ cells of mouse and human testes, indicating its role in testicular differentiation in mammals [15–18]. Godmann, et al. [18] found that although lacking of Klf4 in germ cells of mouse testis generated by the Cre-loxP system does not impair spermiogenesis, some genes related in differentiation, proliferation and cell cycle etc. exhibited up- and down-regulated expressions in the mutants, implying its potential function in spermatogenesis.
Bivalve mollusks possess fascinatingly diverse modes of reproduction, including dioecism (e.g., Chlamys farreri), hermaphrodite (e.g., Argopecten irradias) and even sex reversal (Crassostrea gigas), suggesting that bivalves are good animal models for studying sex determination and reproductive regulation [19]. In previous research, some sex-related genes, such as dmrt1, dmrt2, dmrt4, SoxH, foxl2, β-catenin, have been identified in some bivalves, and present sexual dimorphic expression characteristics; while 17β-HSD8 presents similar expression between males and females [19–25]. However, the understanding of particular key genes involving in sex is still very limited. In the present study, we identified a full-length cDNA of Klf4 in the Zhikong scallop C. farreri (Cf-Klf4), which is a dioecism with stable sex composition and important commercial shellfish in Northern China, and revealed that Cf-Klf4 was specifically expressed in germ cells of C. farreri testes. Furthermore, we determined that Cf-Klf4 participated in the regulation of spermatogenesis and maintenance of testis function in C. farreri tested by means of RNA interference (RNAi). Our data provide important clues for better understanding of the molecular mechanism about gametogenesis and sex formation in shellfish.
Materials and methods
Ethics statement
The collection and handling of the scallops were performed in accordance with the Ocean University of China Institutional Animal Care and Use Committee (OUC-IACUC) and the local government. No specific permissions were required for the described studies, and the studies did not involve endangered or protected species.
Animals and sampling
Healthy male and female scallops C. farreri with mean shell height 6.39±0.41 cm were collected from Shazikou Bay (Qingdao, China). Gonads were dissected and weighed for subsequent analysis. Parts of the gonads were immediately frozen in liquid nitrogen and stored at -80°C. The remainders were fixed in 4% paraformaldehyde in 0.01 M phosphate buffered saline (PBS) at 4°C for 20 h, then dehydrated with serial methanol (25%, 50%, 75% and 100%) diluted in 0.01 M PBS and stored in 100% methanol at −20°C.
According to the morphologic characteristics described by Liu, et al. [26] and Liao, et al. [27], the gonads were grouped into four stages based on the histological structure and the gonadosomatic index (GSI = gonad weight/soft tissue body weight×100), the resting stage (GSI = 3.57±0.80 for ovary and 3.73±0.25 for testis), the proliferative stage (GSI = 3.98±0.98 for ovary and 4.07±0.72 for testis), the growing stage (GSI = 6.87±0.62 for ovary and 6.90±0.58 for testis) and the mature stage (GSI = 9.62±1.47 for ovary and 9.76±1.46 for testis).
Histology
Samples were dehydrated in an ascending gradient of ethanol, cleared in xylene and embedded in paraffin wax. Sections (5 μm thick) were fixed to a microscope slide with 0.1% polylysine at 37°C for 10 h. The procedure of histology was followed by the description of Liu, et al. [26]. The sections were observed and photographed using a Nikon E80i microscope (Nikon, Tokyo, Japan).
RNA extraction
Total RNA was extracted from gonads of the four stages using Trizol RNA extraction kit (Invitrogen, CA, USA) according to the manufacturer’s protocol. After removal of contaminant DNA, with DNase I (Takara, Otsu, Japan), purified RNA was quality-checked and quantified with gel electrophoresis and spectrophotometry.
Cloning of target cDNA in C. farreri
The 3’- and 5’- RACE ready first-strand cDNA was synthesized from 1 μg total RNA of adult testis at proliferative stage using SMARTerTM RACE kit (Clontech, CA, USA) according to the manufacturer’s instruction. The specific primers, GSP-F (5’-GTATGCTGGCGTCCTCAGTGAACAGAGC-3’) and GSP-R (5’- GTGTACAGCTACTGGAGTTGTCTGCTGG-3’), were designed according to a 2,301 bp cDNA fragment which was retrieved from C. farreri transcriptome (SRX218546). Nested PCR was conducted using 50× diluted primary PCR product as the template and the nested primers GSNP-F (5’- GTGTACAGCTACTGGAGTTGTCTGCTGG -3’) and GSNP-R (5’- TGAACGCAAGTCAGACAGTCTTC-3’) to clone the 5’ and 3’ regions of Klf4 cDNA, respectively. The PCR products were sequenced and then assembled with SeqMan Pro (DNA STAR, WI, USA).
Sequence analysis
The sequence similarity of KLF4 with those from other species was analyzed using BLAST program at NCBI (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Multiple alignments were analyzed using the CLUSTAL X2 software. A phylogenetic tree was constructed using MEGA 6.0.6 with 1000 bootstrap trials.
Quantitative real-time PCR (qRT-PCR)
qRT-PCR analysis was employed to determine the expression level of Klf4 mRNA in testes and ovaries at different stages. Two specific primers, qPCR-F 5’- GAAAGCGACAGACAAGCCAC-3’ and qPCR-R 5’- GGTAAGTTCATCAGAGCGAGCA-3’ were designed based on the full-length sequence of Klf4 for amplifying a 164 bp gene-specific product, and elongation factor 1 alpha (ef-1α) of C. farreri was used as a reference gene [28]. The amplification was carried out in a total volume of 20 μl using Roche LightCycler 480 Real-Time PCR System (Roche, Basel, Switzerland) and SYBR Green Master Mix (Takara, Dalian, China) following the manufacturer’s instruction. 2-ΔΔCt method was used to analyze the relative expression levels of Cf-Klf4 mRNA. All data were presented as mean ± SEM from five samples with three parallel repetitions, and all qRT-PCR assays were validated in compliance with “the MIQE guidelines” [29].
In situ hybridization (ISH)
A cDNA fragment of 564 bp was amplified with two specific primers, ISH-F 5’-GGCGAATTCGATCACTATGATGTCGTA-3’ and ISH-R 5’-CCGAAGCTTGATGAATTGATGTCAGGA-3’, and DIG-labeled RNA sense and antisense probes of Cf-Klf4 were generated using a DIG RNA labeling Kit (SP6/T7) (Roche, Basel, Switzerland) following the manufacturer’s instruction. DIG-labeled RNA probes of C. farreri foxl2 (Cf-foxl2) were synthesized as described in Liu, et al. [22]. Sections of the gonadal tissues were made following the method in “Histology”. In situ hybridization was performed as described [30], with the modifications that samples were digested for 10 min at 37°C with 2 μg/ml protease K and counterstained with 1% neutral red. The sections were observed and photographed using a Nikon E80i microscope (Nikon, Tokyo, Japan).
Immunohistochemistry
The open reading frame of Cf-Klf4 cDNA was amplified with the sense primer 5‘-GAGCTCATGGATAACGGTTCGTTG -3’ (SacI site underlined) and the antisense primer 5‘-CTCGAGTATGTGGCGTTTCATATG-3’ (XhoI site underlined). The prokaryotic expression and purification of C. farreri KLF4 were performed following protocols as described [25]. The polyclonal antibody of C. farreri KLF4 against New Zealand white rabbits was produced by Sangon Biotech (Shanghai, China). The serum antibody titer was determined by indirect enzyme-linked immunoassay, and the antisera were aliquoted and stored at −80°C.
Total protein was extracted from approximately 100 mg of C. farreri testis at mature stage using total protein extraction kit (CW Biotech, Beijing, China) according to manufacturer’s instruction. Western blot was performed in triplicate for detecting specificity of the Cf-KLF4 antibody and the level of Cf-KLF4 protein as described by Ma, et al. [31]. The polyclonal antibody of Rabbit anti-β-Actin (CW Biotech, Beijing, China) was used as an internal control to calibrate the total extractive proteins. The Cf-KLF4 antibody (anti-KLF4) was diluted as 1:1000 by PBS/Tween-20 plus 5% skimmed milk powder.
Sections of the gonadal tissues were made following the method in “Histology”. Immunohistochemistry was conducted following protocols described by Ma, et al. [31], with the modification that sections were incubated in PBS/Tween-20 plus 5% skimmed milk powder for 1 h. The control group was performed using negative serum, which was extracted before injecting purified recombinant Cf-KLF4 into New Zealand white rabbits, instead of the anti-KLF4. Observation and digital images were taken with a Nikon E80i microscope (Nikon, Tokyo, Japan).
RNAi assay
dsRNA synthesis
The procedure was performed as described by Suzuki, et al. [32] with some modifications. Two primers, RNAi-F 5’-TAATACGACTCACTATAGGGAGACGTGAGCCTCTTGGTGTT-3’ (T7 promoter underlined) and RNAi-R 5’-TAATACGACTCACTATAGGGAGTGCATGAAATGATGCGTAG-3’ (T7 promoter underlined), were designed according to Cf-Klf4 cDNA sequence to amplify a specific fragment (522 bp). PCR products were gel-purified and then transcribed in vitro using the T7 MEGAscript RNAi Kit (Ambion, Austin, USA) to synthesis double-stranded RNA (dsRNA). The dsRNAs were phenol/chloroform-extracted, ethanol-precipitated, and suspended in RNase-free PBS (pH 7.4). Purified RNA was quality-checked and quantified with gel electrophoresis and spectrophotometry.
dsRNA administration and sampling
Healthy male scallops C. farreri with mean shell height 6.25±0.32 cm were purchased from Shazikou Bay (Qingdao, China). Seventy-five male scallops at the proliferative stage were evenly assigned and maintained in three aquaria with 430 L filtered, aerated seawater at 16.1±0.4°C, respectively. Unicellular algae Platymonas helgolandica and Chaetoceros muelleri were fed daily and water was renewed twice a day during the experiment. For each group with twenty-five scallops, 80 μl PBS containing 50 μg Klf4 dsRNA (dsKLF4 group) or 80 μl PBS without dsRNA (PBS group) were injected into the adductor muscle at T0 (initiation of this assay) and T7 (the 7th day), respectively. The PBS and blank (no injection) groups were used as control, respectively. The testes were dissected and weighted at 3 d (five scallops for each group), 10 d (five scallops for each group) and 24 d (eight scallops for each group), respectively. The procedure of sampling was the same as “Animals and sampling”.
Determining the number and composition of germ cells in the follicles of gonads
Gonadal sections from five scallops of each group were made following the method in “Histology”. To inspect the number and composition of germ cells in gonads after RNAi, all the germ cells in the follicles was counted by randomly observing five sights (2500 μm2 for each) in histological sections of gonads and percentage of germ cells at different developmental stages was calculated.
TdT-mediated dUTP Nick-End Labeling (TUNEL)
The TUNEL assay was conducted to determine cell apoptosis in the testes after RNAi using a DeadEndTM Colorimetric TUNEL System Kit (Promega, Madison, USA) following the manufacturer’s instruction. Sections of the testis tissues were made following the method in “Histology”. Observation and digital images were taken with a Nikon E80i microscope (Nikon Co., Tokyo, Japan).
Statistical analysis
All data were presented as means ± SEM. Significant differences between means were tested using one-way analysis of variance (ANOVA) followed by Tukey’s HSD test (SPSS software version 18.0; SPSS Inc., Chicago, USA), and the significant level was set at P<0.05 in all cases.
Results
Sequence analysis of C. farreri Klf4
Two fragments of 1,168 bp and 1,563 bp were cloned from 5’- and 3’- RACE, respectively. The full-length cDNA sequence was 2,610 bp (GenBank accession number: KY045799.1), containing a 1,314-bp open reading frame (ORF) encoding a putative protein of 437 amino acid residues, a 96-bp 5’-untranslated region (UTR) and a 1,202-bp 3’-UTR. Molecular mass of the putative protein was 50.1 kDa and the isoelectric point was 7.68. The deduced amino acid sequence contained three conversed DNA-binding domains and two linkers of KLF family, as well as three putative functional domains of KLF4 (Fig 1A). Furthermore, the deduced amino acid sequence was homologous with other known KLF4s, which was 75% identical to Pinctada fucata, 63% to Paracentrotus lividus and Latimeria chalumnae, and 71% to Salmo salar. Especially, KLF4s from different organisms are highly conserved in their three classical Cys2/His2 zinc fingers and nuclear localization signals by a ClustalX2 alignment (Fig 1A).
Fig 1.
Multiple sequence alignment (a) and phylogenetic analysis (b) among the KLF4 sequences from different species. Identical residues are highlighted in black. The transcriptional activation domain, transcriptional repression domain and nuclear localization signal are in box I to III. The three Cys2His2 type zinc fingers are in box IV, VI and VIII, its linkers are in box V and VII.
The phylogenic tree demonstrated that C. farreri KLF4 clustered primarily with that of mollusca P. fucata, Aplysia californica and P. lividus, successively, and then formed a subcluster with the branch formed by vertebrates, including Homo sapiens, Mus musculus, Gallus gallus, Xenopus tropicalis, D. rerio and so on. (Fig 1B).
Temporal expression of Klf4 in gonads at different stages
qRT-PCR results showed the levels of C. farreri Klf4 mRNA in testes grew significantly (P<0.05) from resting stage to proliferative stage, with a 3.5-fold increasement, and then it kept a relative stable level from the proliferative stage to growing stage and reached the maximum in mature stage, which was 6-fold higher than that in resting stage (P<0.05). However, no significant difference of Cf-Klf4 expression level in ovaries was presented during oogenesis (Fig 2, S1 Table). Moreover except for the resting stage, the Cf-Klf4 mRNA levels were significantly different (P<0.05) between testes and ovaries, which was 1.5-fold, 3-fold and 6-fold higher in the testes than that in the ovaries at the proliferative, growing and mature stage, respectively (Fig 2).
Fig 2. Expression of Cf-Klf4 mRNA in C. farreri gonads at different stages detected by qRT-PCR.
Data are indicated as the mean ± SEM from five independent samples with triplicate. The expression level in the testes at resting stage is set as 1.00 to calibrate the relative levels in gonads at other stages. Different letters indicate significant differences (P < 0.05).
Cyto-location of Cf-Klf4 mRNA and protein during gametogenesis
The cyto-location of C. farreri Klf4 in the testes was different from that in the ovaries during gametogenesis (Figs 3 and 4). In testes, Cf-Klf4 transcripts were visible in all germ cells (Fig 3F–3K), and a similar location of Cf-KLF4 protein was also presented except in spermatozoa (Fig 4B–4G). However, the positive signal in oogonia and oocytes was hardly visible or faint at either mRNA or protein level (Figs 3A–3D and 4J–4M).
Fig 3. Localization of Cf-Klf4 mRNA in gonads of C. farreri demonstrated by in situ hybridization.
Positive signals with an antisense probe are indicated in blue; controls with sense probe are indicated in mature ovary (e) and testis (l). (a)-(e), ovary; (a), resting stage; (b), proliferative stage; (c), growing stage; (d), mature stage. (f)-(l), testis; (f), resting stage; (g), proliferative stage; (h), growing stage; (j), mature stage; (i) and (k), magnified image of (h) and (j), respectively. Og, oogonium; Oc, oocyte; MO, mature oocyte; Sg, spermatogonium; Sc, spermatocyte; St, spermatid; Sz, spermatozoon. Bar, 40 μm for a-e; 20 μm for (h), (j), (l); 10 μm for others.
Fig 4. Localization of Cf-KLF4 protein in gonads of C. farreri demonstrated by immunohistochemistry.
Positive signals with anti-KLF4 are indicated in brown; controls with negative serum are indicated in mature testis (h) and ovary (i). (a), specific test of KLF4 polyclonal antibody shows that only a specific band appears, meaning KLF4 polyclonal antibody is specific. (b)-(h), testis; (b), resting stage; (c), proliferative stage; (d), growing stage; (e), mature stage; (f), (g), magnified image of (e). (i)-(m), ovary; (j), resting stage; (k), proliferative stage; (l), growing stage; (m), mature stage; Og, oogonium; Oc, oocyte; MO, mature oocyte; Sg, spermatogonium; Sc, spermatocyte; St, spermatid; Sz, spermatozoon. Bar, 10 μm for (b), (f); 20 μm for others.
Klf4 knockdown led to a testis developmental retardance in C. farreri
qRT-PCR detected that the Cf-Klf4 transcript level in the testes of dsKLF4 group was significantly decreased (P<0.05), which was only 60% of controls, the PBS or blank group (Fig 5A, S2 Table). Meanwhile, the level of Cf-KLF4 protein in dsKLF4 group was decreased when compared to the PBS and blank groups detected by Western blot (Fig 5B). No significant difference was presented between two control groups (Fig 5).
Fig 5.
Level of the Cf-Klf4 mRNA and Cf-KLF4 protein in C. farreri testes for 72 h post-injection detected by qRT-PCR (a) and Western blot (b). (a) Level of the Cf-Klf4 mRNA detected by qRT-PCR. Data are indicated as the mean ± SEM from five independent samples with triplicate. The expression level in the testes of blank group is set as 1.00 to calibrate the relative levels in testes of other groups. Different letters indicate significant differences (P < 0.05). (b) Level of the Cf-KLF4 protein for 72 h post the second injection detected by Western blot. 1, blank group; 2, PBS group; 3, dsKLF4 group.
We found the phenotype of scallops in the dsKLF4 group presented obvious differences from the PBS and blank groups when Cf-Klf4 mRNA in the male scallops was knockdown for 24 d. In the dsKLF4 scallops, the testes were translucent and wizened, and the size was smaller than that of the control groups (Fig 6A). The GSI of the dsKLF4 scallops (5.77±1.16) was significantly (P<0.05) lower than that of the PBS (7.86±0.44) or the blank scallops (7.97±1.20) (Fig 6B, S3A Table).
Fig 6. Characteristics of C. farreri testes when Cf-Klf4 knockdown for 24 d.
(a), phenotype; (b), GSI (n = 8); (c), Gamete number in testis follicles of a 2500 μm2 area (n = 5, five sights each individual, respectively); (d), percentage of various types of germ cells in a total number of 200 gametes (n = 5, five sights each individual, respectively). Data are means ± SEM. Different letters indicate significant differences (P < 0.05).
Histological examination showed the characteristics of the testis follicles in the dsKLF4 group were obviously different from the control groups at day 24. In the blank and PBS groups, all testes developed to mature stage, and the follicles were filled with spermatogenic cells of different developmental stages, meanwhile spermatozoa were arranged radially with tails pointing towards the center of the follicle (Fig 7D–7E). In the dsKLF4 testes, however, the follicular cavity was obviously empty compared to that of the controls, and only a few male gametes were in the follicle wall (Fig 7F). The quantity of the germ cells in the follicles of dsKLF4 testes was significantly less than that of the control groups (P<0.05). In the 2500 μm2 view of testis sections under microscope, the cell number in the dsKLF4 group was 108.2±32.2, accounting for only 46.8% of the blank group (Fig 6C, S3B Table), while there were no significant differences between PBS group (225.0±41.4) and blank group (237.7±48.2). In addition, the germ cell composition in dsKLF4 testes was obviously different from controls, which was 6%, 19% and 60% of spermatogonia, spermatocytes and spermatozoa, respectively, in dsKLF4 group, compared to 1.6%, ~50% and ~45% of that in PBS and blank groups (Fig 6D, S3C Table).
Fig 7. Histological characteristics of C. farreri testes in RNAi experiment.
(a), testes at the start of experiment; (b), testes at the 10th day of blank group; (c), testes at the 10th day of dsKLF4 group; (d)-(i), testes after RNAi for 24 days. (d), blank group; (e), PBS group; (f), dsKLF4 group; (h), the hermaphroditic gonads in the dsKLF4 group after RNAi for 24 days; (g) and (i), magnified images of (f) and (h), respectively. Sg, spermatogonium; Sc, spermatocyte; St, spermatid; Sz, spermatozoon; Og, oogonium; Oc, oocyte. Bar, 10 μm for (g) and (i); 20 μm for others.
TUNEL detection revealed that most spermatocytes and a few spermatogonia in dsKLF4 testes presented obvious positive signals of apoptosis (Fig 8D), while no obvious signals were visible in spermatids and spermatozoa. In the blank group testes, only several apoptosis cells were detected (Fig 8A).
Fig 8. Cell apoptosis in the testes demonstrated by TUNEL after RNAi for 24 days.
Positive signals are indicated in brown. (a)-(c), blank group; (d)-(f), dsKLF4 group; (g)-(i), the hermaphroditic gonad in the dsKLF4 group; (b), (e), (h), magnified images of the gonads; (c), (f), (i), negative control without terminal deoxynucleotidyl transferase of TUNEL experiment. Sg, spermatogonium; Sc, spermatocyte; St, spermatid; Sz, spermatozoon; Og, oogonium; Oc, oocyte. Bar, 10 μm for (b), (e), (h); 20 μm for others.
Interestingly, we observed two of the eight scallops in the dsKLF4 group presented unique gonadal structure appearing to be hermaphroditic at day 24. In each follicle of testes in these two scallops, the majority of germ cells in the follicular cavity was spermatozoa (approximate 95%, Fig 6D), moreover, oogonium-like and oocyte-like cells instead of spermatogonia and spermatocytes scattered in the follicle wall (Fig 7H). No TUNEL positive signal was detected in these testes (Fig 8G).
We used a C. farreri female-specific gene foxl2 [22] to further identify the types of oogonium-like and oocyte-like cells in the hermaphroditic-like gonad by means of in situ hybridization (Fig 9). Results exhibited that female gametes specific signals were also presented in these cells, which suggested these two scallops were hermaphroditic.
Fig 9. Location of a female-specific gene Cf-foxl2 demonstrated by in situ hybridization in the hermaphroditic gonads of dsKLF4 group.
Positive signals with an antisense probe are indicated in blue. (b), the magnified image of (a). Sz, spermatozoon; Og, oogonium; Oc, oocyte. Bar, 20 μm.
Discussion
In this study, we firstly reported the characteristics of Cf-Klf4 sexual dimorphic expression in C. farreri testes and ovaries, which is different from mammals. Furthermore, the Klf4 knock-down in C. farreri testes led to the retardance of spermatogenesis, even male-to-female sex reversal, indicating its essential roles in spermatogenesis.
Cf-Klf4 presents a characteristic of sexually dimorphic expression in C. farreri during gametogenesis
Up to now, expression of Klf4 in testis and ovary was only studied in human and mouse, which indicated a sexually dimorphic characteristic. In human, the Klf4 expression level is about 2-fold higher in testes than ovaries [16]. In mouse, levels of Klf4 mRNA and protein are also high in testes [15, 33]. Moreover, KLF4 has been reported only in testis, and presented only in post-meiotic germ cells of mouse and human adult testes or postnatal mouse testes [15, 16, 18]. In this study, we presented a sexually dimorphic expression of Klf4 in C. farreri testis and ovary. However, it is obviously different in expression level and cellular localization between the mammals and the scallop. In C. farreri, the level of Cf-Klf4 mRNA in testes was 6–fold higher than that of ovaries at mature stage, and Cf-Klf4 was located in all the male germ cells and hardly visible in C. farreri ovaries (Figs 3A–3E and 4I–4M). Therefore, we hypothesized Klf4 might also involve in spermatogenesis and its role might be different between the mammals and the shellfish.
Cf-Klf4 regulates early spermatogenesis in C. farreri
Godmann, et al. [18] reported that deletion of Klf4 in germ cells does not impair spermiogenesis in the mouse based on histological structure, GSI, fertility and testosterone level in the testes compared with that of the control, although some genes involving in differentiation, proliferation and cell cycle are up- or down-regulated. In the present study, testis development and spermatogenesis were obviously retardanted when Cf-Klf4 mRNA and Cf-KLF4 protein were knocked down in the testes of C. farreri, which were demonstrated with the significantly decreased GSI (P<0.05) (Fig 6B), the empty follicle cavity (Fig 7F), and significantly reduced number of spermatogenic cells in the dsKLF4 testes (P<0.05) (Fig 6C). Therefore, we determined that Cf-Klf4 participates the regulation of spermatogenesis and its role is different between the scallop C. farreri and the mouse M. musculus.
Shields, et al. [1] reported that KLF4 is an important differentiation factor of epithelia and involved in cell cycle regulation. Chen, et al. [34] revealed that induced KLF4 expression is associated with up-regulation of many genes involving in the cell cycle arrest and down-regulation of genes in promoting cell proliferation. Moreover, it has been well-known that during spermatogenesis, spermatogonia differentiate into primary spermatocytes, which subsequently generate the secondary spermatocytes through meiosis I and spermatids through meiosis II. Therefore, proportion of the spermatocytes in follicles is relatively stable in mature testes. Nevertheless, we found in the present study that the proportion of spermatocytes was obviously reduced in the dsKLF4 testes comparing to the blank group (Fig 7C and 7F), and the extent of the reduction gradually increased with the experiment proceeded (Fig 6D). Meanwhile, the proportion of spermatogonia increased in the dsKLF4 group (Fig 6D). Obviously, the knockdown of Cf-Klf4 mRNA broke the dynamic equilibrium among the spermatogenic cells. Furthermore, almost half of spermatocytes and a few spermatogonia were in apoptosis status, while little positive signals were found in control groups by means of TUNEL detection (Fig 8A and 8B). In view of the above mentioned facts, we suggested that the Cf-Klf4 regulates early spermatogenesis, and might promote the differentiation of post-mitosis spermatogonia and post-meiotic spermatocytes as well as the apoptosis of spermatocytes.
Klf4 maintains the testis function
The sex determination and formation is a vital and essential progress during individual development, with several key genes or a serial of genes involved. Up to now, only several genetic models for sex determination and formation has been proposed in model organisms, such as M. musculus, Drosophila melanogaster and Caenorhabditis elegans [35–37]. In bivalve mollusks, studies on sex determination and formation are still in its infancy, even the relevant key genes have not yet been identified. Laurent, et al. [38] demonstrated that function loss of foxl2, a female functional maintenance gene is sufficient to cause an XX female-to-male sex reversal in the goat. Dmy, a dmrt1 homologue in the medaka Oryzias latipe has been identified to be male sex-determining gene based on its mutation can cause a male-to-female sex reversal [39]. In the present study, two hermaphroditic scallops were observed in the dsKLF4 gonads in which the oogonia and oocytes presenting foxl2 positive signals (Fig 9) scattered along the walls in all the follicles, as well as spermatozoa distributed in the follicular cavity (Fig 7G). Liao, et al. [27] and our years of research demonstrated that the Zhikong scallop C. farreri is a kind of dioecious bivalve and its gender composition is stable. Moreover, Wu, et al. [40] reported when the clam Paphia undulata occurs sex reversal from male-to-female, male germ cells are in the center of the follicle while female germ cells are scattered in the follicle wall. While, when it is female-to-male sex reversal, female germ cells are in the center of the follicle while male germ cells are scattered in the follicle wall. Hereby in the present study, we confirmed the hermaphroditic gonads in the dsKLF4 group is male-to-female sex reversal, and suggested that Kfl4 is essential for the spermatogenesis and the maintenance of male gonadal function in C. farreri.
Conclusions
In the present work, we identified a Klf4 full-length cDNA of 2,610 bp in C. farreri. The Cf-Klf4 expression presents a sexually dimorphic characteristic during gametogenesis, and is specifically visible in spermatogonia, spermatocytes and spermatids of C. farreri testes, which is different from that in human beings and mice. Furthermore, the Cf-Klf4 should participate in the regulation of early spermatogenesis and play an important role in maintaining the testis function based on the Cf-Klf4 RNAi analysis. In the future, it remains to study molecular mechanism of Klf4 regulating spermatogenesis in shellfish.
Supporting information
(XLSX)
(XLSX)
(a), GSI; (b), Gamete number in testis follicles of a 2500 μm2 area; (c), percentage of various types of germ cells in a total number of 200 gametes.
(XLSX)
Data Availability
All relevant data are within the paper and its Supporting Information files.
Funding Statement
This work was supported by the National Natural Science Foundation of China received by ZQ (grant number: 31602139), http://www.nsfc.gov.cn/, the Scientific and Technological Innovation Project from Laboratory for Marine Fisheries and Aquaculture, Qingdao National Laboratory for Marine Science and Technology received by ZZ (grant number: 2015ASKJ02), http://www.qnlm.ac/index, and the National High Technology Research and Development Program of China received by ZZ (grant number: 2012AA10A402), http://program.most.gov.cn/. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1.Shields M, Christy J, Yang W. Identification and characterization of a gene encoding a gut-enriched Krüppel-like factor expressed during growth arrest [J]. J Biol Chem. 1996; 271 (33): 20009–20017. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Kaczynski J, Cook T, Urrutia R. Sp1- and Krüppel-like transcription factors [J]. Genome Biol. 2003; 4(2): 206 doi: 10.1186/gb-2003-4-2-206 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Suske G, Bruford E, Philipsen S. Mammalian SP/KLF transcription factors: Bring in the family [J]. Genomics. 2005; 85(5): 551–556. doi: 10.1016/j.ygeno.2005.01.005 [DOI] [PubMed] [Google Scholar]
- 4.Dang T, Pevsner J, Yang W. The biology of the mammalian Krüppel-like family of transcription factors [J]. Biochem Cell Biol. 2000; 32(11–12): 1103–1121. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Yet F, McA M, Folta C. Yen H, Yoshizumi M, Hsieh C, et al. Human EZF, a Krüppel-like zinc finger protein, is expressed in vascular endothelial cells and contains transcriptional activation and repression domains [J]. Biol Chem. 1998; 273: 10747–10754. [DOI] [PubMed] [Google Scholar]
- 6.Wei D, Kanai M, Huang S, Xie K. Emerging role of KLF4 in human gastrointestinal cancer [J]. Carcinogenesis. 2005; 27(1): 23–31. doi: 10.1093/carcin/bgi243 [DOI] [PubMed] [Google Scholar]
- 7.Segre A, Bauer C, Fuchs E. Klf4 is a transcription factor required for establishing the barrier function of the skin [J]. Nat Genet. 1999; 22: 356–360. doi: 10.1038/11926 [DOI] [PubMed] [Google Scholar]
- 8.Katz J, Perreault N, Goldstein B, Lee C, Labosky P, Yang V, et al. The zinc-finger transcription factor Klf4 is required for terminal differentiation of goblet cells in the colon [J]. Development. 2002; 129(11): 2619–2628. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Abbas T, Dutta A. p21 in cancer: intricate networks and multiple activities [J]. Nat Rev Cancer. 2009; 9(6): 400–414. doi: 10.1038/nrc2657 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Yu T, Chen X, Zhang W, Liu J, Avdiushko R, Napier D, et al. KLF4 regulates adult lung tumor-initiating cells and represses K-Ras-mediated lung cancer [J]. Cell Death Differ. 2015. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Lin C, Ruppert M. A normal-tumor switch alters the activity of KLF4-miR-206 signaling in breast cancer [J]. FASEB J. 2012; 26(1_MeetingAbstracts): 944.3. [Google Scholar]
- 12.Cittelly M, Finlay-Schultz J, Howe N, Spoelstra N, Axlund S, Hendricks P, et al. Progestin suppression of miR-29 potentiates dedifferentiation of breast cancer cells via KLF4 [J]. Oncogene. 2013; 32(20): 2555–2564. doi: 10.1038/onc.2012.275 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Takahashi K, Yamanaka S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors [J]. Cell. 2006; 126(4): 663–676. doi: 10.1016/j.cell.2006.07.024 [DOI] [PubMed] [Google Scholar]
- 14.Polo M, Anderssen E, Walsh M, Schwarz B, Nefzger C, Lim S, et al. A molecular roadmap of cellular reprogramming into iPS cells [J]. Cell. 2012; 151(7): 1617 doi: 10.1016/j.cell.2012.11.039 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Behr R, Kaestner H. Developmental and cell type-specific expression of the zinc finger transcription factor Krüppel-like factor 4 (Klf4) in postnatal mouse testis [J]. Mech Develop. 2002; 115(1): 167–169. [DOI] [PubMed] [Google Scholar]
- 16.Behr R, Deller C, Godmann M, Muller T, Bergmann M, Lvell R, et al. Krüppel-like factor 4 expression in normal and pathological human testes [J]. Mol Hum Reprod. 2007; 13(11): 815–820. doi: 10.1093/molehr/gam064 [DOI] [PubMed] [Google Scholar]
- 17.Godmann M, Katz P, Guillou F, Simoni M, Kaestner K, Berh R. Krüppel-like factor 4 is involved in functional differentiation of testicular Sertoli cells [J]. Dev Biol. 2008; 315(2): 552–566. doi: 10.1016/j.ydbio.2007.12.018 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Godmann M, Gashaw I, Katz P, Nagy A, Kaestner K, Berh R. Krüppel-like factor 4, a “pluripotency transcription factor” highly expressed in male postmeiotic germ cells, is dispensable for spermatogenesis in the mouse [J]. Mech Develop. 2009b; 126(8): 650–664. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Li Y, Zhang L, Sun Y, Ma X, Wang J, Li R, et al. Transcriptome Sequencing and Comparative Analysis of Ovary and Testis Identifies Potential Key Sex-Related Genes and Pathways in Scallop Patinopecten yessoensis [J]. Mar Biotechnol. 2016; 1–13. doi: 10.1007/s10126-015-9665-5 [DOI] [PubMed] [Google Scholar]
- 20.Feng Z, Shao M, Sun D, Zhang Z. Cloning, characterization and expression analysis of Cf-dmrt4-like gene in Chlamys farreri [J]. J Fish Sci China (in Chinese with English abstract). 2010; 17(5): 930–940. [Google Scholar]
- 21.Yu F, Wang M, Zhou L, Gui J, Yu X. Molecular Cloning and Expression Characterization of Dmrt2 in Akoya Pearl Oysters, Pinctada martensii [J]. J Shellfish Res. 2011; 30(2): 247–254. [Google Scholar]
- 22.Liu X, Zhang Z, Shao M, Liu J, Muhammad F. Sexually dimorphic expression of foxl2 during gametogenesis in scallop Chlamys farreri, conserved with vertebrates [J]. Dev Genes Evol. 2012; 222(5): 279–286. doi: 10.1007/s00427-012-0410-z [DOI] [PubMed] [Google Scholar]
- 23.Li H, Zhang Z, Bi Y, Yang D, Zhang L, Liu J. Expression characteristics of β-catenin in scallop Chlamys farreri gonads and its role as a potential upstream gene of Dax1 through canonical Wnt signaling pathway regulating the spermatogenesis [J]. PloS One. 2014; 9(12): e115917 doi: 10.1371/journal.pone.0115917 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Zhang N, Xu F, Guo X. Genomic analysis of the Pacific oyster (Crassostrea gigas) reveals possible conservation of vertebrate sex determination in a mollusc [J]. G3. 2014; 4:2207–2217. doi: 10.1534/g3.114.013904 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Liu J, Zhang Z, Ma X, Liang S, Yang D. Characteristics of 17β-hydroxysteroid dehydrogenase 8 and its potential role in gonad of Zhikong scallop Chlamys farreri [J]. J Steroid Biochem. 2014; 141: 77–86. [DOI] [PubMed] [Google Scholar]
- 26.Liu J, Zhang Z, Zhang L, Liu X, Yang D, Ma X. Variations of estradiol-17β and testosterone levels correlated with gametogenesis in the gonad of Zhikong scallop (Chlamys farreri) during annual reproductive cycle [J]. Can J Zool. 2014; 92(3): 195–204. [Google Scholar]
- 27.Liao C, Xu Y, Wang Y. Reproductive cycle of the scallop Chlamys farreri (Jones and Preston) at Qingdao [J]. J Fish China/Shuichan Xuebao (in Chinese with English abstract). 1983; 7(1): 1–13. [Google Scholar]
- 28.Zhou Z, Wang L, Shi X, Yue F, Wang M, Zhang H, et al. The expression of dopa decarboxylase and dopamine beta hydroxylase and their responding to bacterial challenge during the ontogenesis of scallop Chlamys farreri [J]. Fish Shellfish Immun. 2012; 33 (1): 67–74. [DOI] [PubMed] [Google Scholar]
- 29.Bustin A, Benes V, Garson A, Hellemans J, Huggett J, Kubista M, et al. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments [J]. Clin Chem. 2009; 55(4): 611–622. doi: 10.1373/clinchem.2008.112797 [DOI] [PubMed] [Google Scholar]
- 30.Feng Z, Zhang Z, Shao M, Zhu W. Developmental expression pattern of the Fc-vasa-like gene, gonadogenesis and development of germ cell in Chinese shrimp Fenneropenaeus chinensis [J]. Aquaculture. 2011; 314 (1–4): 202–209. [Google Scholar]
- 31.Ma Y, Zhang Z, Shao M, Kang K, Tan Z, Li J. Sulfide: quinone oxidoreductase from echiuran worm Urechis unicinctus [J]. Mar Biotechnol. 2011; 13 (1): 93–107. doi: 10.1007/s10126-010-9273-3 [DOI] [PubMed] [Google Scholar]
- 32.Suzuki M, Saruwatari K, Kogure T, Yamamoto Y, Nishimura T, Kato T, et al. An acidic matrix protein, Pif, is a key macromolecule for nacre formation [J]. Science. 2009; 325(5946): 1388–1390. doi: 10.1126/science.1173793 [DOI] [PubMed] [Google Scholar]
- 33.Godmann M, Gashaw I, Eildermann K, Schweyer S, Bergmann M, Skotheim R, et al. The pluripotency transcription factor Krüppel-like factor 4 is strongly expressed in intratubular germ cell neoplasia unclassified and seminoma [J]. Mol Hum Reprod. 2009; 15(8): 479–488. doi: 10.1093/molehr/gap040 [DOI] [PubMed] [Google Scholar]
- 34.Chen X, Whitney M, Gao Y, Yang V. Transcriptional profiling of Krüppel-like factor 4 reveals a function in cell cycle regulation and epithelial differentiation [J]. J Mol Biol. 2003; 326, 665–677. doi: 10.1016/S0022-2836(02)01449-3 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Berta P, Hawkins J, Sinclair A, Taylor A, Griffiths B, Goodfellow P, et al. Genetic evidence equating SRY and the testis-determining factor [J]. Nature. 1990; 348: 448–450. doi: 10.1038/348448A0 [DOI] [PubMed] [Google Scholar]
- 36.Coschigano K, Wensink P. Sex-specific transcriptional regulation of the male and female doublesex proteins of Drosophila [J]. Gene Dev. 1993; 7: 42–54. [DOI] [PubMed] [Google Scholar]
- 37.Hodgkin J. Males, hermaphrodites, and females: Sex determination in Caenorhabditis elegans [J]. Trends Genet. 1985; 1: 85–88. [Google Scholar]
- 38.Boulanger L, Pannetier M, Gall L, Allais A, Elzaiat M, Bourhis D, et al. FOXL2 is a female sex-determining gene in the goat [J]. Curr Biol. 2014; 24(4): 404–408. doi: 10.1016/j.cub.2013.12.039 [DOI] [PubMed] [Google Scholar]
- 39.Masuyama H, Yamada M, Kamei Y, Fujiwara T, Todo T, Nagahama Y, et al. Dmrt1 mutation causes a male-to-female sex reversal after the sex determination by Dmy in the medaka [J]. Chromosome Res. 2012; 20(1): 163–176. doi: 10.1007/s10577-011-9264-x [DOI] [PubMed] [Google Scholar]
- 40.Wu H. Histological changes in the gonad during Paphia undulata sex reversal [J]. Mar Sci (in Chinese with English abstract). 2002; 26(1): 5–8. [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
(XLSX)
(XLSX)
(a), GSI; (b), Gamete number in testis follicles of a 2500 μm2 area; (c), percentage of various types of germ cells in a total number of 200 gametes.
(XLSX)
Data Availability Statement
All relevant data are within the paper and its Supporting Information files.









