Skip to main content
Oncology Letters logoLink to Oncology Letters
. 2017 May 22;14(1):877–884. doi: 10.3892/ol.2017.6224

Genetic alterations in Japanese extrahepatic biliary tract cancer

Rei Noguchi 1, Kiyoshi Yamaguchi 1, Tsuneo Ikenoue 1, Yumi Terakado 1, Yasunori Ohta 2, Naohide Yamashita 3, Osamu Kainuma 4, Sana Yokoi 5, Yoshiaki Maru 6, Hiroki Nagase 6, Yoichi Furukawa 1,✉
PMCID: PMC5494721  PMID: 28693246

Abstract

Biliary tract cancer (BTC) is one of the most devastating types of malignant neoplasms worldwide. However, the mechanisms underlying the development and progression of BTC remain unresolved. BTC includes extrahepatic bile duct carcinoma (EBDC), gallbladder carcinoma (GBC) and ampulla of Vater carcinoma (AVC), named according to the location of the tumor. Although genetic alterations of intrahepatic cholangiocarcinoma have been investigated, those of EBDC, GBC and AVC have not yet been fully understood. The present study analyzed somatic mutations of 50 cancer-associated genes in 27 Japanese BTC cells, including: 11 EBDC, 14 GBC and 2 AVC. Next-generation sequencing using an Ion AmpliSeq Cancer Panel identified a total of 44 somatic mutations across 14 cancer-associated genes. Among the 44 mutations, 42 were judged as pathological mutations. Frequent mutations were identified in tumor protein 53 (TP53) (14/27), SMAD family member 4 (SMAD4) (6/27), phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit α (PIK3CA) (6/27), and Kirsten rat sarcoma (KRAS) (6/27); no significant differences were identified between EBDC and GBC tissues. Notably, the frequency of the PIK3CA mutation was higher when compared with previous reports. This result may suggest that the activation of the PIK3CA-protein kinase B signaling pathway, in addition to the abrogation of p53, SMAD4 and RAS mitogen-activated protein kinase may have a crucial role in the carcinogenesis of Japanese BTC. These findings may be useful for the development of personalized therapies for BTC.

Keywords: biliary tract cancer, extrahepatic bile duct carcinoma, gallbladder carcinoma, ampulla of Vater carcinoma, somatic mutation, next generation sequencing

Introduction

Biliary tract cancer (BTC) is the sixth most common cause of cancer-associated mortalities in Japan and >18,000 patients succumbed to this disease in 2013 (1). BTC is anatomically classified into three groups: Extrahepatic bile duct carcinoma (EBDC), gallbladder carcinoma (GBC) and ampulla of Vater carcinoma (AVC) (2). Previous epidemiological studies have revealed that the incidence of EBDC is high in Japan and Korea, and that of GBC is high in Chile, Argentina, India, Peru, Ecuador and Eastern Europe, including the Czech Republic and Slovakia (3). The etiology of intrahepatic and extrahepatic cholangiocarcinoma in Thailand is associated with infection by a liver fluke, Opisthorchis viverrini (4,5), whereas BTCs that develop in Japanese patients do not typically involve infection with parasites. Although complete surgical resection of tumors allows for improved prognosis, there are limited cases of its use due to the vast majority of patients who are diagnosed at an advanced cancer stage, with the exception of cases diagnosed incidentally at the time of elective cholecystectomy for gallbladder stones (4). Furthermore, effective molecular-targeted drugs have not yet been developed for BTC (6). Combined chemotherapies using gemcitabine, platinum agents and docetaxel regimens are used for patients with tumors that cannot be removed by resection surgery; however, their efficacies are far from satisfactory (7). The prognosis of patients with advanced BTC remains poor, and the five-year survival rates remain low at 5–15% for advanced stage BTC (8,9). Therefore, the development of effective molecular targeted drugs is a matter of pressing concern.

A number of previous studies have identified that chronic and continuous stimulation of the biliary tract serves a role in the process of carcinogenesis (10). A case-control study of intrahepatic cholangiocarcinoma in the USA demonstrated that choledocholithiasis and cholangitis were risk factors for BTC, with odds ratios of 4.0 and 8.8, respectively (11). In addition, it was reported that choledocholithiasis increased the risk of extrahepatic and intrahepatic cholangiocarcinoma 34-fold and 22.5-fold, respectively, and that cholangitis also increased the risk of extrahepatic and intrahepatic cholangiocarcinoma 45.7-fold and 64.2-fold, respectively (12). Notably, the risk of BTC increases ~400-fold in patients with PSC, in comparison with the general population (13). Additionally, in patients with pancreaticobiliary maljunction (PBM), the incidence of GBC and BTC are ~14.8 and 4.9%, respectively (14). Patients with PBM suffer from frequent refluxes of pancreatic juice into the biliary tract, which causes damage to the epithelium of the biliary tract (14). Chronic inflammation exposes epithelial cells to cytokines and interferons, which causes genotoxic stress through the production of reactive oxygen species (14). Therefore, with the rapid renewal of damaged cells, epithelial cells with genotoxic stresses may happen to acquire unrepaired genetic changes, leading to the accumulation of mutations in oncogenes and tumor suppressor genes, including Kirsten rat sarcoma (KRAS) and tumor protein 53 (TP53) (14).

Numerous previous studies have performed genetic analyses of BTC (15,16), and identified TP53 mutations in 8.2–35.7% of GBC cases (17,18), and KRAS mutations in 2–20% of GBC cases (18). KRAS mutations were identified in 20–67% of EBDC cases (19,20), and in 28.6–37.0% of AVC cases (21–23). Although previous studies have revealed that genetic alterations in TP53 and KRAS are involved in tumorigenesis (24–27), the number of reports of global mutation profiles in BTC is limited.

The present study analyzed genetic alterations in 11 EBDC, 14 GBC and 2 AVC tissues, using an Ion AmpliSeq Cancer Panel and covering 50 cancer-associated genes. The results may be useful for the establishment of personalized therapies, and the development of novel anticancer drugs for this devastating disease.

Materials and methods

This study was approved by the institutional review board of the Institute of Medical Science, University of Tokyo (Tokyo, Japan; approval no. IMSUT-IRB #24-56). Written informed consent was obtained from all patients prior to the study.

Patients and clinical tissues

Tumor tissues and corresponding non-cancerous tissues were obtained from 27 patients with BTC in the Chiba Cancer Center Hospital (Chiba, Japan) and Kanagawa Cancer Center (Yokohama, Japan). The tissues were resected during surgeries that occurred between June 1997 and August 2013, snap frozen in liquid nitrogen, and stored at −80°C until required for DNA extraction. These tissues included 11 with EBDC, 14 with GBC and 2 with AVC, and kept frozen until analysis. The 27 patients included 12 females (44.4%) and 15 males (55.6%), with a median age of 69 years (range, 44–82 years). All tumors were histologically diagnosed as BTC according to the WHO criteria (28). Disease stages were determined according to the UICC Tumor-Node-Metastasis (TNM) system (29). Clinicopathological information is summarized in Table I.

Table I.

Clinicopathological features of the 27 patients with BTC.

Patient ID Age Gender Locationa Maximum tumor size (cm) TNMb Stageb
1 82 M EBDC   6.0 T3N1M0 IIB
2 68 M EBDC   9.0 T1N0M0 IA
3 65 M EBDC 10.0 T1N0M0 IA
4 73 M EBDC 15.0 T1N0M0 IA
5 67 M EBDC   2.7 T1N0M0 IA
6 69 M EBDC   2.0 T2N1M0 IIB
7 61 M EBDC   1.8 T1N1M0 IIB
8 70 F EBDC Unknown T1N1M0 IIB
9 69 M EBDC   4.0 T1N0M0 IA
10 71 M EBDC   1.8 T1N0M0 IA
11 65 M EBDC   5.0 T1N0M0 IA
12 69 M GBC   6.5 T3N0M0 IIA
13 74 M GBC   3.6 T1N1M0 IIB
14 62 F GBC   5.5 T1N1M0 IIB
15 80 F GBC   3.0 T1N0M0 IA
16 73 F GBC   3.5 T2N0M0 IB
17 71 F GBC   8.5 T1N0M0 IA
18 70 M GBC Unknown T1N0M0 IA
19 71 F GBC   3.0 T1N0M0 IA
21 65 M GBC   2.3 T4N0M0 III
20 58 F GBC   5.5 T2N0M0 IB
22 76 F GBC   6.0 T4N1M0 III
23 48 M GBC   5.0 T1N0M0 IA
24 49 F GBC   3.0 T2N0M0 IB
25 44 F GBC   3.5 T2N1M0 IIB
26 66 F AVC   5.0 T3N1M0 IIB
27 70 F AVC   4.0 T4N0M0 III
a

EBDC, extrahepatic bile duct carcinoma; GBC, gallbladder carcinoma; AVC, Ampulla of Vater carcinoma; BTC, biliary tract cancer.

b

TNM and stage were determined based on the international union against cancer staging system.

Extraction and quantification of DNA

Frozen tissue sections (10 µm in thickness) of tumorous and non-tumorous tissues were fixed in ice cold 4% formalin for 10 min, washed using water for 5 min and subsequently stained with hematoxylin. Tumorous and non-tumorous cells were collected from the hematoxylin-stained tissue sections. Genomic DNA was extracted from the cells using a QIAamp DNA formalin-fixed, paraffin-embedded tissue kit (Qiagen GmbH, Hilden, Germany), according to the protocol of the manufacturer. The concentration of DNA was measured by e-SPECT (Malcom, Tokyo, Japan) and a Qubit2 fluorometer (Invitrogen; Thermo Fisher Scientific Inc., Waltham, MA, USA). All genomic DNA was stored at −20°C until use.

Multiplex polymerase chain reaction (PCR) and DNA sequencing

A total of 10 ng DNA was used for multiplex PCR amplification of a panel covering 207 areas in 50 cancer-associated genes, including: ABL1, AKT1, ALK, APC, ATM, BRAF, CDH1, CDKN2A, CBF1R, CTNNB1, EGFR, ERBB2, ERBB4, EZH2, FBXW7, FGFR1, FGFR2, FGFR3, FLT3, GNA11, GNAQ, GNAS, HNF1A, HRAS, IDH1, IDH2, JAK2, JAK3, KDR, KIT, KRAS, MET, MLH1, MPL, NOTCH1, NPM1, NRAS, PDGFRA, phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit α (PIK3CA), PTEN, PTPN11, RB1, RET, SMAD family member 4 (SMAD4), SMARCB1, SMO, SRC, STK11, TP53 and VHL (Ion AmpliSeq Cancer Panel v2; Thermo Fisher Scientific, Inc.). The library construction and subsequent enrichment of the paired DNA samples was performed using an Ion OneTouch system (Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. Sequencing was performed on a 316 chip with a capacity of 300–500 megabases, using the Ion PGM™ System (Thermo Fisher Scientific, Inc.). Sequencing reads were mapped to the University of California, Santa Cruz (UCSC) human genome (GRCh37/hg19) using Torrent Suite™ software (version 4.0.2; Thermo Fisher Scientific, Inc.).

Variant calling and classification of somatic mutations

Sequence data were analyzed using Variant Caller™ (version 4.0-r76860) and Ion Reporter™ (version 4.0-r77897; both Thermo Fisher Scientific, Inc.). Calls of single nucleotide variants (SNV) <2%, and calls of insertions and deletions (indels) <5% in tumor tissues were excluded from further analysis. Calls at positions with sequence coverage >50 reads in tumorous and non-tumorous cells were analyzed, and those present in the tumor sample but not in the matched normal sample, were regarded as somatic mutations. Fisher's exact test was carried out for the variants present in the tumor and corresponding normal tissue, and those detected with a significantly higher frequency (P<0.01) in tumor tissues than the matched normal controls were classified as somatic mutations. All somatic mutations were reviewed by the Integrative Genomic Viewer (IGV; version 2.3; Broad Institute, Cambridge, MA, USA).

According to their locations, somatic mutations were classified into three groups as follows: Intronic, splice site and exonic mutations. The exonic mutations were further divided into four types, namely exonic indels, nonsense, synonymous and non-synonymous mutations. The pathological significance of the mutations was evaluated using several databases: ClinVar, COSMIC, ONCOMINE, Human Gene Mutation Database (HGMD), Leiden Open Variation Database (LOVD) in International Society for Gastrointestinal Hereditary Tumors (InSiGHT), TP53 Database in International Agency for Research on Cancer (IARC), dbSNP and Human Genetic Variation Database (HGVD) in Kyoto University. Mutations reported to play a role in tumorigenesis, and those regarded as deleterious in the ClinVar, COSMIC, ONCOMINE, HGMD, LOVD and TP53 databases, were judged as pathological mutations. In addition, nonsense mutations, splice site mutations and exonic indels were included as pathological mutations. Among the remaining mutations, missense mutations were evaluated using three prediction tools: SIFT, PolyPhen and PANTHER. In the present study, those predicted to be damaged, deleterious or pathological by all three methods were considered as pathological mutations, and other missense mutations as variants of uncertain significance (VUS). The remaining synonymous mutations were regarded as non-pathological alterations.

Statistical analysis

Statistical differences were analyzed using the Fisher's exact test. For the detection of somatic mutations, P<0.01 was considered to indicate a statistically significant difference for the comparison between normal and cancerous tissues. For the comparison of mutation profiles between EBDCs and GBCs, P<0.05 was considered to indicate a significant difference.

Results

Genetic analysis

Genetic analysis of the 27 tumors and matched normal tissues was performed by amplicon sequencing. The average sequence throughput per sample was ~26 Mb, and the average number of reads per amplicon was 1,099. Among the 207 regions analyzed, all regions (207/207) were covered by ≥100 reads on average, and 86.9% of all the amplicons were covered by ~500 reads. Subsequent mutation analysis using Valiant Caller™ and Ion Reporter™ detected a total of 92 variant calls that were candidates for somatic mutations. However, 37 of the 92 calls were filtered out for further analysis as no significant differences were identified (P>0.01) in matched normal tissues, and the frequency was not statistically different between the tumors and noncancerous tissues. Among the remaining 55 alterations, 11 variants were located within homopoloymers, which were identified as miscalls by reviewing with IGV. Finally, 44 variants were judged to be somatic mutations. Among the 44 mutations, 42 were located in exons and the two in splice sites. The exonic mutations were comprised of 38 non-synonymous, 2 synonymous, 1 deletion and 1 insertion. The two synonymous mutations were identified as non-pathological, as they did not induce amino acid changes or were not predicted to cause aberrant splicing.

Among the 42 mutations, the most frequently mutated gene was TP53 (14/27) and the second was PIK3CA (6/27), followed by: KRAS (6/27), SMAD4 (6/27), RB1 (2/27), APC (1/27), ATM (1/27), CDKN2A (1/27), CTNNB1 (1/27), KIT (1/27), NRAS (1/27), SMO (1/27) and VHL (1/27; Table II). All 14 TP53 mutations are included in the IARC TP53 database (R17). The six PIK3CA mutations, including one p.E542 K, four p.E545Ks and one p.Q546K, were reported to be oncogenic mutations (30), and are repeatedly observed in the COSMIC database (v74). Five of the six KRAS mutations are activating mutations (p.G12D, p.G12R and p.G13D), and are located at codon 12 or codon 13, the two major hot spots (24,25). Although the single remaining missense mutation (p.L19F) is located outside of the hot spots, this mutation was reported to exhibit oncogenic activities (31). Therefore, it was considered to be a pathological mutation. The six SMAD4 mutations included: One nonsense mutation, one 24-bp deletion and four missense mutations (p.D351H, p.G352E, p.R361H and p.A532D). Two of the four mutations (p.D351H and p.R361H) are well-known pathological mutations, and the other two missense mutations (p.G352E and p.A532D) are relatively infrequent mutations. The presence of p.G352E was reported in colorectal cancer (32), squamous cell lung cancer (33) and pancreatic cancer in the COSMIC (v74) database (34); p.A532D was identified in colorectal and pancreatic cancer in the COSMIC (v74) database (35). These two mutations were identified as pathological mutations following in silico analysis, including SIFT, PolyPhen and PANTHER. Finally, it was judged that all SMAD4 mutations may result in the loss of SMAD4 function, and that they may have a vital role in tumorigenesis.

Table II.

List of the somatic mutations.

Gene Nucleotide Amino acid Type of mutation Pathogenicity Evidence of pathogenicitya Number of cases
TP53 c.293_294insA p.P98Pfs50X Insertion Pathological IARC 1
c.329G>T p.R110L Missense Pathological IARC, CSMC 1
c.451C>G p.P151A Missense Pathological ONC, IARC, CSMC 1
c.473G>C p.R158P Missense Pathological ONC, IARC, CSMC 1
c.493C>T p.Q165X Nonsense Pathological IARC, CSMC 1
c.574C>T p.Q192X Nonsense Pathological ONC, IARC, CSMC 1
c.613T>G p.Y205D Missense Pathological ONC, IARC, CSMC 1
c.614A>G p.Y205C Missense Pathological ONC, IARC, CSMC 1
c.853G>A p.E285K Missense Pathological IARC, CSMC 1
c.994-1G>A – Splice site Pathological SPL, IARC, CSMC 1
c.1024C>T p.R342X Nonsense Pathological NS, IARC, CSMC 1
c.839G>A p.R280K Missense Pathological ONC, IARC, CSMC 1
c.824G>A p.C275Y Missense Pathological ONC, IARC, CSMC 1
c.721T>C p.S241P Missense Pathological ONC, IARC, CSMC 1
PIK3CA c.1623T>C p.S541= Synonymous Non-pathological – 1
c.1624G>A p.E542K Missense Pathological dbSNP, ONC, CSMC 1
c.1633G>A p.E545K Missense Pathological dbSNP, ONC, CSMC 4
c.1636C>A p.Q546K Missense Pathological dbSNP, CSMC 1
SMAD4 c.346C>T p.Q116X Nonsense Pathological NS, CSMC 1
c.535_558delATTCAAACCATCCAGCATCCACCA p.I179_P186del Deletion Pathological INDEL 1
c.1051G>C p.D351H Missense Pathological ONC, IS, CSMC 1
c.1055G>A p.G352E Missense Pathological dbSNP, CSMC, Rep 1
c.1082G>A p.R361H Missense Pathological dbSNP, ONC, CSMC 1
c.1595C>A p.A532D Missense Pathological CSMC, Rep, IS 1
KRAS c.34G>C p.G12R Missense Pathological dbSNP, ONC, CSMC 1
c.35G>A p.G12D Missense Pathological dbSNP, ONC, CSMC 3
c.38G>A p.G13D Missense Pathological dbSNP, ONC, CSMC 1
c.57G>T p.L19F Missense Pathological Rep, CSMC 1
NRAS c.181C>A p.Q61K Missense Pathological dbSNP, ONC, CSMC 1
CDKN2A c.358G>T p.E120X Nonsense Pathological NS, CSMC 1
RB1 c.596T>A p.L199X Nonsense Pathological NS, CSMC 1
c.607+2T>G – Splice site Pathological SPL 1
APC c.4339C>T p.Q1447X Nonsense Pathological NS, CSMC 1
CTNNB1 c.134C>T p.S45F Missense Pathological dbSNP, CSMC 1
KIT c.2411G>A p.R804Q Missense Pathological IS 1
SMO c.961G>A p.V321M Missense Pathological CSMC, IS 1
ATM c.1044G>C p.L348F Missense Pathological IS 1
FLT3 c.1746C>T p.T582= Synonymous Non-pathological – 1
VHL c.286C>T p.Q96X Nonsense Pathological NS, CSMC 1

IARC, international agency for research on cancer; CSMC, COSMIC; TP53, tumor protein 53; ONC, oncology; PIK3CA, phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit α; dbSNP, single nucleotide polymorphism database; SMAD4, SMAD4 family member 4; SPL, splice site mutations; NS, nonsense mutations; INDEL, exonic insertions/deletions; Rep, reports; IS, in silico analyses; KRAS, Kirsten rat sarcoma; NRAS, neuroblastoma RAS viral oncogene homolog; CDKN2A, cyclin-dependent kinase inhibitor 2A; RB1, retinoblastoma 1; APC, adenomatous poylyposis coli; CTNNB1, catenin β-1; KIT, KIT proto-oncogene receptor tyrosine kinase; SMO, Smoothened frizzled class receptor; ATM, ataxia-telangiectasita mutated; FLT3, FMS-related tyrosine kinase 3; VHL, von Hippel-Lindau tumor suppressor.

a

Evidence of pathogenicity is judged from i) the type of mutation including nonsense mutations (NS); splice site mutations (SPL) and exonic indels (INDEL); ii) reports (Rep); iii) databases including ONCOMINE (ONC), dbSNP (dbSNP), TP53 database in international agency for research on cancer (IARC) and COSMIC (CSMC); and iv) in silico analyses (IS).

The present study identified a KIT mutation (c.2411G>A, p.R804Q) that had not been reported in previous studies or public databases. In silico analysis predicted that this was a pathological mutation; possibly damaged (score: 1) by PolyPhen, deleterious (score: 0.01) by SIFT and deleterious (subPSEC: −3.301; Pdeterious: 0.575) by PANTHER. As a result, 42/44 mutations were identified to be pathological.

Mutation profiles of EBDCs and GBCs

Mutation profiles between the 11 EBDC and the 14 GBC samples were compared further. It is of note that TP53, KRAS, PIK3CA and SMAD4 mutations were observed in the two types of tumors (Table III). No significant differences (P>0.05) were identified between the frequencies of mutations of the four genes in the various types of cancer tumors.

Table III.

Mutation profile of 27 BTCs.

Gene name Total n=27 (%) EBDC n=11 (%) GBC n=14 (%) AVC n=2 (%)
TP53 14 (51.9) 5 (45.5) 9 (64.3) 0 (0)
SMAD4   6 (22.2) 3 (27.3) 2 (14.3) 1 (50)
PIK3CA   6 (22.2) 3 (27.3) 3 (21.4) 0 (0)
KRAS   6 (22.2) 3 (27.3) 2 (14.3) 1 (50)
NRAS   1 (3.7) 1 (9.1) 0 (0) 0 (0)
CDKN2A   1 (3.7) 0 (0) 1 (7.1) 0 (0)
RB1   2 (7.4) 1 (9.1) 1 (7.1) 0 (0)
APC   1 (3.7) 1 (9.1) 0 (0) 0 (0)
CTNNB1   1 (3.7) 1 (9.1) 0 (0) 0 (0)
ATM   1 (3.7) 0 (0) 1 (7.1) 0 (0)
KIT   1 (3.7) 1 (9.1) 0 (0) 0 (0)
SMO   1 (3.7) 1 (9.1) 0 (0) 0 (0)
VHL   1 (3.7) 0 (0) 1 (7.1) 0 (0)

TP53, tumor protein 53; SMAD4, SMAD family member 4; PIK3CA, phosphatidylinositol 3-kinase catalytic alpha; KRAS, Kirsten rat sarcoma; NRAS, neuroblastoma RAS viral oncogene homolog; CDKN2A, cyclin-dependent kinase inhibitor 2A; RB1, retinoblastoma 1; APC, adenomatous polyposis coli; CTNNB1, catenin β-1; ATM, ataxia-telangiectasia mutated gene; KIT, KIT proto-oncogene receptor tyrosine kinase; SMO, smoothened, frizzled class receptor; VHL, von Hippel-Lindau tumor suppressor.

Discussion

The current study performed a genetic analysis of 27 BTC tissue samples consisting of: 11 EBDC, 14 GBC and 2 AVC. Using NGS, it was discovered that the tumors frequently carry mutations in TP53, KRAS, PIK3CA and SMAD4.

TP53 mutations in 45.6% of EBDC and 64.3% of GBC tissue samples were identified. These frequencies are consistent with previous studies for Caucasian EBDC (17.5–75%) (16,36,37) and GBC (46.2–63%) (15,36,38). Additionally, the frequencies of KRAS mutations in Japanese EBDC (27.2%) and GBC (14.3%) are in agreement with previous studies (16,19,20,36,37). Notably, an NRAS mutation was identified in a tumor without KRAS mutation, corroborating mutual exclusiveness between the mutations in KRAS and NRAS. In total, TP53 and KRAS mutations in 14 and 7 of the 27 tumors, respectively, were identified, suggesting that the inactivation of TP53 and activation of the RAS-MAPK pathway serve a crucial role in biliary tract carcinogenesis.

Notably, the present study revealed relatively high frequency (22.2%) of PIK3CA mutations in Japanese BTCs, compared with previous reports (15,16,18,23,36,37,39–41). In Caucasian BTC, the frequencies of PIK3CA mutation are limited (16,23,36,37). Simbolo et al (36) identified a PIK3CA mutation in 5/57 (8.8%) of EBDC samples. By contrast, a number of previous studies did not identify any PIK3CA mutations in EBDC (16,37). Regarding GBC, numerous previous studies revealed PIK3CA mutations at frequencies of 7.7% and 5.9% (36). These results may suggest that mechanisms underlying the pathogenesis of BTC vary between Japanese and Caucasian populations. In addition, molecular agents targeted to the activated PI3K/AKT signaling pathway may be more applicable for Japanese patients with BTC, as compared with Caucasian patients.

The present study identified six SMAD4 mutations, including: One nonsense mutation, one in-frame deletion and four missense mutations (p.D351H, p.G352E, p.R361H and p.A532D). SMAD4 is a tumor suppressor gene containing two evolutionarily conserved regions as follows: Mad homology 1 and 2 domains (MH1 and MH2, respectively) (42,43). The four mutations, p.D351H, p.G352E, p.R361H and p.A532D, are located in the MH2 domain (codon 319–552), which serves an important role in heteromerization and transactivation functions (43). The mutations at codons 351 and 361 are frequently reported (43). The two residues, Asp351 and Arg361, are located in the loop-helix region of SMAD4, and are involved in the interaction with Asp450 in SMAD2 (43). Therefore, these mutations may change the loop-helix structure, disrupting the heterodimerization between SMAD2 and SMAD4. Mutations at codons 352 and 532 are relatively infrequent (43); a total of 10 cases of a mutation at codon 352 and three cases at codon 532 are present in the COSMIC database. Although p.G352E is one of the ten cases, it was identified as a pathological mutation as the germ line p.G352E mutation has been reported in patients with juvenile polyposis and hereditary hemorrhagic telangiectasia (44). Although Ala532 is located outside of mutation cluster region (MCR) between codons 330 and 370, it is within the three-helix bundle (codon 445–540), which is reported to be functionally important (45). Missense mutations at Ala532 are assumed to disrupt the packing between the three-helix bundle and the β-sandwich (45). Additionally, in silico analysis of the mutation using the three algorithms identified it to be a pathological mutation. Therefore, p.A532D was considered to be a pathological mutation.

In the present study, fewer frequencies of mutations were identified in tyrosine kinase receptor (TKR) genes than other studies (36). The mutations in TKRs, including ALK, EGFR, ERBB2, ERBB4, FGFR3, MET, KIT, KDR and VEGFR2, were reported with a higher prevalence in GBCs (6/26; 23.1%), compared with intrahepatic bile duct carcinoma IHBDCs (4/70; 5.7%) and EBDCs (4/57; 7.0%) (36). Although amplicon sequencing covering these genes was carried out, alterations were not detected in the BTC samples used in the present study. Therefore, the mechanisms underlying Japanese BTC may differ from Caucasian BTC, and therapeutic drugs for Japanese patients must be selected according to the specific mutations in their tumors.

The present study identified two RB1 mutations in an EBDC and a GBC tissue sample. However, previous studies did not detect any RB1 mutations in EBDC (16,36,37). Additionally, a CDKN2A mutation was revealed in one GBC. CDKN2A serves a role in cell cycle regulation through the inhibition of cyclin dependent kinases (CDK), including CDK4 and CDK6, and acts as a tumor suppressor gene in melanoma (46), esophageal cancer (47) and pancreatic cancer (48). In combination with cyclins, CDK4 and CDK6 phosphorylate the retinoblastoma protein (RB), which results in the transactivation of E2F transcription factors (49). The data suggest that disrupted cell cycle regulation at the G1-S transition is involved in the tumorigenesis of Japanese BTC. Furthermore, immunohistochemical staining demonstrated loss of p16 (CDKN2A) expression in 74.1% (20/27) of GBC tissues, and loss of pRB expression in 3.7% (1/27) of GBC tissues (50). Recently, the FDA approved palbociclib, an inhibitor of CDK4/6, for the treatment of patients with HR-negative and HER2-negative metastatic breast cancer (51). Notably, a melanoma cell line with mutations in CDKN2A was predicted to be sensitive to the CDK4/6 inhibitor (52). Therefore, patients with BTC carrying a CDKN2A mutation are expected to benefit from the use of palbociclib.

In addition, a nonsense mutation of VHL, p.Q96X, was identified in one GBC case. VHL is a tumor suppressor gene responsible for the hereditary disease, von Hippel Lindau syndrome. Inactivation of VHL by mutation, deletion or hypermethylation, is frequently observed in renal cell carcinomas (RCC) (53). In the COSMIC (v74) database, p.Q96X has been reported in 10 cases, including nine RCCs (54,55) and one hemangioblastoma. Although mutations of VHL have been less frequently reported in BTC than RCC, immunohistochemical staining revealed decreased VHL expression levels in (31/33; 93.9%) of GBC cases (56). Genetic alterations induce loss of VHL, which increases survival rate through the increased expression of VEGF, PDGF, TGF-β, GLUT1 and FGF genes (57). Patients suffering from RCC with a VHL mutation are often treated by tyrosine kinase inhibitors, anti-vascular endothelial growth factor (VGF) antibodies and mechanistic target of rapamycin inhibitors (58). Therefore, patients with BTC and a VHL mutation may also benefit from these three treatments.

In conclusion, it was revealed in the present study that TP53, RAS family genes, PIK3CA and/or SMAD4 are frequently mutated in Japanese BTC. In addition, it was revealed that PIK3CA mutations are more frequently identified in Japanese BTC than Caucasian BTC, suggesting that the PI3K-AKT signaling pathway may have a crucial role in the tumorigenesis of Japanese BTC. The data may be useful not only for the comprehensive understanding of tumorigenesis, but also for the development of personalized therapies for this type of tumor.

Acknowledgements

The authors thank Ms. Seira Hatakeyama, Mrs. Yuko Yamaguchi and Mrs. Nozomi Yusa for their excellent technical assistance. This study was supported by the Grant-in-Aid (grant no. 25280105) from the Japan Society for the Promotion of Science.

References

  • 1.Miyazaki M, Ohtsuka M, Miyakawa S, Nagino M, Yamamoto M, Kokudo N, Sano K, Endo I, Unno M, Chijiiwa K, et al. Classification of biliary tract cancers established by the Japanese Society of Hepato-Biliary-Pancreatic Surgery: 3(rd) English edition. J Hepatobiliary Pancreat Sci. 2015;22:181–196. doi: 10.1002/jhbp.211. [DOI] [PubMed] [Google Scholar]
  • 2.Castro FA, Koshiol J, Hsing AW, Devesa SS. Biliary tract cancer incidence in the United States-Demographic and temporal variations by anatomic site. Int J Cancer. 2013;133:1664–1671. doi: 10.1002/ijc.28161. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Randi G, Malvezzi M, Levi F, Ferlay J, Negri E, Franceschi S, La Vecchia C. Epidemiology of biliary tract cancers: An update. Ann Oncol. 2009;20:146–159. doi: 10.1093/annonc/mdn533. [DOI] [PubMed] [Google Scholar]
  • 4.Ong CK, Subimerb C, Pairojkul C, Wongkham S, Cutcutache I, Yu W, McPherson JR, Allen GE, Ng CC, Wong BH, et al. Exome sequencing of liver fluke-associated cholangiocarcinoma. Nat Genet. 2012;44:690–693. doi: 10.1038/ng.2273. [DOI] [PubMed] [Google Scholar]
  • 5.Chan-on W, Nairismägi ML, Ong CK, Lim WK, Dima S, Pairojkul C, Lim KH, McPherson JR, Cutcutache I, Heng HL, et al. Exome sequencing identifies distinct mutational patterns in liver fluke-related and non-infection-related bile duct cancers. Nat Genet. 2013;45:1474–1478. doi: 10.1038/ng.2806. [DOI] [PubMed] [Google Scholar]
  • 6.Okusaka T, Nakachi K, Fukutomi A, Mizuno N, Ohkawa S, Funakoshi A, Nagino M, Kondo S, Nagaoka S, Funai J, et al. Gemcitabine alone or in combination with cisplatin in patients with biliary tract cancer: A comparative multicentre study in Japan. Br J Cancer. 2010;103:469–474. doi: 10.1038/sj.bjc.6605779. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Valle J, Wasan H, Palmer DH, Cunningham D, Anthoney A, Maraveyas A, Madhusudan S, Iveson T, Hughes S, Pereira SP, et al. Cisplatin plus gemcitabine versus gemcitabine for biliary tract cancer. N Engl J Med. 2010;362:1273–6981. doi: 10.1056/NEJMoa0908721. [DOI] [PubMed] [Google Scholar]
  • 8.Anderson CD, Pinson CW, Berlin J, Chari RS. Diagnosis and treatment of cholangiocarcinoma. Oncologist. 2004;9:43–57. doi: 10.1634/theoncologist.9-1-43. [DOI] [PubMed] [Google Scholar]
  • 9.DeOliveira ML, Cunningham SC, Cameron JL, Kamangar F, Winter JM, Lillemoe KD, Choti MA, Yeo CJ, Schulick RD. Cholangiocarcinoma: Thirty-one-year experience with 564 patients at a single institution. Ann Surg. 2007;245:755–762. doi: 10.1097/01.sla.0000251366.62632.d3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Lazaridis KN, Gores GJ. Cholangiocarcinoma. Gastroenterology. 2005;128:1655–1667. doi: 10.1053/j.gastro.2005.03.040. [DOI] [PubMed] [Google Scholar]
  • 11.Shaib YH, El-Serag HB, Davila JA, Morgan R, McGlynn KA. Risk factors of intrahepatic cholangiocarcinoma in the United States: A case-control study. Gastroenterology. 2005;128:620–626. doi: 10.1053/j.gastro.2004.12.048. [DOI] [PubMed] [Google Scholar]
  • 12.Welzel TM, Graubard BI, El-Serag HB, Shaib YH, Hsing AW, Davila JA, McGlynn KA. Risk factors for intrahepatic and extrahepatic cholangiocarcinoma in the United States: A population-based case-control study. Clin Gastroenterol Hepatol. 2007;5:1221–1228. doi: 10.1016/j.cgh.2007.05.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Boonstra K, Weersma RK, van Erpecum KJ, Rauws EA, Spanier BW, Poen AC, van Nieuwkerk KM, Drenth JP, Witteman BJ, Tuynman HA, et al. Population-based epidemiology, malignancy risk, and outcome of primary sclerosing cholangitis. Hepatology. 2013;58:2045–2055. doi: 10.1002/hep.26565. [DOI] [PubMed] [Google Scholar]
  • 14.Funabiki T, Matsubara T, Miyakawa S, Ishihara S. Pancreaticobiliary maljunction and carcinogenesis to biliary and pancreatic malignancy. Langenbecks Arch Surg. 2009;394:159–169. doi: 10.1007/s00423-008-0336-0. [DOI] [PubMed] [Google Scholar]
  • 15.Jiao Y, Pawlik TM, Anders RA, Selaru FM, Streppel MM, Lucas DJ, Niknafs N, Guthrie VB, Maitra A, Argani P, et al. Exome sequencing identifies frequent inactivating mutations in BAP1, ARID1A and PBRM1 in intrahepatic cholangiocarcinomas. Nat Genet. 2013;45:1470–1473. doi: 10.1038/ng.2813. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Churi CR, Shroff R, Wang Y, Rashid A, Kang HC, Weatherly J, Zuo M, Zinner R, Hong D, Meric-Bernstam F, et al. Mutation Profiling in Cholangiocarcinoma: Prognostic and Therapeutic Implications. PLoS One. 2014;9:e115383. doi: 10.1371/journal.pone.0115383. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Kim YT, Kim J, Jang YH, Lee WJ, Ryu JK, Park YK, Kim SW, Kim WH, Yoon YB, Kim CY. Genetic alterations in gallbladder adenoma, dysplasia and carcinoma. Cancer Lett. 2001;169:59–68. doi: 10.1016/S0304-3835(01)00562-6. [DOI] [PubMed] [Google Scholar]
  • 18.Kumari N, Corless CL, Warrick A, Beadling C, Nelson D, Neff T, Krishnani N, Kapoor VK. Mutation profiling in gallbladder cancer in Indian population. Indian J Pathol Microbiol. 2014;57:9–12. doi: 10.4103/0377-4929.130849. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Chang YT, Chang MC, Huang KW, Tung CC, Hsu C, Wong JM. Clinicopathological and prognostic significances of EGFR KRAS and BRAF mutations in biliary tract carcinomas in Taiwan. J Gastroenterol Hepatol. 2014;29:1119–1125. doi: 10.1111/jgh.12505. [DOI] [PubMed] [Google Scholar]
  • 20.Ohashi K, Tsutsumi M, Nakajima Y, Noguchi O, Okita S, Kitada H, Tsujiuchi T, Kobayashi E, Nakano H, Konishi Y. High rates of Ki-ras point mutation in both intra- and extra-hepatic cholangiocarcinomas. Jpn J Clin Oncol. 1994;24:305–310. [PubMed] [Google Scholar]
  • 21.Schönleben F, Qiu W, Allendorf JD, Chabot JA, Remotti HE, Su GH. Molecular analysis of PIK3CA, BRAF, and RAS oncogenes in periampullary and ampullary adenomas and carcinomas. J Gastrointest Surg. 2009;13:1510–1516. doi: 10.1007/s11605-009-0917-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Howe JR, Klimstra DS, Cordon-Cardo C, Paty PB, Park PY, Brennan MF. K-ras mutation in adenomas and carcinomas of the ampulla of vater. Clin Cancer Res. 1997;3:129–133. [PubMed] [Google Scholar]
  • 23.Matsubayashi H, Watanabe H, Yamaguchi T, Ajioka Y, Nishikura K, Kijima H, Saito T. Differences in mucus and K-ras mutation in relation to phenotypes of tumors of the papilla of vater. Cancer. 1999;86:596–607. doi: 10.1002/(SICI)1097-0142(19990815)86:4<596::AID-CNCR8>3.3.CO;2-8. [DOI] [PubMed] [Google Scholar]
  • 24.Vogelstein B, Fearon ER, Hamilton SR, Kern SE, Preisinger AC, Leppert M, Nakamura Y, White R, Smits AM, Bos JL. Genetic alterations during colorectal-tumor development. N Engl J Med. 1988;319:525–532. doi: 10.1056/NEJM198809013190901. [DOI] [PubMed] [Google Scholar]
  • 25.Bos JL. Ras oncogenes in human cancer: A review. Cancer Res. 1989;49:4682–4699. [PubMed] [Google Scholar]
  • 26.Bártek J, Bártkova J, Vojtĕsek B, Stasková Z, Rejthar A, Kovarík J, Lane DP. Patterns of expression of the p53 tumour suppressor in human breast tissues and tumours in situ and in vitro. Int J Cancer. 1990;46:839–844. doi: 10.1002/ijc.2910460515. [DOI] [PubMed] [Google Scholar]
  • 27.Iggo R, Gatter K, Bartek J, Lane D, Harris AL. Increased expression of mutant forms of p53 oncogene in primary lung cancer. Lancet. 1990;335:675–679. doi: 10.1016/0140-6736(90)90801-B. [DOI] [PubMed] [Google Scholar]
  • 28.Khan SA, Davidson BR, Goldin R, Pereira SP, Rosenberg WM, Taylor-Robinson SD, Thillainayagam AV, Thomas HC, Thursz MR, Wasan H. British Society of Gastroenterology: Guidelines for the diagnosis and treatment of cholangiocarcinoma: Consensus document. Gut. 2002;51(Suppl 6):VI1–9. doi: 10.1136/gut.51.suppl_6.vi1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Sobin MG Leslie, Wittekind Christian. International Union Against Cancer, ‘TNM Classification of Malignant Tumours’. 7th. WILEY-BLACKWELL, Inc.; 2009. [Google Scholar]
  • 30.Samuels Y, Wang Z, Bardelli A, Silliman N, Ptak J, Szabo S, Yan H, Gazdar A, Powell SM, Riggins GJ, et al. High frequency of mutations of the PIK3CA gene in human cancers. Science. 2004;304:554. doi: 10.1126/science.1096502. [DOI] [PubMed] [Google Scholar]
  • 31.Akagi K, Uchibori R, Yamaguchi K, Kurosawa K, Tanaka Y, Kozu T. Characterization of a novel oncogenic K-ras mutation in colon cancer. Biochem Biophys Res Commun. 2007;352:728–732. doi: 10.1016/j.bbrc.2006.11.091. [DOI] [PubMed] [Google Scholar]
  • 32.Tan IB, Malik S, Ramnarayanan K, McPherson JR, Ho DL, Suzuki Y, Ng SB, Yan S, Lim KH, Koh D, et al. High-depth sequencing of over 750 genes supports linear progression of primary tumors and metastases in most patients with liver-limited metastatic colorectal cancer. Genome Biol. 2015;16:32. doi: 10.1186/s13059-015-0589-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Paik PK, Shen R, Won H, Rekhtman N, Wang L, Sima CS, Arora A, Seshan V, Ladanyi M, Berger MF, Kris MG. Next-generation sequencing of stage iv squamous cell lung cancers reveals an association of PI3K aberrations and evidence of clonal heterogeneity in patients with brain metastases. Cancer Discov. 2015;5:610–621. doi: 10.1158/2159-8290.CD-14-1129. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.http://cancer.sanger.ac.uk/cosmic/mutation/overview?id=4806745 COSMIC_database_SMAD4_p.G352E.
  • 35.http://cancer.sanger.ac.uk/cosmic/mutation/overview?id=1389109 COSMIC_database_SMAD4_p.A532D.
  • 36.Simbolo M, Fassan M, Ruzzenente A, Mafficini A, Wood LD, Corbo V, Melisi D, Malleo G, Vicentini C, Malpeli G, et al. Multigene mutational profiling of cholangiocarcinomas identifies actionable molecular subgroups. Oncotarget. 2014;5:2839–2852. doi: 10.18632/oncotarget.1943. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Putra J, De Abreu FB, Peterson JD, Pipas JM, Mody K, Amos CI, Tsongalis GJ, Suriawinata AA. Molecular profiling of intrahepatic and extrahepatic cholangiocarcinoma using next generation sequencing. Exp Mol Pathol. 2015;99:240–244. doi: 10.1016/j.yexmp.2015.07.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Wang H, Zhou H, Liu A, Guo X, Yang CS. Genetic analysis of colon tumors induced by a dietary carcinogen PhIP in CYP1A humanized mice: Identification of mutation of β-catenin/Ctnnb1 as the driver gene for the carcinogenesis. Mol Carcinog. 2015;54:1264–1274. doi: 10.1002/mc.22199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Voss JS, Holtegaard LM, Kerr SE, Fritcher EG, Roberts LR, Gores GJ, Zhang J, Highsmith WE, Halling KC, Kipp BR. Molecular profiling of cholangiocarcinoma shows potential for targeted therapy treatment decisions. Hum Pathol. 2013;44:1216–1222. doi: 10.1016/j.humpath.2012.11.006. [DOI] [PubMed] [Google Scholar]
  • 40.Li M, Zhang Z, Li X, Ye J, Wu X, Tan Z, Liu C, Shen B, Wang XA, Wu W, et al. Whole-exome and targeted gene sequencing of gallbladder carcinoma identifies recurrent mutations in the ErbB pathway. Nat Genet. 2014;46:872–876. doi: 10.1038/ng.3030. [DOI] [PubMed] [Google Scholar]
  • 41.Ross JS, Wang K, Gay L, Al-Rohil R, Rand JV, Jones DM, Lee HJ, Sheehan CE, Otto GA, Palmer G, et al. New routes to targeted therapy of intrahepatic cholangiocarcinomas revealed by next-generation sequencing. Oncologist. 2014;19:235–242. doi: 10.1634/theoncologist.2013-0352. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Brown KA, Pietenpol JA, Moses HL. A tale of two proteins: Differential roles and regulation of Smad2 and Smad3 in TGF-beta signaling. J Cell Biochem. 2007;101:9–33. doi: 10.1002/jcb.21255. [DOI] [PubMed] [Google Scholar]
  • 43.Fleming NI, Jorissen RN, Mouradov D, Christie M, Sakthianandeswaren A, Palmieri M, Day F, Li S, Tsui C, Lipton L, et al. SMAD2, SMAD3 and SMAD4 mutations in colorectal cancer. Cancer Res. 2013;73:725–735. doi: 10.1158/0008-5472.CAN-12-2706. [DOI] [PubMed] [Google Scholar]
  • 44.Gallione C, Aylsworth AS, Beis J, Berk T, Bernhardt B, Clark RD, Clericuzio C, Danesino C, Drautz J, Fahl J, et al. Overlapping spectra of SMAD4 mutations in juvenile polyposis (JP) and JP-HHT syndrome. Am J Med Genet A. 2010;152A:333–339. doi: 10.1002/ajmg.a.33206. [DOI] [PubMed] [Google Scholar]
  • 45.Shi Y, Hata A, Lo RS, Massagué J, Pavletich NP. A structural basis for mutational inactivation of the tumour suppressor Smad4. Nature. 1997;388:87–93. doi: 10.1038/40431. [DOI] [PubMed] [Google Scholar]
  • 46.Kamb A, Gruis NA, Weaver-Feldhaus J, Liu Q, Harshman K, Tavtigian SV, Stockert E, Day RS, III, Johnson BE, Skolnick MH. A cell cycle regulator potentially involved in genesis of many tumor types. Science. 1994;264:436–440. doi: 10.1126/science.8153634. [DOI] [PubMed] [Google Scholar]
  • 47.Mori T, Miura K, Aoki T, Nishihira T, Mori S, Nakamura Y. Frequent somatic mutation of the MTS1/CDK4I (multiple tumor suppressor/cyclin-dependent kinase 4 inhibitor) gene in esophageal squamous cell carcinoma. Cancer Res. 1994;54:3396–3397. [PubMed] [Google Scholar]
  • 48.Caldas C, Hahn SA, da Costa LT, Redston MS, Schutte M, Seymour AB, Weinstein CL, Hruban RH, Yeo CJ, Kern SE. Frequent somatic mutations and homozygous deletions of the p16 (MTS1) gene in pancreatic adenocarcinoma. Nat Genet. 1994;8:27–32. doi: 10.1038/ng0994-27. [DOI] [PubMed] [Google Scholar]
  • 49.Nevins JR. The Rb/E2F pathway and cancer. Hum Mol Genet. 2001;10:699–703. doi: 10.1093/hmg/10.7.699. [DOI] [PubMed] [Google Scholar]
  • 50.Parwani AV, Geradts J, Caspers E, Offerhaus GJ, Yeo CJ, Cameron JL, Klimstra DS, Maitra A, Hruban RH, Argani P. Immunohistochemical and genetic analysis of non-small cell and small cell gallbladder carcinoma and their precursor lesions. Mod Pathol. 2003;16:299–308. doi: 10.1097/01.MP.0000062656.60581.AA. [DOI] [PubMed] [Google Scholar]
  • 51.McClendon AK, Dean JL, Rivadeneira DB, Yu JE, Reed CA, Gao E, Farber JL, Force T, Koch WJ, Knudsen ES. CDK4/6 inhibition antagonizes the cytotoxic response to anthracycline therapy. Cell Cycle. 2012;11:2747–2755. doi: 10.4161/cc.21127. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Young RJ, Waldeck K, Martin C, Foo JH, Cameron DP, Kirby L, Do H, Mitchell C, Cullinane C, Liu W, et al. Loss of CDKN2A expression is a frequent event in primary invasive melanoma and correlates with sensitivity to the CDK4/6 inhibitor PD0332991 in melanoma cell lines. Pigment Cell Melanoma Res. 2014;27:590–600. doi: 10.1111/pcmr.12228. [DOI] [PubMed] [Google Scholar]
  • 53.Latif F, Tory K, Gnarra J, Yao M, Duh FM, Orcutt ML, Stackhouse T, Kuzmin I, Modi W, Geil L. Identification of the von Hippel-Lindau disease tumor suppressor gene. Science. 1993;260:1317–1320. doi: 10.1126/science.8493574. [DOI] [PubMed] [Google Scholar]
  • 54.Kondo K, Yao M, Yoshida M, Kishida T, Shuin T, Miura T, Moriyama M, Kobayashi K, Sakai N, Kaneko S, et al. Comprehensive mutational analysis of the VHL gene in sporadic renal cell carcinoma: Relationship to clinicopathological parameters. Genes Chromosomes Cancer. 2002;34:58–68. doi: 10.1002/gcc.10054. [DOI] [PubMed] [Google Scholar]
  • 55.Brauch H, Weirich G, Brieger J, Glavac D, Rödl H, Eichinger M, Feurer M, Weidt E, Puranakanitstha C, Neuhaus C, et al. VHL alterations in human clear cell renal cell carcinoma: Association with advanced tumor stage and a novel hot spot mutation. Cancer Res. 2000;60:1942–1948. [PubMed] [Google Scholar]
  • 56.Shi J, Liu H, Wang HL, Prichard JW, Lin F. Diagnostic utility of von Hippel-Lindau gene product, maspin, IMP3, and S100P in adenocarcinoma of the gallbladder. Hum Pathol. 2013;44:503–511. doi: 10.1016/j.humpath.2012.06.010. [DOI] [PubMed] [Google Scholar]
  • 57.Gossage L, Eisen T, Maher ER. VHL, the story of a tumour suppressor gene. Nat Rev Cancer. 2015;15:55–64. doi: 10.1038/nrc3844. [DOI] [PubMed] [Google Scholar]
  • 58.Penticuff JC, Kyprianou N. Therapeutic challenges in renal cell carcinoma. Am J Clin Exp Urol. 2015;3:77–90. [PMC free article] [PubMed] [Google Scholar]

Articles from Oncology Letters are provided here courtesy of Spandidos Publications

RESOURCES