Improving Baculovirus Infectivity by Efficiently Embedding Enhancing Factors into Occlusion Bodies

ABSTRACT

The relatively low infectivity of baculoviruses to their host larvae limits their use as insecticidal agents on a larger scale. In the present study, a novel strategy was developed to efficiently embed foreign proteins into Autographa californica multiple nucleopolyhedrovirus (AcMNPV) occlusion bodies (OBs) to achieve stable expression of foreign proteins and to improve viral infectivity. A recombinant AcMNPV bacmid was constructed by expressing the 150-amino-acid (aa) N-terminal segment of polyhedrin under the control of the p10 promoter and the remaining C-terminal 95-aa segment under the control of the polyhedrin promoter. The recombinant virus formed OBs in Spodoptera frugiperda 9 cells, in which the occlusion-derived viruses were embedded in a manner similar to that for wild-type AcMNPV. Next, the 95-aa polyhedrin C terminus was fused to enhanced green fluorescent protein, and the recombinant AcMNPV formed fluorescent green OBs and was stably passaged in vitro and in vivo. The AcMNPV recombinants were further modified by fusing truncated Agrotis segetum granulovirus enhancin or truncated Cydia pomonella granulovirus ORF13 (GP37) to the C-terminal 95 aa of polyhedrin, and both recombinants were able to form normal OBs. Bioactivity assays indicated that the median lethal concentrations of these two AcMNPV recombinants were 3- to 5-fold lower than that of the control virus. These results suggest that embedding enhancing factors in baculovirus OBs by use of this novel technique may promote efficient and stable foreign protein expression and significantly improve baculovirus infectivity.

IMPORTANCE Baculoviruses have been used as bioinsecticides for over 40 years, but their relatively low infectivity to their host larvae limits their use on a larger scale. It has been reported that it is possible to improve baculovirus infectivity by packaging enhancing factors within baculovirus occlusion bodies (OBs); however, so far, the packaging efficiency has been low. In this article, we describe a novel strategy for efficiently embedding foreign proteins into AcMNPV OBs by expressing N- and C-terminal (dimidiate) polyhedrin fragments (150 and 95 amino acids, respectively) as fusions to foreign proteins under the control of the p10 and polyhedrin promoters, respectively. When this strategy was used to embed an enhancing factor (enhancin or GP37) into the baculovirus OBs, 3- to 5-fold increases in baculoviral infectivity were observed. This novel strategy has the potential to create an efficient protein expression system and a highly efficient virus-based system for insecticide production in the future.

INTRODUCTION

Baculoviruses are a family of enveloped viruses with rod-shaped virions and double-stranded DNA genomes. There are four baculovirus genera, namely, Alphabaculovirus (lepidopteran-specific nucleopolyhedrovirus [NPV]), Deltabaculovirus (dipteran-specific NPV), Gammabaculovirus (hymenopteran-specific NPV), and Betabaculovirus (lepidopteran-specific granulovirus [GV]) (1). Their infection cycles are characterized by two types of virions, budded viruses (BVs) and occlusion-derived viruses (ODVs), and these have different structural forms and membrane proteins (2–4). BVs are produced in the early stages of viral infection and play the main role in viral transmission between host cells (5, 6). ODVs are produced in the late stages of virus infection and are involved in the transmission of baculoviruses between hosts. During the late stage of baculovirus infection, a large number of ODV particles become embedded in polyhedrin and form occlusion bodies (OBs) (7). In the environment, OBs are taken up by susceptible hosts, where they dissolve in the alkalic environment of the insect midgut, and ODVs are released (8). ODVs bind to and fuse with the midgut cells and release nucleocapsids into the cytoplasm, and then the nucleocapsids are transported to the nucleus, where they are uncoated and begin replicating, thereby producing BVs (9). Late in infection, the host's tissues become filled with virions occluded in millions of occlusion bodies, and these are released upon host death when the host liquefies (10). The most widely studied baculovirus is Autographa californica multiple NPV (AcMNPV), which has been shown to be able to infect 43 different species across 11 lepidopteran families. AcMNPV-based insecticides have been registered as commercial products in several countries around the globe (11).

Public attention has focused on baculovirus-based insecticides because they have several advantages over other products. For example, they are environmentally friendly and harmless to humans and animals, and they have long-lasting control effects on the targeted pests (12, 13). However, the large-scale application of baculoviruses has been limited by several factors, especially their limited activity against older larvae (14). One reasonable method for overcoming this shortcoming is to construct genetically modified viruses, such as recombinant viruses with enhanced insecticidal properties from packaging within the OBs of some proteins that are capable of improving the virus infection rate (15). Enhanced insecticidal proteins include Bacillus thuringiensis (Bt) Cry toxins as well as chitinases and enhancins (16).

Enhancin refers to a synergistic or viral enhancing factor, found in GV and a few NPVs, that has the ability to enhance infection by other NPVs (17). The enhancins from Helicoverpa armigera GV (HearGV), Pseudaletia unipuncta GV (PsunGV), and Trichoplusia ni GV (TrniGV) all significantly facilitate NPV infections (18, 19). For example, purified enhancin from TrniGV can enhance the infection rate of AcMNPV 2- to 4-fold when fed to T. ni larvae and up to 12-fold when fed to other larvae (20). There are two mechanisms underlying the activity of enhancins: one involves enhancing the permeability of peritrophic membranes (PMs), and the other involves strengthening the binding or fusion ability of ODVs to the insect midgut (17, 20, 21). Therefore, when enhancins are packaged in OBs, they are released into the midgut together with ODVs when the OBs are taken up by susceptible hosts, leading to more baculovirus transport over the midgut and resulting in more host insect cells becoming infected (21).

The Agrotis segetum granulovirus (AgseGV) enhancin gene encodes a 1,004-amino-acid (aa) protein with a predicted molecular mass of 115 kDa. Amino acid sequence analysis showed that AgseGV enhancin exhibited the greatest identity in the N-terminal area, especially for amino acids between positions 200 and 380 of the N terminus, within which there is a zinc-binding domain (HVMGH) common to metalloproteases and a conserved aspartic acid residue (D), located 20 aa toward the C terminus from the second histidine residue (H) (22). A previous study in our laboratory showed that a truncated AgseGV enhancin (aa 205 to 439) which contained the zinc-binding domain and the conserved aspartic acid residue could enhance the infectivity of AcMNPV 2- to 3-fold when it was fed to Spodoptera exigua larvae (unpublished data). The baculovirus glycoprotein GP37 is homologous to fusolin, a synergistic factor found in entomopoxviruses, with 30 to 40% aa sequence identity. It was reported previously that bacterially expressed and truncated Cydia pomonella granulovirus (CpGV) GP37 could bind to chitin and could also dissociate a 50-kDa protein in S. exigua PMs, while droplet-feeding bioassays indicated that GP37 significantly enhanced the infectivity of both AcMNPV and S. exigua NPV in S. exigua larvae (23).

Currently, there are three main ways to package foreign proteins, along with the polyhedrin matrix, into baculovirus OBs (see Fig. S1 in the supplemental material). Early studies showed that a recombinant virus expressing a translational fusion between polyhedrin and green fluorescent protein (GFP) did not form OBs (24). Hamblin et al. (25) proposed the first method, “co-occlusion of foreign protein with polyhedrin,” in which cells are infected with wild-type AcMNPV and a recombinant virus expressing enhanced GFP (EGFP) (Fig. S1, panel 1). The foreign protein EGFP formed by the recombinant virus expressing EGFP can then be embedded in the polyhedrin formed by the wild-type virus (25). Using this approach, Sf21 cells were coinfected with a recombinant AcMNPV strain that expresses TrniGV enhancin and with wild-type AcMNPV, and enhancin was successfully carried into the resulting OBs (26). The second method for packaging foreign proteins into OBs is to construct a recombinant virus in which the AcMNPV polyhedrin and fused polyhedrin-GFP are expressed under the control of the p10 or polyhedrin promoter (Fig. S1, panel 2). The OBs from the resultant recombinant virus show green fluorescence, and the recombinant virus has an infection rate similar to that of the wild-type virus (24). The third method is to construct a recombinant baculovirus by inserting the Bt toxin-encoding gene between the two polyhedrin genes under the control of the polyhedrin promoter (Fig. S1, panel 3). The recombinant baculovirus expressing the polyhedrin-Bt toxin-polyhedrin fusion protein produces OBs containing Bt toxin (15). However, these techniques have the following disadvantages: (i) the coinfection efficiency of the two viruses required for the coocclusion of foreign protein is low, (ii) the number of foreign proteins falsely entrapped into OBs is limited, and (iii) polyhedrin fragments fused with Bt toxin or enhancin are less active after serial passage as a result of foreign protein deletion by homologous recombination between the two polyhedrin genes.

The AcMNPV polyhedrin gene is 735 bp long and encodes a protein of 33 kDa (2). The polyhedrin monomer is composed of three parts: an N-terminal head, a β-barrel body in the middle, and a C-terminal tail (27). The three polyhedrin monomers combine closely to form a trimer through N-terminal head interactions. The C-terminal segment of polyhedrin is extended from the three sides of the trimer and is independent of trimer assembly. The disulfide bonds are also central to maintaining the advanced structure of polyhedrin (28).

In the present study, we aimed to construct a series of AcMNPV recombinants, based on the crystal structure of baculovirus polyhedrin, in which N-terminal polyhedrin segments (110, 150, 170, and 204 aa) and the remaining C-terminal polyhedrin segments (135, 95, 75, and 41 aa, respectively) are expressed under the control of different promoters to test their ability to form normal OBs. We also constructed a recombinant virus in which the appropriate C-terminal 95-aa polyhedrin segment was fused to EGFP to determine whether foreign proteins can be embedded in OBs and to explore the possibility of packaging enhancing factors into OBs to improve baculovirus infectivity.

RESULTS

Construction of recombinant viruses expressing the N-terminal segment of polyhedrin under p10 promoter control and the remaining C-terminal segment under polyhedrin promoter control.

The recombinant AcMNPV bacmids AcBac-phN110-phC135, AcBac-phN150-phC95, AcBac-phN170-phC75, AcBac-phN204-phC41, and AcBac-ph were successfully constructed using the Bac-to-Bac system (Fig. 1a). The recombinant AcMNPV bacmids were verified by PCR analysis (data not shown) using the primer pairs shown in Table 1.

FIG 1.

Construction and identification of recombinant AcMNPV bacmids containing different polyhedrin N-terminal segment lengths under the control of the p10 promoter (P_P10) and the remaining C-terminal segments under the control of the polyhedrin promoter (P_PH) of AcMNPV. (a) Schematic representation of recombinant AcMNPV bacmids. The NLS sequence (AAGCGCAAGAAG) and linker sequence (AGATCCACCTCCACC) were incorporated into the 5′- and 3′-terminal segments of phC, respectively. The loci targeted by the phN-F and phC-R PCR primers, which were used to differentiate the recombinants from the control virus, are indicated by arrows. The drawings at the top show the lengths of the N-terminal segments and C-terminal segments of polyhedrin in each construct. N, nuclear localization sequence (NLS); L, linker sequence. (b) Sf9 cells were transfected with AcBac-ph (positive control) or AcBac-phN150-phC95 DNA. At 96 h posttransfection, the supernatants were harvested and used to infect a new batch of Sf9 cells. Pictures were taken at 72 h postinfection. (c) PCR amplification of genomic DNAs extracted from recombinant AcMNPV OBs. phN-F and phC-R were used as the primers. Lanes: M, molecular size marker; 1, genomic DNA from vAcBac-ph; 2, genomic DNA from vAcBac-phN150-phC95. (d and e) SDS-PAGE (d) and Western blot (e) analyses of vAcBac-phN150-phC95 and vAcBac-ph OBs. Lanes: M, molecular size marker; 1, OBs from vAcBac-ph; 2, OBs from vAcBac-phN150-phC95.

TABLE 1.

Primers used in this study

Primer	Sequence (5′ → 3′)a
phN-F	CTAGCTAGCATGCCGGATTATTCATACCGTC (NheI)
phN110-R	ACATGCATGCTTAAACAATGGGGAAGCTGTCTTC (SphI)
phN150-R	ACATGCATGCTTAATGAGGTACATAGTCGGGGTCG (SphI)
phN170-R	ACATGCATGCTTAGCTGATGCGGTACTCGTTGTTG (SphI)
phN204-R	ACATGCATGCTTAGTAGAAGTTCTCCCAGATGACACG (SphI)
phC135-F	GGAATTCATGGCTAAGCGCAAGAAGAACGACCAAGAAGTGATGGATG (EcoRI)
phC95-F	GGAATTCATGGCTAAGCGCAAGAAGGACGTGATTAGGATCGTCGAGC (EcoRI)
phC75-F	GGAATTCATGGCTAAGCGCAAGAAGCTGGCTAAGAAGGGCGGC (EcoRI)
phC41-F	GGAATTCATGGCTAAGCGCAAGAAGAAGCCCATCGTTTACATCGGTA (EcoRI)
phC-R	GCTCTAGAAGATCCACCTCCACCATACGCCGGACCAGTGAAC (XbaI)
egfp-F	GCTCTAGAAGTAAAGGAGAAGAACTTTTCACTG (XbaI)
egfp-R	AACTGCAGTTATTTGTATAGTTCATCCATGCC (PstI)
en4-F	GCTCTAGAATGTTTTTTAAACAAGATCTCAGCG (XbaI)
en4-R	AACTGCAGTCAAAGACGAATTATACACTCTTCAA (PstI)
gp37-F	GCTCTAGAATGCCGTTGGCGAGACAGCGCCACT (XbaI)
gp37-R	AACTGCAGCTACAAATCACTTTTCGTTTGCTTG (PstI)

^aRestriction sites for the indicated enzymes are indicated with italics.

The AcMNPV recombinants were obtained by transfecting Sf9 cells with the bacmids described above and subsequently infecting Sf9 cells with the recombinant viruses. The Sf9 cells infected by the vAcBac-ph and vAcBac-phN150-phC95 recombinants produced OBs observable by inverted optical microscopy (Fig. 1b). However, OBs were not observed in Sf9 cells infected by the AcMNPV recombinants vAcBac-phN110-phC135, vAcBac-phN170-phC75, and vAcBac-phN204-phC41 (data not shown). These results suggest that the N-terminal 150-aa and C-terminal 95-aa regions of the polyhedrin protein can interact with each other and form OBs.

To confirm that S. exigua larvae were indeed infected by vAcBac-phN150-phC95, PCR and Western blot analyses were performed using the OBs purified from virus-killed S. exigua cadavers. The existence of chimeric polyhedrin in the genomic DNA extracted from the vAcBac-phN150-phC95 OBs was verified by PCR using the phN-F and phC-R primers (Fig. 1a). Because the direction of the C-terminal 95-aa region in vAcBac-phN150-phC95 was opposite that in wild-type AcMNPV or vAcBac-ph, there was an 800-bp product for wild-type AcMNPV or vAcBac-ph and no product for vAcBac-phN150-phC95 (Fig. 1c) with this pair of primers, which are labeled in Fig. 1a. The results suggest that the OBs from vAcBac-phN150-phC95 were not contaminated by wild-type AcMNPV or vAcBac-ph. SDS-PAGE and Western blotting showed that the OBs from vAcBac-phN150-phC95 could form a 35-kDa monomer band, which is 2 kDa larger than the wild-type polyhedrin monomer. This size difference was likely caused by the presence of the nuclear localization sequence (NLS) and linker sequences in the C-terminal segment of phC95. Additionally, in common with the control virus vAcBac-ph, an approximately 70-kDa dimer band and an approximately 105-kDa trimer band were observed for the vAcBac-phN150-phC95 OBs (Fig. 1d and e). These results show that chimeric polyhedrin was able to form OBs and embed ODVs.

EGFP-phC95 fusion proteins can be packaged into OBs.

To confirm that foreign proteins could be embedded in baculovirus OBs, we constructed the vAcBac-phN150-phC95-egfp recombinant virus by fusing EGFP to the C-terminal 95-aa region of AcMNPV polyhedrin (Fig. 2a).

FIG 2.

Construction and fluorescence microscopy observations of EGFP-containing AcMNPV recombinants. (a) Schematic representation of recombinant AcMNPV bacmids. (b) Sf9 cells were transfected with AcBac-ph-egfp or AcBac-phN150-phC95-egfp. At 96 h posttransfection, the supernatants were harvested and used to infect a new batch of Sf9 cells. Pictures were taken at 72 h postinfection by fluorescence microscopy with 488-nm light excitation. Bars, 15 μm. (c) OBs were purified from S. exigua larvae infected with AcBac-phN150-phC95-egfp. The OBs were observed by fluorescence microscopy with 488-nm light excitation. Bars, 50 μm.

A large number of fluorescent green OBs were observed in the Sf9 cells infected by vAcBac-phN150-phC95-egfp (Fig. 2b). In contrast, the OBs from vAcBac-ph-egfp, a control construct in which EGFP was not fused to the polyhedrin fragment, showed diffusely distributed fluorescence (Fig. 2b). When they were observed under a fluorescence microscope, the OBs purified from the S. exigua larvae previously inoculated with vAcBac-phN150-phC95-egfp also displayed green fluorescence (Fig. 2c). These results show that EGFP proteins were successfully packaged into the OBs of AcMNPV.

Expression of EGFP during serial passage.

To investigate the expression of foreign EGFP proteins during serial passages, Sf9 cells or S. exigua larvae were infected with the serially passaged recombinant virus vAcBac-phN150-phC95-egfp. The results of Western blot analysis revealed that the expression level of the polyhedrin-EGFP fusion protein was not altered significantly during 14 serial passages in vitro (Fig. 3a) or during four serial passages in vivo (Fig. 3b). This observation suggests that vAcBac-phN150-phC95-egfp can stably proliferate both in vitro and in vivo.

FIG 3.

Serial passage of recombinant EGFP-containing AcMNPV. (a) Western blot analysis of the OBs produced from Sf9 cells infected with serially passaged vAcBac-phN150-phC95-egfp. Lanes: mock, uninfected Sf9 cells; Ctr, OBs from vAcBac-ph; P2 to P14, OBs from vAcBac-phN150-phC95-egfp at passages 2, 4, 6, 8, 10, 12, and 14. (b) Western blot analysis at passages 2, 3, and 4 of the OBs produced by S. exigua larvae infected with serially passaged vAcBac-phN150-phC95-egfp. Lanes: M, molecular size marker; Ctr, OBs from vAcBac-ph.

Embedding enhancin or GP37 in OBs can improve AcMNPV infectivity.

To determine whether embedding enhancin or GP37 in OBs could improve the infectivity of AcMNPV, we constructed the recombinant viruses vAcBac-phN150-phC95-en4 and vAcBac-phN150-phC95-gp37 (Fig. 4a). We observed OBs in Sf9 cells infected by the vAcBac-phN150-phC95-en4, vAcBac-phN150-phC95-gp37, or vAcBac-ph recombinant (data not shown). PCR analysis showed that the en4 and gp37 genes could be amplified from the OBs, thereby confirming that these genes were successfully inserted into the genomic DNA of the vAcBac-phN150-phC95 recombinant (data not shown). Furthermore, En4 and GP37 were detected by use of anti-En4 and anti-GP37 antisera, respectively, in Western blots (Fig. 4b). This observation confirmed that En4 and GP37 were packaged into recombinant virus OBs.

FIG 4.

Construction and identification of AcMNPV recombinants containing truncated enhancin or GP37. (a) Schematic representation of AcMNPV recombinants. (b) Western blot analysis of vAcBac-phN150-phC95-en4 and vAcBac-phN150-phC95-gp37 OBs. Lanes: M, molecular size marker; 1, OBs from vAcBac-phN150-phC95-gp37; 2, OBs from vAcBac-phN150-phC95-en4; 3, OBs from vAcBac-ph. (c) Electron microscopy observation of OBs from the AcMNPV recombinants. Bars, 500 nm.

The transmission electron microscopy (TEM) results showed that OBs from all the AcMNPV recombinants produced normal ODVs similar to those of the vAcBac-ph control virus. The results also confirmed that the number of nucleocapsids (1 to 5) enveloped in each ODV was normal (Fig. 4c) (29).

The infectivity of the AcMNPV recombinants that had enhancing factors embedded in their OBs was assayed. In test 1, the 50% lethal concentrations (LC₅₀s) of vAcBac-phN150-phC95-en4 and vAcBac-phN150-phC95-gp37 were 2.4 × 10⁴ OBs/ml and 4.0 × 10⁴ OBs/ml, respectively; these were 5.3- and 3.2-fold lower, respectively, than the value for the vAcBac-ph control (12.9 × 10⁴ OBs/ml). The 95% confidence intervals for the potency ratios of both vAcBac-phN150-phC95-en4 and vAcBac-phN150-phC95-gp37 to the control virus did not include the value 1.0 (Table 2), indicating that the infectivity of the recombinant viruses was significantly improved. Similar results were observed for test 2 (Table 2).

TABLE 2.

LC₅₀s of recombinant viruses against second-instar S. exigua larvae

Test no. and virus	LC50 (95% CI) (104 OBs/ml)	Slopea	χ2/df	Mean potency ratio (95% CI) for vAcBac-phb
1
vAcBac-ph	12.9 (7.0–25.5)	0.702	0.278/3
vAcBac-phN150-phC95-en4	2.4 (0.5–5.3)	0.658	0.221/3	5.3 (1.7–16.3)
vAcBac-phN150-phC95-gp37	4.0 (1.9–6.8)	0.875	0.265/3	3.2 (1.4–7.6)
2
vAcBac-ph	14.8 (8.9–27.9)	1.108	1.151/3
vAcBac-phN150-phC95-en4	2.9 (0.4–7.2)	0.569	0.969/3	5.1 (1.4–18.5)
vAcBac-phN150-phC95-gp37	4.8 (2.4–8.1)	0.990	1.990/3	3.1 (1.4–6.7)

^aSlope for the regression equation of the probit function = a + b × log(concentration).

^bThe potency ratio was calculated by dividing the LC₅₀ of vAcBac-ph by that of the recombinant. The significance of differences was based on whether the 95% confidence interval (CI) of the potency ratio included the value 1.0 (36).

DISCUSSION

In this study, three major factors were considered for development of a new method aimed at efficiently embedding foreign proteins into baculovirus OBs to achieve stable expression of foreign proteins and to improve baculovirus infectivity. Several approaches had been adapted to package foreign proteins, but the packaging efficiency was low (24–26). The first aim of the new method was to increase the efficiency of foreign protein packaging in OBs.

For this purpose, serial recombinant AcMNPV bacmids were constructed by expressing several lengths of the N-terminal segment of polyhedrin under the control of the p10 promoter and the remaining C-terminal segment under the control of the polyhedrin promoter (Fig. 1a). The principles for bisecting the polyhedrin were as follows: (i) the points were not in the β-strands or α-helices because these are important for the polyhedrin secondary structure, (ii) the points were not in the N-terminal head because this segment is essential for forming polyhedrin trimers, and (iii) selecting these points would not disturb the disulfide bonds responsible for forming the tetrahedral clusters of polyhedrin. According to these principles, 4 potential points were selected (Fig. 1a). The results indicate that only the vAcBac-phN150-phC95 recombinant could form OBs in cells, like the control virus (Fig. 1b). We propose that OB formation by this recombinant virus is related to the strong interactions between the β-barrel structures of the polyhedrin monomers. The N-terminal 150 aa and C-terminal 95 aa of the polyhedrin not only could form monomers but also could form dimers and trimers through these strong interactions (Fig. 1e).

Furthermore, by fusing EGFP to the C-terminal 95 aa of polyhedrin (Fig. 2a), EGFP could successfully be packaged into OBs and form normal OBs (Fig. 2b and c and 4c), which interacted with the N-terminal 150 aa of polyhedrin. Thus, one EGFP molecule would be packaged into OBs when one polyhedrin molecule was formed. In theory, the packaging efficiency of this novel approach is 100%.

The second aim of this study was to stabilize the expression of foreign proteins. Should the recombinant viruses revert to the wild-type genotype, and therefore not be stably expressed during in vitro and in vivo serial passaging, the infectivity of the virus stock would be reduced. In previous studies, homologous recombination between the two polyhedrin genes meant that inserting the foreign protein gene cry1-5 between these two genes in recombinant viruses produced unstable viruses (15). Deletion mutants of the foreign genes also occurred during viral replication within the hosts. The expression level of the polyhedrin–Cry1-5–polyhedrin fusion protein decreased during serial passaging both in vitro and in vivo. Fusion protein expression in Sf9 cells infected with the recombinant virus was not detected from the 14th passage. Moreover, this decrease was more dramatic in vivo, with almost no fusion protein produced from the 5th passage (15). In contrast, in the present study, vAcBac-phN150-phC95-egfp did not revert to the wild-type genotype, and stable expression continued during in vitro and in vivo serial passaging (Fig. 3a and b).

The third aim of the present study was to increase baculovirus infectivity by using the novel method to package enhancing factors into OBs. The bioassay results showed that the LC₅₀s of the AcMNPV recombinants which packaged truncated enhancin or GP37 into OBs were 3- to 5-fold lower than that of the control virus. This implies that it is possible to use these recombinant viruses in the field at concentrations 3- to 5-fold lower than that of the control virus and to achieve similar results. Thus, these recombinant baculoviruses have the potential to improve biocontrol.

Besides enhancin and GP37, future research studies can also select other enhancins or Bt toxic proteins to be packaged into baculovirus OBs. For example, there have been several reports on the improvement of insecticidal activity by expressing the Bt Cry protein toxin and enhancins of HearGV, PsunGV, and TrniGV in OBs (16). The new technique may be used not only to produce virus-based insecticides but also for large-scale production of the key proteins of some pathogenic microorganisms as vaccine candidates.

In conclusion, a novel recombinant AcMNPV, vAcBac-phN150-phC95, was constructed to efficiently embed foreign proteins into OBs to achieve stable expression, with the aim of delivering an improved baculovirus insecticide. This novel baculovirus has three advantages. First, it provides an efficient way to package foreign proteins into baculovirus OBs. Second, the expression of foreign proteins in this baculovirus is stable during serial passaging. Finally, the novel technique used to construct this baculovirus may be used to improve baculovirus infectivity.

MATERIALS AND METHODS

Bacterial strains, insect cells, and insects.

The pFastBacDual donor plasmid (Invitrogen, Carlsbad, CA, USA) and Escherichia coli host strains DH5α (Invitrogen) and DH10B (Invitrogen) containing an AcMNPV bMON14272 bacmid (AcBacmid) and a helper plasmid were used for all the experiments. Spodoptera frugiperda cells (Sf9), maintained at 27°C in Grace's medium (Invitrogen) supplemented with 10% fetal bovine serum (Gibco, Grand Island, NY, USA) and 0.1% antibiotic-antimycotic solution (Invitrogen), were subcultured every 3 to 4 days. S. exigua larvae were provided by the Core Facility and Technical Support, Wuhan Institute of Virology. The larvae were reared on artificial diets at 28°C (30). The Cydia pomonella granulovirus (CpGV) M isolate was kindly provided by J. A. Jehle of DLR Rheinpfalz, Germany, and Agrotis segetum granulovirus (AgseGV) was obtained from the China Center for General Viruses Culture Collection, Wuhan, China.

PCR amplifying the N- and C-terminal coding segments of the polyhedrin gene and target genes.

The 5′ polyhedrin segments were PCR amplified from AcMNPV genomic DNA by using the phN-F forward primer and the phN110-R, phN150-R, ph170N-R, and phN204-R specific reverse primers (Sangon, Shanghai, China) (Table 1), which are here called phN110 (aa 1 to 110), phN150 (aa 1 to 150), phN170 (aa 1 to 170), and phN204 (aa 1 to 204), respectively (Fig. 1a). The forward and reverse primers contain initiation and termination codons, respectively. The PCR conditions were as follows: 35 cycles of 98°C for 45 s, 55°C for 30 s, and 72°C for 15 to 45 s (time determined by the length of each target fragment to be amplified).

The 3′ polyhedrin segments were PCR amplified using the specific forward primers phC135-F, phC95-F, phC75-F, and phC41-F and the reverse primer phN-R (Table 1); the forward primers are here called phC135 (aa 111 to 245), phC95 (aa 151 to 245), phC75 (aa 171 to 245), and phC41 (aa 205 to 245), respectively (Fig. 1a). Each forward primer contains an initiation codon and the polyhedrin nuclear localization sequence (NLS) (AAGCGCAAGAAG). Each reverse primer contains a linker sequence (AGATCCACCTCCACC), used to prepare for the subsequent connection to egfp, gp37, or truncated enhancin. The PCR conditions were as follows: 35 cycles of 98°C for 45 s, 55°C for 30 s, and 72°C for 10 to 45 s (time determined by the length of each target fragment to be amplified).

The egfp gene was amplified from the pEGFP-N1 plasmid (Clontech, Heidelberg, Germany) by PCR using the egfp-F and egfp-R primers (Table 1), as described previously (31). The PCR conditions involved 35 cycles of 94°C for 45 s, 56°C for 30 s, and 72°C for 45 s. The resulting egfp gene was inserted into the pUC18 plasmid (TaKaRa Biotechnology Co. Ltd., Dalian, China), and its authenticity was confirmed by endonuclease digestion and DNA sequencing.

The gp37 (CpGV orf13) (23) and en4 (nucleotides [nt] 616 to 1499 of AgseGV enhancin [GenBank accession no. NC_005839]) sequences were PCR amplified from the genomic DNA of the corresponding virus by using the gp37-F/gp37-R or en4-F/en4-R primer pair (Table 1). The PCR conditions involved 35 cycles of 94°C for 45 s, 56°C for 30 s, and 72°C for 40 s.

Construction of AcMNPV recombinants in which the N- and C-terminal segments of polyhedrin are expressed under the control of different promoters.

The amplified 5′ and 3′ polyhedrin segments were analyzed by agarose gel electrophoresis and then recovered from the gel by use of a gel extraction kit (Omega Bio-Tek, Norcross, GA, USA), and they were digested with NheI/SphI and EcoRI/XbaI, respectively, and then ligated into pMD18T and pUC18 (TaKaRa), respectively. The resulting constructs are here called pMD18T-phN110, pMD18T-phN150, pMD18T-phN170, and pMD18T-phN204 (pMD18T constructs) and pUC18-phC135, pUC18-phC95, pUC18-phC75, and pUC18-phC41 (pUC18 constructs).

To generate the pD-phN110-phC135 donor plasmid, the regions containing nt 1 to 330 (phN110) and nt 331 to 735 (phC135) of polyhedrin were cut from the recombinant pMD18T-phN110 and pUC18-phC95 constructs mentioned above by using the NheI/SphI or EcoRI/XbaI restriction enzymes. The phN110 and phC135 products were inserted into pFastBacDual (Invitrogen) under the control of the p10 promoter and the polyhedrin promoter, respectively. The donor plasmids pD-phN150-phC95, pD-phN170-phC75, pD-phN204-phC41, and pD-ph were generated similarly. The full-length polyhedrin-containing pD-ph donor plasmid was used to produce a control virus (Fig. 1a).

To generate a series of recombinant bacmids, the donor plasmids mentioned above were transformed into DH10B competent cells containing the pMON7124 helper plasmid and the AcBacmid by use of the Bac-to-Bac system (Invitrogen). The bacterial cells were cultivated (37°C, 225 rpm, 4 h), after which they were serially diluted 10-fold (10⁻¹, 10⁻², and 10⁻³) with SOC medium (containing 0.5% yeast extract, 2% tryptone, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl₂, 10 mM MgSO₄, and 20 mM glucose), and 100 μl of each dilution was plated onto an LB agar plate containing 50 μg/ml kanamycin, 7 μg/ml gentamicin, 10 μg/ml tetracycline, 100 μg/ml X-Gal (5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside), and 40 μg/ml IPTG (isopropyl-β-d-thiogalactopyranoside). After 48 h of incubation at 37°C, white colonies were picked from the plate and restreaked on fresh LB agar plates, and the plates were then incubated overnight at 37°C. Next, a single clone was picked, inoculated into liquid culture, and grown overnight. The recombinant bacmid DNAs subsequently isolated were named AcBac-phN110-phC135, AcBac-phN150-phC95, AcBac-phN170-phC75, AcBac-phN204-phC41, and AcBac-ph. To verify successful transposition into the bacmid, the recombinant bacmid DNAs were analyzed by PCR using the primer pairs listed in Table 1.

To generate the first passage of recombinant baculovirus (P1), the recombinant AcBacmids mentioned above were used to transfect Sf9 cells by using Cellfectin II reagent (Invitrogen) and standard procedures. At 5 days posttransfection, the P1 BVs recovered were named vAcBac-phN110-phC135, vAcBac-phN150-phC95, vAcBac-phN170-phC75, vAcBac-phN204-phC41, and vAcBac-ph. To obtain the second passage of recombinant baculovirus (P2), Sf9 cells were plated at 2 × 10⁶ cells/ml. The appropriate amount of the P1 viral stock was added to each culture bottle after incubating the cells for 1 h at room temperature to allow attachment. The cells were incubated at 27°C for 48 h. Next, 2 ml of the virus-containing medium from each culture bottle was collected and transferred to a sterile 15-ml snap-cap tube. The tubes were centrifuged at 500 × g for 5 min to remove the cells and large debris. The supernatant was collected as the P2 viral stock.

To obtain the OBs from the AcMNPV recombinants, S. exigua larvae were placed on ice for 10 min. The hemocoel of the fourth instar of each S. exigua larva was then injected with 10 μl of P2 BVs at a multiplicity of infection (MOI) of 0.1. The S. exigua larvae were reared on artificial diets at 28°C (30) until they were liquefied. The OBs were collected from the virus-killed cadavers by differential centrifugation (32). A larger number of OBs was obtained by feeding second-instar S. exigua larvae with the OBs collected from the virus-killed cadavers.

Construction of AcMNPV recombinants in which phC95 is fused to EGFP.

The egfp gene was inserted into pUC18 after PCR amplification and digestion with XbaI and PstI, and the resulting recombinant pUC18-egfp plasmid was then verified by XbaI and PstI digestion and sequencing. To generate the donor plasmids, pUC18-egfp was digested with XbaI and PstI, and the egfp product was ligated into pD-phN150-phC95, with the linker sequence at the 3′ end, or into pD-ph (Fig. 2a). The plasmids were confirmed by XbaI/PstI digestion and were called pD-phN150-phC95-egfp and pD-ph-egfp.

To generate the AcBac-phN150-phC95-egfp and AcBac-ph-egfp recombinant bacmids, the pD-phN150-phC95-egfp and pD-ph-egfp donor plasmids were transformed into competent DH10B cells as described above.

OBs from vAcBac-phN150-phC95-egfp and vAcBac-ph-egfp were obtained from S. exigua larvae injected with the corresponding BVs as described above. The collected OBs were used to inoculate second-instar S. exigua larvae to obtain a larger number of OBs.

Construction of AcMNPV recombinants in which phC95 is fused to enhancin and gp37.

The en4 and gp37 genes were separately inserted into pUC18 after PCR amplification, and the resulting recombinants, pUC18-en4 and pUC18-gp37, were then confirmed to be correct by XbaI and PstI digestion and sequencing as described above. To generate the AcBac-phN150-phC95-gp37 and AcBac-phN150-phC95-en4 recombinant bacmids, the donor plasmids pD-phN150-phC95-gp37 and pD-phN150-phC95-en4, respectively, were generated and then transformed into competent DH10B cells as described above. OBs from vAcBac-phN150-phC95-gp37 and vAcBac-phN150-phC95-en4 were obtained by transfecting and infecting Sf9 cells, injecting the resulting BVs into fourth-instar S. exigua larvae, and orally infecting second-instar S. exigua larvae as described above.

Serial passage of recombinant baculoviruses.

Serial passage of the recombinant baculoviruses was conducted according to the method previously described by Shim et al. (15). Briefly, Sf9 cells were infected with the second recombinant baculovirus passage (P2) at an MOI of 0.1. The endpoint dilution method was used to titrate the BVs at 4 days postinfection (33). The Sf9 cells were then infected with the resulting BVs at an MOI of 0.1. Passages 4, 6, 8, 10, 12, and 14 were collected by repeating this step.

PCR assays of genomic DNAs from recombinant AcMNPV OBs collected from virus-killed cadavers.

The OBs from virus-killed cadavers were purified by differential centrifugation (32). Genomic DNA was then extracted from the OBs of recombinant AcMNPV according to the method previously described by Wei et al. (34). A PCR assay with phN-F and phC-R as the primers (Fig. 1a) was used to check whether vAcBac-phN150-phC95 was contaminated with wild-type AcMNPV or vAcBac-ph. The PCR conditions were as follows: 35 cycles of 94°C for 45 s, 56°C for 30 s, and 72°C for 45 s. The presence of egfp, gp37, or en4 in vAcBac-phN150-phC95-egfp, vAcBac-phN150-phC95-gp37, and vAcBac-phN150-phC95-en4 was also verified by PCR, using the specific primer pairs egfp-F/egfp-R, gp37-F/gp37-R, and en4-F/en4-R (Table 1) and subsequent sequencing.

SDS-PAGE and Western blotting.

The protocols for SDS-PAGE and Western blotting were conducted according to the methods described previously by Sparks et al. (8). Briefly, 40 μl of OBs (1 × 10⁷ OBs/ml) was lysed in 10 μl of sample buffer (5× SDS-PAGE buffer) in a boiling water bath for 5 min. A prestained protein ladder (Thermo Scientific, Waltham, MA, USA) and samples were loaded onto two 12% SDS-PAGE gels (one gel was used for Western blotting and the other for SDS-PAGE analysis). After electrophoresis for 90 min, the proteins were transferred to polyvinylidene difluoride (PVDF) membranes (Millipore, Billerica, MA, USA) for 20 min at 20 V. The membranes were blocked overnight in a 5% blocking solution comprising Tris-buffered saline (TBS) plus 5% nonfat dry milk at 4°C and then washed three times in TBS-T buffer solution (50 mmol/liter Tris-Cl, 200 mmol/liter NaCl, 0.1% Tween 20, pH 7.5) for 5 min. The membranes were incubated with primary antibody, i.e., polyclonal anti-polyhedrin (Beyotime, Nantong, China), monoclonal anti-EGFP (Beyotime), polyclonal anti-GP37 (23), or polyclonal anti-En4 (generated in our laboratory), for 1.5 h at 37°C and then subjected to four 10-min washes with TBS-T buffer solution. Next, the membranes were incubated with the corresponding secondary antibodies, namely, goat anti-rabbit or anti-mouse IgG (1:2,000 dilution) conjugated to horseradish peroxidase (Beyotime), for 1.5 h and then subjected to four more 10-min washes with TBS-T buffer solution. Nitro Blue Tetrazolium/5-bromo-4-chloro-3-indolylphosphate (NBT/BCIP) (Beyotime) was used to visualize the signals.

Fluorescence microscopy and TEM.

vAcBac-phN150-phC95-egfp OBs (2 μl; 10⁷ OBs/ml) were dropped onto glass slides, covered with coverslips, and then observed under a fluorescence microscope with 488-nm light excitation.

For TEM, the OBs were purified from larval cadavers according to the method described by Gross et al. (32) and then stored in 40% (vol/vol) glycerol at 4°C prior to analysis. The OBs were then embedded in resin, sectioned, and stained as described previously (35). Stained ultrathin sections were examined with a Hitachi H-800 transmission electron microscope (Hitachi Co., Ltd., Tokyo, Japan) at an accelerating voltage of 200 kV.

Laboratory bioassays.

The droplet-feeding method was used to measure the infectivity of vAcBac-ph and recombinant viruses containing En4 or GP37 according to a previously published procedure (31). Briefly, the vAcBac-ph OBs and the recombinant virus were diluted into five appropriate concentration gradients (1 × 10⁶ OBs/ml, 3 × 10⁵ OBs/ml, 1 × 10⁵ OBs/ml, 3 × 10⁴ OBs/ml, and 1 × 10⁴ OBs/ml) in a 40% sucrose solution with food coloring (erioglaucine disodium salt). Second-instar larvae that had been starved overnight were fed the diluted OBs for 10 min. Larvae that ingested the OB suspension, as judged by the uptake of the blue stain, were transferred to the individual wells of a 24-well tissue culture plate containing fresh artificial diet and then incubated at 27°C (30). Forty-eight larvae were used for each viral treatment at each concentration. The number of dead insects was counted every day until all the larvae died or pupated. The bioassay was performed in duplicate. Probit analysis in R (36) was used to calculate the 50% lethal concentration (LC₅₀) values and the potency ratios of the recombinant viruses (37).