Abstract
Pulmonary surfactant protein C (SP-C) expression by type II alveolar epithelial cells (AECs) is markedly reduced in diverse types of lung injuries and is often associated with AEC apoptosis. It is unclear whether loss of SP-C contributes to the increased p53 and urokinase-type plasminogen activator (uPA) system cross-talk and apoptosis of AECs. Therefore, we inhibited SP-C expression in human and murine AECs using lentivirus vector expressing shRNA and tested p53 and downstream changes in the uPA-fibrinolytic system. Inhibition of SP-C expression in AECs induced p53 and activated caspase-3, indicating AEC apoptosis. We also found that bleomycin or cigarette smoke exposure failed to inhibit SP-C expression or apoptosis in AECs in p53- and plasminogen activator inhibitor-1 (PAI-1)-deficient mice. Depletion of SP-C expression by lentiviral SP-C shRNA in PAI-1-deficient mice failed to induce p53 or apoptosis in AECs, whereas it increased both AEC p53 and apoptosis in wild-type and uPA-deficient mice. SP-C inhibition in AECs also increased in CXCL1 and CXCL2 and their receptor CXCR2 as well as ICAM-1 expression, which is indicative of a proinflammatory response. Overexpression of p53-binding 3′-UTR sequences in AECs inhibited PAI-1 induction while maintaining uPA and uPAR protein and mRNA expression. Furthermore, caveolin-1 expression and phosphorylation were increased in AECs, indicating an intricate link between caveolin-1 and Src kinase-mediated cell signaling and AEC apoptosis due to loss of SP-C expression through p53 and uPA system-mediated cross-talk. The role of uPA, PAI-1, and p53 in the regulation of AEC apoptosis after injury was also determined in knockout mice.
Keywords: surfactant protein C, alveolar epithelial cell, urokinase, p53, apoptosis
pulmonary surfactant protein C (SP-C) is produced exclusively by type II alveolar epithelial cells (AECs) (2). The AECs secrete the 35-amino acid mature SP-C peptide to the alveolus, where, along with other surfactants, SP-C participates in the maintenance of alveoli structure and assists in gas exchange by reducing surface tension. SP-C homeostasis is maintained inside the alveoli through recycling by AECs and degradation by macrophages (2). Recent reports link deficiency or mutation in the SP-C gene expression to familial forms of pulmonary fibrosis (27, 30). Mutation in the BRICHOS domain of the SP-C precursor protein causes accumulation of the misfolded protein in the endoplasmic reticulum (ER) and subsequent ER stress, resulting in proteasome dysfunction and caspase-3 activation in AECs (24). SP-C expression is markedly reduced in various types of infectious and noninfectious lung diseases. Many proliferative and degenerative interstitial lung diseases such as nonspecific interstitial pneumonia and usual interstitial pneumonia have been linked to mutations in the SP-C gene (7, 20, 25, 35). However, the role of altered SP-C expression in cellular signaling and gene regulation is not well elucidated. Treatment of surfactant-deficient rabbits with surfactant protein B (SPB) and SP-C containing surfactant preparations showed reduction in alveolar-capillary protein leakage and increase in the lung compliance (16). Administration of recombinant SP-C-based preparations to patients with acquired respiratory distress syndrome improved gas exchange (34), demonstrating the importance of SP-C in lung function.
The pathological link between the development of respiratory distress in neonates and abnormalities in production of surfactant proteins, including SP-C, has been well established. Although SP-C-null mice are viable, they exhibit increased sensitivity and prolonged apoptosis of AECs and fibrosis from bleomycin (BLM) injury (9, 18). Reduction of inflammatory responses caused by respiratory syncytial virus-induced lung injury, following forced expression of SP-C in SP-C-null mice (12), suggests protection by SP-C against lung inflammation and normal alveolar homeostasis. SP-C expression is also decreased in injured AECs, including those isolated from human IPF and COPD lungs as well as from mice with BLM, silica, or cigarette smoke (CS) exposure-induced lung injuries (4, 6, 31, 36). These observations indicate the importance of SP-C in lung homeostasis. These sudden changes in hydrophobic-alveolar SP-C may be sensed by the AECs, as their membrane proteins are in constant interaction with this extracellular milieu. It is being proposed that SP-C, based on its covalent addition of palmitic acid, rendering it capable of interacting with specific cell membranes, may be functioning as a membrane peptide (1). Restoring SP-C expression in AECs attenuates BLM-induced lung fibrosis in mice (26), illustrating the importance of SP-C in alveolar injury and the subsequent development of pulmonary fibrosis.
In this study, we demonstrate that loss of SP-C expression causes AECs to undergo apoptosis and lung injury. Furthermore, the process involves induction of p53 via its posttranslational modifications and downstream p53-mediated changes in the urokinase-type plasminogen activator (uPA)-fibrinolytic system. We used primary human and murine AECs as well as murine lentivirus (LV) expressing SP-C shRNA, BLM, and CS models to evaluate changes of p53, uPA, uPA plasma membrane receptor (uPAR), and plasminogen activator inhibitor-1 (PAI-1) expression, inflammatory chemokines and intercellular adhesion molecule 1 (ICAM-1) expression, and apoptosis in AECs. In addition, we targeted p53 interaction with all three major components of the uPA system in SP-C shRNA-treated cells, using p53-binding 3′-untranslated regions (3′-UTR) to determine whether AEC survival and inflammation can be altered.
MATERIALS AND METHODS
Human AECs.
Human pulmonary AECs were purchased from Sciencell Research Laboratories (Sciencell, Carlsbad, CA) and cultured as per the supplier’s instructions. The cells were grown in poly-l-lysine coated plates in growth-supplemented AEC culture medium (AEpiCM; Sciencell, Carlsbad, CA) at 37°C in an incubator supplied with 5% CO2.
Isolation of AECs from mouse lungs.
All experiments involving mice were performed according to the approved protocols under the guidelines of Animal Care and Use Committee of the University of Texas Health Science Center at Tyler. AECs were isolated from C57BL/6 mice of wild-type (WT) as well as PAI-1−/− and uPA−/− background (The Jackson Laboratory, Bar Harbor, ME), following the method of Corti et al. (8), with minor modifications. The AECs were plated on plastic culture dishes precoated with anti-CD-32 and anti-CD-45 antibodies for 2 h at 37°C. The nonadherent cells were collected. The purities of AEC cell preparations were >90%, based on lithium carbonate staining for inclusion bodies. The cells were maintained in poly-l-lysine-coated plates in growth-supplemented AEC culture medium (AEpiCM; Sciencell) at 37°C in an incubator supplied with 5% CO2.
Preparation of cigarette smoke extract.
Research cigarettes 2R4F were purchased from the Tobacco Health Research University of Kentucky (Lexington, KY). The cigarette smoke extract (CSE) was prepared by burning research cigarettes in a side arm flask, and the smoke generated was bubbled into phosphate-buffered saline at room temperature through an attached peristaltic pump, as we described earlier (6, 31). For quantification of the CSE concentration, an absorbance of 1.0 at 230 nm was considered 100%. The CSE was filter sterilized by passing it through a 0.2-µm filter.
Treatment.
Human or mouse AECs plated in the culture dishes (cell density 2 × 105 cm2) were treated with BLM (40 µg/ml), CSE (2.5%), SP-C shRNA lentiviral (LV) particles (SP-C shRNA), or control LV particles (Ctrl shRNA) purchased from Santa Cruz Biotechnology (Santa Cruz, CA) for 48 h. The target sequence for human SP-C shRNA (sc-36539-V) was mapping to 8p21.3, and for mouse SP-C shRNA (sc-36540-V) was mapping to 14 D2. For competitive inhibition of p53 from binding to endogenous uPA, uPAR, and PAI-1 mRNAs in AECs, the cells were transduced with a chimeric construct of LV with SP-B promoter expressing p53-binding or p53-nonbinding chimeric uPA-uPAR-PAI-1 3′-UTR, as we reported earlier (5, 21). These cells were harvested and used for extraction of RNA and proteins. For inhibiting SP-C expression in AECs in vivo, mice were transduced by intranasal instillation with the LV particles containing SP-C shRNA in PBS (50 µl) for 3 consecutive days, as described earlier (4, 5). Three days after SP-C shRNA, AECs from the lungs were isolated for analysis. The SP-C mRNA suppression was analyzed by semiquantitative PCR as per the instruction of the supplier. AECs isolated from WT mice treated with BLM (2 µg/g body wt) via nares, as we described earlier (31), were used as a positive control.
Protein analysis by Western blotting.
Changes in SP-C (cat. no. sc-13979; Santa Cruz Biotechnology), p53 (cat. no. sc-6243; Santa Cruz Biotechnology), Ser15 phosphorylated p53 (p53S15P, cat. no. 9284; Cell Signaling Technology, Beverly, MA), Lys379 acetylated p53 (p53Ac, cat. no. 2570; Cell Signaling Technology), sirtuin 1(Sirt1; cat. no. 9475; Cell Signaling Technology), caspase-3 (cat. no. ab32351; Abcam, Cambridge, MA), cleaved caspase-3 (cat. no. 9661; CellSignaling Technology), caveolin-1 (cat. no. ab18199; Abcam), Tyr14 phosphorylated caveolin-1 (P-Y14Cav-1; cat. no. sc-101653; Santa Cruz Biotechnology), SRC kinase (cat. no. 2108; Cell Signaling Technology), Tyr418 phosphorylated Src (P-Y418Src; cat. no. ab110777; Abcam), Tyr527 phosphorylated Src (P-Y527Src; cat. no. 2105; Cell Signaling Technology), uPA (cat. no. ab135824; Abcam), uPAR (cat. no. ab103791; Abcam), PAI-1 (cat. no. ab66705; Abcam), CXC chemokines CXCL1 (cat. no. ab86436; Abcam) and CXCL2 (cat. no. AF-452-SP and MAB276 from R & D Systems, Minneapolis, MN) and their receptor CXCR2 (cat. no. ab14935; Abcam), intercellular adhesion molecule 1 (ICAM-1; cat. no. ab124759; Abcam), and β-actin (cat. no. 3700; Cell Signaling Technology) expression levels were assessed by Western blotting of lysates of AECs using specific antibodies and enhanced chemiluminescence (ECL; Thermo, Rockford, IL) detection, as described previously (31, 32).
mRNA quantitation by real-time qPCR.
Total RNA was isolated from AECs using TRI reagent and reverse transcribed using impromII Reverse transcription kit (Promega, WI). The levels of the mRNAs were quantitated using an aliquot of reverse transcribed total RNA and gene-specific primers (Table 1) by real-time PCR, as described earlier (31, 32).
Table 1.
List of primer sequences used for gene expression analysis by qPCR
| Gene | Sequence (5′-3′) |
|---|---|
| Human SP-C | |
| Forward | TTGGTCCTTCACCTCTGTCC |
| Reverse | CTCCCACAATCACCACGAC |
| Human uPA | |
| Forward | GACTCCAAAGGCAGCAATGA |
| Reverse | TGCTGCCCTCCGAATTTCTT |
| Human uPAR | |
| Forward | TCGCTCTTTCGCAAAACGTC |
| Reverse | GGCAATCCCCGTTGGTCTTA |
| Human PAI-1 | |
| Forward | GCAAGGCACCTCTGAGAACT |
| Reverse | GGGTGAGAAAACCACGTTGC |
| Mouse SP-C | |
| Forward | GGAGCACCGGAAACTCAGAA |
| Reverse | GGAGCCGCTGGTAGTCATAC |
| Mouse uPA | |
| Forward | TACCGAGGAAAGGCCAACAC |
| Reverse | TTCCCCAGGCCTAGGCTAAT |
| Mouse uPAR | |
| Forward | GTGTGCCCTCGTGTTGTCTT |
| Reverse | ATGTGACAGTGGGGAGACCC |
| Mouse PAI-1 | |
| Forward | TCAGTGGCCAATGGAAGACC |
| Reverse | CTGGTAGGGCAGTTCCACG |
| β-actin | |
| Forward | CACCG CAGCTCGTAGCTCTTCTCCAGGG |
| Reverse | CCAGCCATGTACG TTGCTATCCAG |
SP-C, surfactant protein C; uPA, urokinase-type plasminogen activator; uPAR, uPA plasma membrane receptor; PAI-1, plasminogen activator inhibitor-1.
Statistical analysis.
The differences between experimental values were analyzed by one-way ANOVA, followed by Tukey’s post hoc test using GraphPad Prism 4.0 software (GraphPad Software, San Diego, CA).
RESULTS
Loss of SP-C expression is associated with increased AEC apoptosis.
We found concurrent loss of SP-C expression and increased apoptosis in AECs exposed to CS or BLM. To directly confirm whether loss of SP-C expression contributes to AEC apoptosis, we treated AECs with LV-SP-C shRNA. Quantitative analysis for SP-C mRNA showed loss of 95% of the baseline SP-C mRNA expression in human AECs treated with SP-C shRNA in vitro. Transduction of mouse AECs with SP-C shRNA reduced its expression by 80% in vitro and caused 70–75% suppression of SP-C mRNA in mouse AECs in vivo. Consistent with BLM injury, loss of baseline SP-C expression alone induced caspase-3 activation, whereas AECs exposed to control shRNA still showed basal SP-C expression, with minimal apoptosis in both human (Fig. 1A) and mouse (Fig. 1B) AECs. These findings suggest that loss of basal expression of SP-C in AECs, often observed during BLM or CS exposure or other lung injuries, itself can cause AEC apoptosis irrespective of the underlying cause. We then transduced WT mice with LV-shRNA, isolated AECs 3 days later, and compared the responses with mice exposed to control shRNA or BLM. As shown in Fig. 1C, AECs of mice exposed to BLM or SP-C shRNA alone showed significant suppression of baseline SP-C expression compared with their levels in control mice treated with saline or control shRNA. We also found that reduction in baseline SP-C expression augmented AEC apoptosis in WT mice exposed to BLM or SP-C shRNA. We reported earlier that p53 induces PAI-1 and inhibits uPA expression in AECs of WT mice during lung injury (5). Furthermore, mice deficient in expression for PAI-1 resist AEC apoptosis and lung injury, whereas those lacking uPA expression are more susceptible to lung epithelial injury and fibrosis. Therefore, we exposed AECs isolated from PAI-1-deficient mice to LV-SP-C shRNA in vitro and assayed for changes in SP-C expression and activation of caspase-3. Consistent with changes in WT AECs, and unlike exposure of PAI-1-deficient AECs to BLM, expression of SP-C shRNA reduced SP-C expression in PAI-1-deficient AECs, whereas those exposed to control shRNA still retained baseline SP-C levels (Fig. 1D). Interestingly, inhibition of baseline expression of SP-C in PAI-1-deficient AECs failed to induce activation of caspase-3, indicating resistance to apoptosis. Similarly, these cells failed to respond to BLM treatment and resisted apoptosis. AECs isolated from PAI-1-deficient mice, exposed to LV-SP-C shRNA in vivo, also showed significant suppression of SP-C levels, whereas BLM-treated mice showed remarkable resistance. Furthermore, analysis of AEC lysates for activation of caspase-3 revealed that PAI-1-deficient mice exposed to SP-C shRNA or BLM resist apoptosis (Fig. 1E), indicating that increased PAI-1 expression is required for AEC apoptosis. We next inhibited SP-C expression by transducing murine AECs isolated from uPA-deficient mice with SP-C shRNA and compared the responses with AECs exposed to BLM. We found that treatment of uPA-deficient AECs with SP-C shRNA or BLM reduced basal SP-C expression and induced apoptosis depicted by increased activation of caspase-3 (Fig. 1F). Consistent with our in vitro findings, AECs isolated from uPA-deficient mice exposed to SP-C shRNA or BLM showed reduction in SP-C levels with elevated caspase-3 activation compared with the corresponding responses in saline or nonspecific shRNA-treated control mice (Fig. 1G).
Fig. 1.
Suppression of surfactant protein C (SP-C) expression in alveolar epithelial cells (AECs) activates caspase-3. A and B: primary human (A) or mouse (B) AECs were treated with PBS, 40 µg/ml bleomycin (BLM), or 2.5% cigarette smoke extract (CSE) or transduced with lentivirus (LV) SP-C shRNA (SP-C shRNA) or control shRNA (Ctrl shRNA) according to the manufacturers’ instructions in culture dishes for 48 h. The lysates were immunoblotted for SP-C, cleaved caspase-3 (Cl. caspase-3), and total caspase-3 to assess apoptosis and β-actin for loading equality. Densities of individual bands were quantified and are presented as bar graphs after normalization with the corresponding densities of β-actin in each sample. Expression of Cl. caspase-3 was normalized with that of caspase expression. C: wild-type (WT) mice (n = 3) were exposed to saline or BLM (2 µg/g body wt) or transduced with Ctrl shRNA or SP-C shRNA via intranasal instillation. Three days later, AECs were isolated and tested for SP-C, Cl./total caspase-3, and β-actin proteins by Western blotting. D: AECs were isolated from plasminogen activator inhibitor-1 (PAI-1)-deficient mice and exposed to PBS, BLM, Ctrl shRNA, or SP-C shRNA in culture dishes, as described in B. The AEC lysates were immunoblotted for SP-C, Cl./total caspase-3, and β-actin. Bar graph represents densities of individual bands after normalization with the corresponding densities of β-actin. Expression of Cl. caspase-3 was normalized with that of caspase expression. E: AECs isolated from PAI-1-deficient mice (n = 3) exposed to saline, BLM, or Ctrl or SP-C shRNA were tested for changes in SP-C expression and apoptosis, as described in C. Bar graph represents densities of individual bands after normalization with β-actin levels. Expression of Cl. caspase-3 was normalized with that of caspase expression. F: AECs isolated from urokinase-type plasminogen activator (uPA)-deficient mice were treated with PBS, BLM, Ctrl shRNA, or SP-C shRNA for 48 h in culture dishes. The lysates were immunoblotted for changes in SP-C expression and apoptosis. The densities of individual bands are presented as bar graph after normalization with β-actin loading controls. G: AECs isolated from uPA-deficient mice (n = 3) exposed to saline, BLM, Ctrl shRNA, or SP-C shRNA were immunoblotted for SP-C, Cl. caspase-3, and total caspase-3 for apoptosis and β-actin, as described in C. The densities of individual bands were normalized against β-actin protein levels in the same sample and are presented as a bar graph. Expression of Cl. caspase-3 was normalized with that of caspase expression. Data are presented as means ± SD of 3 repetitions, with significance (P value) obtained after Tukey’s analysis. NS, not significant.
Loss of SP-C expression induces p53 expression in AECs.
Since p53 controls viability of AECs through changes in uPA and PAI-1 expression, and p53 expression is increased in injured lung epithelial cells, we analyzed AECs lysates for p53 expression. Consistent with lung epithelial injury caused by exposure to BLM or CSE, transduction of human AECs (Fig. 2A) or AECs from mice (Fig. 2B) with SP-C shRNA had augmented baseline p53 expression compared with p53 levels in control cells treated with either PBS or control shRNA. Since p53 mRNA expression is not increased and p53 induction occurs predominantly via posttranslational stabilization of p53 protein during lung injury, we analyzed these lysates for possible modification of p53 protein. We found that both acetylation of Lys379 and phosphorylation of Ser15 of the p53 proteins were increased in human and murine AECs exposed to SP-C shRNA in vitro. Treatment of AECs with BLM or CSE also increased p53 acetylation and serine phosphorylation. We next extended our in vitro experiments in WT mice and found that consistent with BLM injury in mice, AECs of WT mice transduced with SP-C shRNA-induced total as well as acetylated and Ser15 phosphorylated p53 (Fig. 2C). This indicates that stabilization of p53 protein due to posttranslational modifications such as acetylation and Ser15 phosphorylation contributes to its induction. PAI-1-deficient mice exposed to BLM or CSE resist suppression of SP-C expression and apoptosis. Therefore, we analyzed lysates of PAI-1-deficient AECs transduced with SP-C shRNA for p53 expression and found that both BLM exposure and suppression of SP-C expression using shRNA failed to induce significant p53 expression (Fig. 2D). Inhibition of SP-C expression by either treatment with SP-C shRNA or BLM also showed minimal acetylation and Ser15 phosphorylation in PAI-1-deficient AECs. Although transduction of PAI-1-deficient mice with SP-C shRNA reduced basal SP-C expression in AECs, there was little induction of Ser15 phosphorylation, Lys379 acetylation, or total p53 expression (Fig. 2E). Similarly, BLM failed to increase total, acetylated, or Ser15 phosphorylated p53 in AECs of PAI-1-deficient mice, which were increased in WT mice. We analyzed lysates of AECs lacking uPA expression and exposed to SP-C shRNA and found that inhibition of SP-C expression, like BLM injury, augmented total p53 levels. These AECs also showed elevated Ser15 phosphorylation and acetylation of p53 (Fig. 2F), suggesting that posttranscriptional changes in p53 protein contribute to its stabilization. We further confirmed that inhibition of SP-C expression, by transduction of uPA-deficient mice with shRNA, increased Ser15 phosphorylated, acetylated, and total p53 in AECs (Fig. 2G), and responses were comparable with uPA-deficient mice exposed to BLM.
Fig. 2.
Loss of SP-C expression in AECs promotes p53 activation by acetylation and serine phosphorylation. A and B: primary human (A) or mouse (B) AECs were treated with PBS, BLM, or CSE or transduced with SP-C shRNA or Ctrl shRNA according to the manufacturers’ instructions in culture dishes for 48 h, as described in Fig. 1A. The lysates were immunoblotted for SP-C, total p53, Ser15, phosphorylated p53 (p53 Ser15), Lys379 acetylated p53 (p53Ac), and sirtuin 1 (Sirt1). Bar plot represents densities of individual bands after normalization with the corresponding densities of β-actin in each sample. C: AECs isolated from WT mice (n = 3) exposed to saline or BLM or transduced with Ctrl shRNA or SP-C shRNA, as described in Fig. 1C. The lysates were analyzed for SP-C, p53, p53 Ser15, p53Ac, Sirt1, and β-actin by Western blotting. D: AECs were isolated from PAI-1-deficient mice exposed to PBS, BLM, Ctrl shRNA, or SP-C shRNA in culture dishes, as described in Fig. 1B. The AEC lysates were immunoblotted for SP-C, p53, p53 Ser15, p53Ac, Sirt1, and β-actin. Bar graph represents densities of individual bands after normalization with the corresponding densities of β-actin. E: AECs isolated from PAI-1-deficient mice (n = 3) exposed to saline, BLM, Ctrl shRNA, or SP-C shRNA were tested for changes in SP-C, p53 Ser15, p53Ac, and total p53, as described in Fig. 1C. Bar graph represents densities of individual bands after normalization with β-actin levels. F: AECs isolated from uPA-deficient mice were treated with PBS, BLM, Ctrl shRNA, or SP-C shRNA for 48 h in culture dishes. The lysates were immunoblotted for changes in SP-C, Sirt1, total p53, p53 Ser15, and p53Ac expression. The densities of individual bands are presented as a bar graph after normalization with β-actin loading controls. G: AECs isolated from uPA-deficient mice (n = 3) exposed to saline, BLM, Ctrl shRNA, or SP-C shRNA were immunoblotted for SP-C, p53, p53 Ser15, p53Ac, Sirt1, and β-actin for loading equality, as described in Fig. 1C. The densities of individual bands were normalized against β-actin protein levels in the same sample and are presented as a bar graph. Data represent means ± SD of 3 repetitions, with significance (P value) obtained after Tukey’s analysis.
The literature (18) reveals increased neutrophil influx in mice deficient in SP-C expression. We also reported that CXC chemokines and their receptor CXCR2 are increased in injured AECs and contribute to pulmonary neutrophil influx and inflammation in mice exposed to CS (36). Therefore, we analyzed AECs exposed to SP-C shRNA for CXCL1, CXCL2, and CXCR2. As shown in Fig. 3, A and B, similar to AEC injury caused by BLM or CSE, inhibition of basal SP-C expression in human and mouse AECs alone increased CXC chemokines and CXCR2. These changes were associated with induction of ICAM-1 in human and mouse AECs, indicating that loss of SP-C expression can promote increased inflammation through elaboration of CXC chemokines. To confirm these changes in vivo, we exposed WT mice to SP-C shRNA and tested lysates of AECs isolated 3 days after shRNA transduction for changes in CXC chemokines and CXCR2 expression. As shown in Fig. 3C, and consistent with the results of our in vitro experiments, inhibition of SP-C caused a significant increase in the expression of CXC chemokines and CXCR2 by AECs. Loss of SP-C also augmented ICAM-1 expression by AECs. The AEC responses of mice exposed to SP-C shRNA reiterated WT mice exposed to BLM, indicating the importance of loss of SP-C expression in lung inflammation.
Fig. 3.
SP-C suppression in AECs triggers inflammatory response. A and B: primary human (A) or mouse (B) AECs were treated with PBS, BLM, or CSE or transduced with SP-C shRNA or Ctrl shRNA according to the manufacturers’ instructions in culture dishes for 48 h, as described in Fig. 1A. Lysates were immunoblotted for SP-C, CXCL1, CXCL2, CXCR2, and intercellular adhesion molecule 1 (ICAM-1). Densities of individual bands were quantified and are presented as a bar graph after normalization, with the corresponding densities of β-actin in each sample. C: AECs were isolated from WT mice (n = 3) exposed to saline or BLM or transduced with control shRNA or SP-C shRNA via intranasal instillation, as described in Fig. 1C. AEC lysates were isolated and tested for SP-C, CXCL1, CXCL2, CXCR2, ICAM-1, and β-actin proteins by Western blotting. D: AECs isolated from PAI-1-deficient mice were exposed to PBS, BLM, Ctrl shRNA, or SP-C shRNA in culture dishes, as described in Fig. 1B. The AEC lysates were immunoblotted for SP-C, CXCL1, CXCL2, CXCR2, ICAM-1, and β-actin. Bar graph represents densities of individual bands after normalization with the corresponding densities of β-actin. E: AECs isolated from PAI-1-deficient mice (n = 3) exposed to saline, BLM, Ctrl shRNA, or SP-C shRNA were tested for changes in SP-C expression and inflammatory responses, as described in Fig. 1C. Bar graph represents densities of individual bands after normalization with β-actin levels. Data are presented as means ± SD of 3 repetitions, with significance (P value) obtained after Tukey’s analysis.
Since PAI-1 deficiency prevents inhibition of SP-C expression and protects against lung inflammation due to BLM or CS exposure, we next analyzed AECs exposed to SP-C shRNA for changes in chemokines. As shown in Fig. 3D, inhibition of basal SP-C expression using shRNA failed to augment CXC chemokines or CXCR2 expression. These cells also resisted ICAM-1 expression, which is otherwise induced in WT AECs. They also failed to respond to BLM, indicating that increased AEC-specific PAI-1 expression is required for induction of CXCL1, CXCL2, CXCR2, or ICAM-1. Further analysis of AECs isolated from PAI-1-deficient mice revealed that suppression of SP-C expression using shRNA failed to induce CXCL1, CXCL2, CXCR2, or ICAM-1 expression. This suggests that increased inflammation through elaboration of CXC chemokine signaling associated with loss of baseline SP-C expression requires increased PAI-1 expression (Fig. 3E).
Since p53 controls expression of all three major components of the uPA-fibrinolytic system to regulate AEC viability during lung injury, we investigated whether loss of SP-C expression affects their basal expression. Consistent with increased p53, we found induction of PAI-1 with reciprocal reduction in uPA and uPAR with the loss of the basal level of SP-C expression in shRNA-treated human (Fig. 4A) or murine (Fig. 4C) AECs. We also found similar changes in AECs exposed to either CSE or BLM, although the magnitude of induction of PAI-1 in BLM-treated AECs was disproportionately higher than was detected in the AECs exposed to SP-C shRNA or CSE. The marked increase in PAI-1 expression in AECs treated with BLM could have resulted from a disproportionate increase in p53 expression by these cells Fig. 4A. Analysis of RNA isolated from human (Fig. 4B) or murine (Fig. 4D) AECs further confirmed inhibition of uPA and uPAR and induction of PAI-1 mRNAs, indicating that changes occurred at the mRNA levels. We also found a similar induction of PAI-1 and reduction in baseline uPA and uPAR expression in AECs of WT mice 3 days after transduction with SP-C shRNA, and the responses were roughly consistent with the changes observed in WT mice after exposure to BLM (Fig. 4E). WT mice exposed to saline or control shRNA maintained relatively elevated levels of uPA and uPAR and low PAI-1. Analysis of AEC RNA from these mice showed significant induction of PAI-1 mRNA following treatment with SP-C shRNA or BLM, whereas uPA and uPAR mRNA levels were markedly reduced (Fig. 4F).
Fig. 4.
SP-C suppression affects the fibrinolytic system in AECs. A–D: primary human (A and B) and mouse (C and D) AECs were treated with PBS, BLM, or CSE or transduced with SP-C shRNA or Ctrl shRNA according to the manufacturers’ instructions in culture dishes for 48 h, as described in Fig. 1A. The lysates were immunoblotted for SP-C, uPA, uPA plasma membrane receptor (uPAR), and PAI-1 protein. Densities of individual bands were quantified and are presented as bar graphs after normalization with the corresponding densities of β-actin in each sample for human (A) or mouse (C) AECs. RNA isolated from human (B) or mouse (D) AECs exposed to PBS, BLM, CSE, SP-C shRNA, or Ctrl shRNA was analyzed for SP-C, uPA, uPAR, and PAI-1 mRNA expression by real-time PCR. The levels of each mRNA were normalized against corresponding levels of β-actin mRNA and are presented as bar graphs. E: AECs isolated from WT mice (n = 3) exposed to saline or BLM or transduced with Ctrl shRNA or SP-C shRNA via intranasal instillation. Three days later, AECs were isolated and tested for SP-C, uPA, uPAR, PAI-1, and β-actin protein by Western blotting. F: RNA isolated from AECs of WT mice exposed to saline, BLM, Ctrl shRNA, or SP-C shRNA was analyzed for SP-C, uPA, uPAR, PAI-1, and β-actin mRNA by qPCR. G: AECs isolated from PAI-1-deficient mice were exposed to PBS, BLM, Ctrl shRNA, or SP-C shRNA in culture dishes. The AEC lysates were immunoblotted for SP-C, uPA, uPAR, and β-actin. H: RNA isolated from AECs lacking PAI-1 expression and exposed to PBS, BLM, Ctrl shRNA, or SP-C shRNA in culture dishes was analyzed by quantitative PCR for SP-C, uPA, and uPAR mRNA. I: AECs isolated from PAI-1-deficient mice (n = 3) exposed to saline, BLM, Ctrl shRNA, or SP-C shRNA were tested for changes in SP-C, uPA, uPAR, and β-actin by Western blotting. Bar graph represents densities of individual bands after normalization with β-actin levels. J: RNA isolated from AECs of PAI-1-deficient mice exposed to saline, BLM, Ctrl shRNA, or SP-C shRNA was tested for SP-C, uPA, and uPAR mRNA by qPCR. Data are presented as means ± SD of 3 repetitions with significance (P value) obtained after Tukey’s analysis.
PAI-1 expression is markedly increased in AECs during lung injury, and PAI-1-deficient mice resist AEC apoptosis. Therefore, we analyzed lysates of AECs exposed to SP-C shRNA for uPA and uPAR expression. As shown in Fig. 4G, suppression of SP-C expression in PAI-1-deficient AECs using shRNA or treatment of these cells with BLM failed to significantly reduce basal uPA or uPAR expression. Quantitation of mRNA expression by PCR (Fig. 4H) revealed a lack of significant inhibition of uPA or uPAR mRNAs in AECs following inhibition of baseline SP-C expression or BLM treatment due to a lack of induction of PAI-1 in PAI-1-deficient AECs. AECs of PAI-1-deficient mice exposed to SP-C shRNA or BLM tested 3 days after exposure showed minimal inhibition of baseline uPA or uPAR expression (Fig. 4I). Analysis of uPA or uPAR mRNA from AECs isolated from PAI-1-deficient mice also showed a lack of significant inhibition of uPA or uPAR mRNA expression by SP-C shRNA or BLM in the absence of increased PAI-1 expression (Fig. 4J).
p53 concurrently induces PAI-1 and inhibits uPA and uPAR expression by binding to 3′-UTR sequences. Therefore, we overexpressed p53-binding 3′-UTR sequences to interfere with increased p53 due to loss of SP-C expression from binding to endogenous uPA, uPAR, and PAI-1 mRNAs. We found that inhibition of p53 from binding to endogenous uPA, uPAR, and PAI-1 transcripts, using their 3′-UTR sequences as decoys, reduced PAI-1 and restored uPA and uPAR expression in human (Fig. 5A) or murine (Fig. 5B) AECs. However, AECs exposed to control nonbinding 3′-UTR sequences still showed induction of basal PAI-1 expression along with reciprocal changes in uPA or uPAR proteins due to suppression of SP-C expression. Furthermore, competitive inhibition of p53’s interaction with uPA, uPAR, and PAI-1 mRNA by forced expression of p53-binding 3′-UTR sequences in human and murine AECs reduced apoptosis, which is otherwise augmented following suppression of baseline SP-C levels. Overexpression of p53-binding uPA, uPAR, and PAI-1 3′-UTR sequences in human (Fig. 5C) and mouse (Fig. 5D) AECs also reversed p53-mediated changes by restoring uPA and uPAR mRNA and inhibiting PAI-1 mRNA expression. This indicates that cross-talk between p53 and the uPA system contributes to AEC apoptosis and lung epithelial injury by directly binding to their 3′-UTR sequences. This is mediated through induction of PAI-1 expression and concurrent but reciprocal suppression of uPA and uPAR at the posttranscriptional level.
Fig. 5.
Expression of p53-binding uPA, uPAR, and PAI-1 mRNA 3′ untranslated region (3′-UTR) sequences reverses changes in uPA, uPAR, and PAI-1 expression and apoptosis due to loss of SP-C suppression in AECs. Primary human (A and C) and mouse (B and D) AECs were treated with PBS, SP-C shRNA, and Ctrl shRNA in the presence or absence lentivirus vector containing the SP-B promoter expressing p53-binding chimeric uPA/uPAR/PAI-1 mRNA 3′-UTR sequences (p53-binding sequences) or control nonbinding sequences for 48 h. The lysates of the human (A) and mouse (B) AECs were analyzed for SP-C, uPA, uPAR, PAI-1 and β-actin by immunoblotting. RNA isolated from human (C) or mouse (D) AECs exposed to PBS, SP-C shRNA, and Ctrl shRNA in the presence or absence of p53-binding sequences or control nonbinding sequences for 48 h as described above were analyzed for SP-C, uPA, uPAR, and PAI-1 mRNA expression by real-time qPCR. Data are presented as means ± SD of 3 repetitions, with significance (P value) obtained after Tukey’s analysis.
To elucidate the possible mechanism contributing to induction of p53 following loss of SP-C expression, we analyzed AECs exposed to SP-C shRNA for changes in caveolin-1 expression. Consistent with CS or BLM exposure injury, inhibition of SP-C expression through transduction of shRNA significantly increased caveolin-1 expression in human (Fig. 6A) and mouse (Fig. 6B) AECs in vitro. Further analysis of these cells also showed significant induction of caveolin-1 phosphorylation at the Tyr14 residue, indicating functional activation following loss of SP-C expression. Since Src kinases activate tyrosine phosphorylation of caveolin-1 and Src activity is increased in injured AECs, we next tested Src phosphorylation at Tyr418 to assess activation of Src kinase. Consistent with increased phosphorylation of caveolin-1, suppression of baseline SP-C expression induced Src tyrosine 418 phosphorylation. Since Src activation is controlled by inhibitory phosphorylation at Tyr527, we analyzed AECs for inhibitory Src phosphorylation. Consistent with AEC injury due to CS or BLM exposure, loss of basal SP-C expression induced Src activation by suppressing inhibitory phosphorylation at Tyr527 of Src kinase. These findings were further confirmed by testing AECs isolated from WT mice exposed to SP-C shRNA 3 days after transduction (Fig. 6C).
Fig. 6.
SP-C suppression induces caveolin-1 (Cav-1) and Src activation in AECs. A and B: primary human (A) and mouse (B) AECs were treated with PBS, BLM, or CSE or transduced with SP-C shRNA or Ctrl shRNA according to the manufacturers’ instructions in culture dishes for 48 h. The lysates were immunoblotted for SP-C, Cav-1, Tyr14 phosphorylated Cav-1 (P-Y14Cav-1), Tyr418 phosphorylated Src (P-Y418Src), Tyr527 phosphorylated Src (P-Y527Src), total Src kinase, and β-actin. Densities of individual bands were quantified and presented as bar graph after normalization with the corresponding densities of β-actin in each sample. C: AECs isolated from WT mice (n = 3) exposed to saline or BLM or transduced with Ctrl shRNA or SP-C shRNA via intranasal instillation. Three days later, AECs were isolated and tested for SP-C, Cav-1, P-Y14Cav-1, P-Y418Src, P-Y527Src, total Src kinase, and β-actin proteins by Western blotting. D: AECs isolated from PAI-1-deficient mice were exposed to PBS, BLM, Ctrl shRNA, or SP-C shRNA in culture dishes, as described in Fig. 1B. The AEC lysates were immunoblotted for SP-C, Cav-1, P-Y14Cav-1, P-Y418Src, P-Y527Src, total Src kinase, and β-actin. Bar graph represents densities of individual bands after normalization with the corresponding densities of β-actin. E: AECs isolated from PAI-1-deficient mice (n = 3) exposed to saline, BLM, Ctrl shRNA, or SP-C shRNA were tested for changes in SP-C, Cav-1, P-Y14Cav-1, P-Y418Src, P-Y527Src, total Src kinase, and β-actin, as described in C. Bar graph represents densities of individual bands after normalization with β-actin levels. F: AECs isolated from uPA-deficient mice were treated with PBS, BLM, Ctrl shRNA, or SP-C shRNA for 48 h in culture dishes. The lysates were immunoblotted for changes in SP-C, Cav-1, P-Y14Cav-1, P-Y418Src, P-Y527Src, total Src kinase, and β-actin. The densities of individual bands are presented as a bar graph after normalization with β-actin loading controls. G: AECs isolated from uPA-deficient mice (n = 3) exposed to saline, BLM, Ctrl shRNA, or SP-C shRNA were immunoblotted for SP-C, Cav-1, P-Y14Cav-1, P-Y418Src, P-Y527Src, total Src kinase, and β-actin for loading equality, as described in D. The densities of individual bands were normalized against β-actin protein levels in the same sample and presented as a bar graph. Data are presented as means ± SD of 3 repetitions, with significance (P value) obtained after Tukey’s analysis.
Analysis of AECs of PAI-1-deficient mice transduced with SP-C shRNA or treatment of these AECs (Fig. 6D) or mice (Fig. 6E) with BLM either in vitro or in vivo failed to increase baseline caveolin-1 expression or its function through Tyr14 phosphorylation. These mice also resisted phosphorylation of Tyr418 and inhibition in Tyr527 phosphorylation of Src kinase, indicating a lack of Src activation in the absence PAI-1 expression. However, in isolated AECs lacking uPA expression (Fig. 6F) or in uPA-deficient mice in vivo (Fig. 6G), loss of SP-C expression by either SP-C shRNA transduction or treatment with BLM resulted in increased caveolin-1 expression and its Tyr14 phosphorylation. The caveolin-1 induction also accompanied a parallel increase in activation of Src kinases via phosphorylation of Tyr418 due to suppression of inhibitory Tyr527 phosphorylation of Src. This indicates that changes in p53 expression, p53-mediated downstream changes in the uPA-fibrinolytic system, caveolin-1 expression, and Src activation are intricately linked to changes in baseline SP-C expression.
DISCUSSION
Lung surfactant is composed of a mixture of ∼10% protein, phospholipids (∼80%), and neutral lipids (∼10%), which prevents alveolar collapse during expiration by reducing surface tension. In recent years, surfactant therapy has improved outcomes of neonatal distress syndrome (23, 33) and has provided a supportive role in the treatment of acute respiratory distress syndrome (ARDS) (28, 42). Among the four surfactant proteins, SP-B and SP-C are more hydrophobic, whereas SP-A and SP-D are hydrophilic. SP-B deficiency is lethal, whereas mutations in SP-C increase susceptibility to lung inflammation and infection (27). Epidemiological studies have revealed that rare forms of familial interstitial lung diseases (ILDs) have been linked to decreased SP-C expression due to a clustered mutation in the distal promoter region of the SP-C gene, with onset or severity of diseases ranging from neonatal respiratory distress syndrome (RDS) to ILD onset in adults (15, 25, 35, 37, 39). It has also been shown that a mutation contributing to altered processing and folding can contribute to stress response and reduced secretion of mature SP-C (9, 10). AECs maintain alveolar integrity by differentiating into type I alveolar epithelial cells during epithelial repair and through secretion of surfactant proteins. When AECs are damaged, dysregulated reepithelization and aberrant repair occur, impeding restoration of AECs, which is required to restore normal lung architecture.
Among the four surfactant proteins, only SP-C is synthesized exclusively by the AECs, and its expression is significantly reduced in AECs directly exposed to BLM, CS, or LPS in vitro or those isolated from mice exposed to BLM, silica, CS or LPS (3, 6, 22). Mice deficient in the SP-C gene are also more susceptible to viral or bacterial infections (13, 14), LPS-induced lung injury (11), and BLM-induced lung fibrosis (18). In addition, recent studies suggest that SP-C functions as a key protective component of surfactants against RSV and IAV infection (12), and restoration of SP-C expression attenuates lung injury in vivo, strongly supporting the importance of SP-C expression in lung epithelial homeostasis. Increased AEC apoptosis, inflammation, and loss of SP-C expression by AECs are common in both acute and chronic lung diseases such as sepsis, acute lung injury, ARDS, DAD, COPD, and IPF. Increased inflammation due to influx of inflammatory cells and their proteases can contribute to AEC apoptosis and fibrogenesis. However, the underlying mechanism contributing to AEC apoptosis and ILDs because of reduced SP-C expression has not been well understood.
Multiple reports from our laboratory and others suggest that persistent AEC apoptosis plays a pivotal role in fibrotic repair, which continues unabated in fibrotic lungs. These include IPF lungs, and inhibition of AEC apoptosis prevents not only the severity of lung injury but also abnormal repair. We have also reported that AEC apoptosis and lung injury involve increased p53 expression and p53-mediated downstream changes in uPA, uPAR, and PAI-1 expression in AECs (4). SP-C is produced by AECs, and its loss of expression is often associated with ongoing apoptosis of AECs in diverse types of lung diseases. Increased AEC apoptosis and persistent lung inflammation and remodeling have been reported in SP-C-deficient mice (18). We have also shown that mice lacking p53 or PAI-1 expression are protected from BLM-, CS-, or silica exposure-induced AEC apoptosis or development of lung fibrosis (3, 5, 6, 22). Others (43) have reported that mice deficient in Fas are also protected from BLM-induced lung fibrosis. Multiple studies from our laboratory revealed that inhibition of either p53 expression or blockade of its interaction with endogenous uPA, uPAR, and PAI-1 mRNA in AECs inhibits influx of inflammatory cells, AEC apoptosis, and fibrogenesis. The literature suggests that caspase inhibitor also inhibits AEC apoptosis and collagen accumulation in lung tissues after BLM injury (17, 41). Recent reports also revealed that transplantation of healthy AECs into BLM- or silica-exposed injured or fibrotic lungs attenuates lung fibrosis (40), suggesting that AEC apoptosis is crucial in the pathological progression of ILDs. However, it is unclear whether or how loss of SP-C expression contributes to p53 and uPA-fibrinolytic system cross-talk and AEC apoptosis, which is often observed during lung injury and fibrotic remodeling.
In the current study, we demonstrated that loss of SP-C expression induces AEC apoptosis. We further showed that the process involves increased p53 expression in isolated AECs as well as in mice exposed to SP-C shRNA. Posttranscriptional modifications such as Ser15 phosphorylation and acetylation of p53 prevent p53 from binding mdm2, leading to p53 stabilization. In addition, Ser15 phosphorylation augments p53’s interaction with acetyl transferase such as CBP300, leading to increased acetylation of p53. Since inhibition of SP-C expression augments both Ser15 phosphorylation and Lys379 acetylation of p53 in AECs, we believe posttranscriptional stabilization of p53 probably contributes to its induction. Consistent with increased Lys379 acetylation of p53 in AECs exposed to SP-C shRNA, we found inhibition of Sirt1 expression, indicating that blockade of Sirt1-mediated deacetylation due to loss of SP-C could contribute to induction of p53.
Suppression of PAI-1 expression, which is otherwise induced in AECs exposed to SP-C shRNA, and restoration of baseline uPA and uPAR expression by overexpression of p53-binding uPA, uPAR, and PAI-1 3′-UTR sequences, suggests that p53 regulates their expression by binding to 3′-UTR sequences. The blockade of p53 interaction with the uPA-fibrinolytic system prevents AEC apoptosis, which, given the role of AECs as progenitors of type I alveolar epithelial cells and the source of surfactant proteins and their depletion, impedes repair. We found increased expression of CXC chemokines and CXCR2 with augmented ICAM-1 expression in SP-C shRNA-treated AECs in vitro. AECs isolated from mice exposed to SP-C shRNA likewise show augmented expression of CXCL1/CXCL2, CXCR2, and ICAM-1, indicating that SP-C protects against lung inflammation by regulating CXC chemokine expression. Our findings are consistent with increased inflammation and prolonged recovery from injury, which has been reported in SP-C-deficient mice (18). We recently reported that CS exposure augments lung inflammation through induction of CXC chemokines and CXCR2 expression in AECs and that the process involves p53-mediated induction of PAI-1 (36). CS exposure inhibits SP-C expression in AECs, including those isolated from COPD lungs, and inhibition of SP-C using shRNA alone augments p53 and PAI-1 expression. Furthermore the, lack of induction of CXC chemokines in PAI-1-deficient AECs exposed to SP-C shRNA strongly suggests that the involvement of p53-mediated induction of PAI-1 expression contributes to inflammation. The resistance of mice lacking either p53 or PAI-1 expression to induce CXC chemokines, CXCR2, or ICAM-1 expression or neutrophil influx following exposure to CS for 20 wk further supports this fact.
Consistent with increased expression and phosphorylation of caveolin-1 at Tyr14 in AECs after BLM or CS exposure, we found that inhibition of SP-C alone induced both caveolin-1 expression and its Tyr14 phosphorylation. We and others have shown previously that increased caveolin-1 can bind directly to catalytic subunits of protein phosphatase 2A (PP2A-C) and sequester PP2A to the caveolar compartments (3, 19, 44). Since PP2A inhibits ATM kinase activity through dephosphorylation of Ser1981, increased caveolin-1-mediated sequestration of PP2A results in activation of ATM kinase (Fig. 7). These changes were associated with increased Ser15 phosphorylation and acetylation of p53, indicating that stabilization of p53 protein by posttranslational modification resulting from increased caveolin-1 function contributes to AEC apoptosis. In addition, p53 cross-talk with the uPA system results in net induction of PAI-1 accumulation in alveolar compartments (5). PAI-1 attracts PMN and other inflammatory cells to alveolar space through elaboration of chemokines by AECs (36). Proteases released by PMN and other inflammatory cells induce p53 expression and apoptosis in AECs. This is consistent with literature (38) supporting the requirement of increased caveolin-1 expression in emphysema development in mice exposed to CS. Furthermore, suppression of SP-C expression increases activity of Src kinase through suppression of CSK-mediated inhibitory phosphorylation of Src found in AECs. Activated Src can induce Tyr14 phosphorylation of caveolin-1, which is the major recognition site and substrate for activated Src kinase. In addition, activated Src can inactivate PP2A through COOH-terminal phosphorylation (29), leading to activation of ATM kinase and increased p53 expression through protein stabilization. Furthermore, inactivation of Src kinase activity using specific inhibitor or Y418F mutation induces PAI-1 expression (21). Increased p53 can also induce caveolin-1, suggesting an intricate link that possibly contributes to induction of AEC apoptosis associated with loss of SP-C expression. Upregulation of caveolin-1 negatively regulates proliferative signals, including signaling through epidermal growth factor receptor. Together these outcomes signify that loss of SP-C disturbs various pathways during lung injury, leading to AEC apoptosis and subsequent pulmonary fibrosis.
Fig. 7.

Regulation of AEC apoptosis through SP-C suppression induced p53-uPA-fibrinolytic system cross-talk. Suppression of SP-C protein by bleomycin, cigarette smoke, or SP-C shRNA triggers increased expression and phosphorylation of caveolin-1 by activated Src kinases. This in turn augmented p53 expression and activation by Lys379 acetylation and Ser15 phosphorylation. p53 binds to urokinase-type plasminogen activator (uPA), uPA plasma membrane receptor (uPAR), and plasminogen activator inhibitor (PAI-1) mRNAs, leading to suppression of uPA and uPAR and increased PAI-1 expression. This results in triggering inflammatory responses as well as in enhanced AEC apoptosis.
The degree to which SP-C deficiency may be important in induction of p53 expression and downstream AEC apoptosis or fibrotic repair is not clear. However, the present study suggests that SP-C limits lung inflammation and AEC apoptosis by tightly regulating p53 expression through posttranscriptional protein stabilization and p53-mediated downstream changes in uPA, uPAR, and PAI-1 expression. These studies further emphasize the importance of regulation of p53 expression in AECs by its AEC product to maintain architectural homeostasis in the lung alveolar compartment.
GRANTS
This study was supported in part by a Flight Attendant Medical Research Institute Clinical Innovator Award (FAMRI-ID-123010), the American Heart Association (15GRNT25800004), and National Institutes of Health Grants R01-HL1-33067-01 and R21-ES-025815 (S. Shetty).
DISCLOSURES
No conflicts of interest, financial or otherwise, are declared by the authors.
AUTHOR CONTRIBUTIONS
B.P., A.S.M., and N.T. performed experiments; B.P., A.S.M., N.T., J.F., S.I., and S.S. analyzed data; B.P., A.S.M., N.T., J.F., S.I., and S.S. interpreted results of experiments; B.P., A.S.M., and N.T. prepared figures; B.P. and S.S. drafted manuscript; B.P., A.S.M., N.T., J.F., S.I., and S.S. edited and revised manuscript; B.P., A.S.M., N.T., J.F., S.I., and S.S. approved final version of manuscript.
REFERENCES
- 1.Beers MF, Fisher AB. Surfactant protein C: a review of its unique properties and metabolism. Am J Physiol 263: L151–L160, 1992. [DOI] [PubMed] [Google Scholar]
- 2.Beers MF, Mulugeta S. Surfactant protein C biosynthesis and its emerging role in conformational lung disease. Annu Rev Physiol 67: 663–696, 2005. doi: 10.1146/annurev.physiol.67.040403.101937. [DOI] [PubMed] [Google Scholar]
- 3.Bhandary YP, Shetty SK, Marudamuthu AS, Fu J, Pinson BM, Levin J, Shetty S. Role of p53-fibrinolytic system cross-talk in the regulation of quartz-induced lung injury. Toxicol Appl Pharmacol 283: 92–98, 2015. doi: 10.1016/j.taap.2015.01.007. [DOI] [PubMed] [Google Scholar]
- 4.Bhandary YP, Shetty SK, Marudamuthu AS, Gyetko MR, Idell S, Gharaee-Kermani M, Shetty RS, Starcher BC, Shetty S. Regulation of alveolar epithelial cell apoptosis and pulmonary fibrosis by coordinate expression of components of the fibrinolytic system. Am J Physiol Lung Cell Mol Physiol 302: L463–L473, 2012. doi: 10.1152/ajplung.00099.2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Bhandary YP, Shetty SK, Marudamuthu AS, Ji HL, Neuenschwander PF, Boggaram V, Morris GF, Fu J, Idell S, Shetty S. Regulation of lung injury and fibrosis by p53-mediated changes in urokinase and plasminogen activator inhibitor-1. Am J Pathol 183: 131–143, 2013. doi: 10.1016/j.ajpath.2013.03.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Bhandary YP, Shetty SK, Marudamuthu AS, Midde KK, Ji HL, Shams H, Subramaniam R, Fu J, Idell S, Shetty S. Plasminogen activator inhibitor-1 in cigarette smoke exposure and influenza A virus infection-induced lung injury. PLoS One 10: e0123187, 2015. doi: 10.1371/journal.pone.0123187. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Chibbar R, Shih F, Baga M, Torlakovic E, Ramlall K, Skomro R, Cockcroft DW, Lemire EG. Nonspecific interstitial pneumonia and usual interstitial pneumonia with mutation in surfactant protein C in familial pulmonary fibrosis. Mod Pathol 17: 973–980, 2004. doi: 10.1038/modpathol.3800149. [DOI] [PubMed] [Google Scholar]
- 8.Corti M, Brody AR, Harrison JH. Isolation and primary culture of murine alveolar type II cells. Am J Respir Cell Mol Biol 14: 309–315, 1996. doi: 10.1165/ajrcmb.14.4.8600933. [DOI] [PubMed] [Google Scholar]
- 9.Glasser SW, Burhans MS, Korfhagen TR, Na CL, Sly PD, Ross GF, Ikegami M, Whitsett JA. Altered stability of pulmonary surfactant in SP-C-deficient mice. Proc Natl Acad Sci USA 98: 6366–6371, 2001. doi: 10.1073/pnas.101500298. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Glasser SW, Detmer EA, Ikegami M, Na CL, Stahlman MT, Whitsett JA. Pneumonitis and emphysema in sp-C gene targeted mice. J Biol Chem 278: 14291–14298, 2003. doi: 10.1074/jbc.M210909200. [DOI] [PubMed] [Google Scholar]
- 11.Glasser SW, Maxfield MD, Ruetschilling TL, Akinbi HT, Baatz JE, Kitzmiller JA, Page K, Xu Y, Bao EL, Korfhagen TR. Persistence of LPS-induced lung inflammation in surfactant protein-C-deficient mice. Am J Respir Cell Mol Biol 49: 845–854, 2013. doi: 10.1165/rcmb.2012-0374OC. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Glasser SW, Senft AP, Maxfield MD, Ruetschilling TL, Baatz JE, Page K, Korfhagen TR. Genetic replacement of surfactant protein-C reduces respiratory syncytial virus induced lung injury. Respir Res 14: 19, 2013. doi: 10.1186/1465-9921-14-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Glasser SW, Senft AP, Whitsett JA, Maxfield MD, Ross GF, Richardson TR, Prows DR, Xu Y, Korfhagen TR. Macrophage dysfunction and susceptibility to pulmonary Pseudomonas aeruginosa infection in surfactant protein C-deficient mice. J Immunol 181: 621–628, 2008. doi: 10.4049/jimmunol.181.1.621. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Glasser SW, Witt TL, Senft AP, Baatz JE, Folger D, Maxfield MD, Akinbi HT, Newton DA, Prows DR, Korfhagen TR. Surfactant protein C-deficient mice are susceptible to respiratory syncytial virus infection. Am J Physiol Lung Cell Mol Physiol 297: L64–L72, 2009. doi: 10.1152/ajplung.90640.2008. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Gower WA, Nogee LM. Surfactant dysfunction. Paediatr Respir Rev 12: 223–229, 2011. doi: 10.1016/j.prrv.2011.01.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Gupta R, Hernández-Juviel JM, Waring AJ, Walther FJ. Synthetic lung surfactant reduces alveolar-capillary protein leakage in surfactant-deficient rabbits. Exp Lung Res 41: 293–299, 2015. doi: 10.3109/01902148.2015.1024354. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Kuwano K, Kunitake R, Maeyama T, Hagimoto N, Kawasaki M, Matsuba T, Yoshimi M, Inoshima I, Yoshida K, Hara N. Attenuation of bleomycin-induced pneumopathy in mice by a caspase inhibitor. Am J Physiol Lung Cell Mol Physiol 280: L316–L325, 2001. [DOI] [PubMed] [Google Scholar]
- 18.Lawson WE, Polosukhin VV, Stathopoulos GT, Zoia O, Han W, Lane KB, Li B, Donnelly EF, Holburn GE, Lewis KG, Collins RD, Hull WM, Glasser SW, Whitsett JA, Blackwell TS. Increased and prolonged pulmonary fibrosis in surfactant protein C-deficient mice following intratracheal bleomycin. Am J Pathol 167: 1267–1277, 2005. doi: 10.1016/S0002-9440(10)61214-X. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Li L, Ren CH, Tahir SA, Ren C, Thompson TC. Caveolin-1 maintains activated Akt in prostate cancer cells through scaffolding domain binding site interactions with and inhibition of serine/threonine protein phosphatases PP1 and PP2A. Mol Cell Biol 23: 9389–9404, 2003. doi: 10.1128/MCB.23.24.9389-9404.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Liu T, Sano K, Ogiwara N, Kobayashi N. A novel surfactant protein C L55F mutation associated with interstitial lung disease alters subcellular localization of proSP-C in A549 cells. Pediatr Res 79: 27–33, 2016. doi: 10.1038/pr.2015.178. [DOI] [PubMed] [Google Scholar]
- 21.Marudamuthu AS, Bhandary YP, Shetty SK, Fu J, Sathish V, Prakash Y, Shetty S. Role of the urokinase-fibrinolytic system in epithelial-mesenchymal transition during lung injury. Am J Pathol 185: 55–68, 2015. doi: 10.1016/j.ajpath.2014.08.027. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Marudamuthu AS, Shetty SK, Bhandary YP, Karandashova S, Thompson M, Sathish V, Florova G, Hogan TB, Pabelick CM, Prakash YS, Tsukasaki Y, Fu J, Ikebe M, Idell S, Shetty S. Plasminogen activator inhibitor-1 suppresses profibrotic responses in fibroblasts from fibrotic lungs. J Biol Chem 290: 9428–9441, 2015. doi: 10.1074/jbc.M114.601815. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Moya FR, Gadzinowski J, Bancalari E, Salinas V, Kopelman B, Bancalari A, Kornacka MK, Merritt TA, Segal R, Schaber CJ, Tsai H, Massaro J, d’Agostino R; International Surfaxin Collaborative Study Group . A multicenter, randomized, masked, comparison trial of lucinactant, colfosceril palmitate, and beractant for the prevention of respiratory distress syndrome among very preterm infants. Pediatrics 115: 1018–1029, 2005. doi: 10.1542/peds.2004-2183. [DOI] [PubMed] [Google Scholar]
- 24.Mulugeta S, Nguyen V, Russo SJ, Muniswamy M, Beers MF. A surfactant protein C precursor protein BRICHOS domain mutation causes endoplasmic reticulum stress, proteasome dysfunction, and caspase-3 activation. Am J Respir Cell Mol Biol 32: 521–530, 2005. doi: 10.1165/rcmb.2005-0009OC. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Nogee LM, Dunbar AE 3rd, Wert SE, Askin F, Hamvas A, Whitsett JA. A mutation in the surfactant protein C gene associated with familial interstitial lung disease. N Engl J Med 344: 573–579, 2001. doi: 10.1056/NEJM200102223440805. [DOI] [PubMed] [Google Scholar]
- 26.Ota C, Yamada M, Fujino N, Motohashi H, Tando Y, Takei Y, Suzuki T, Takahashi T, Kamata S, Makiguchi T, Yamaya M, Kubo H. Histone deacetylase inhibitor restores surfactant protein-C expression in alveolar-epithelial type II cells and attenuates bleomycin-induced pulmonary fibrosis in vivo. Exp Lung Res 41: 422–434, 2015. doi: 10.3109/01902148.2015.1060275. [DOI] [PubMed] [Google Scholar]
- 27.Perez-Gil J, Weaver TE. Pulmonary surfactant pathophysiology: current models and open questions. Physiology (Bethesda) 25: 132–141, 2010. doi: 10.1152/physiol.00006.2010. [DOI] [PubMed] [Google Scholar]
- 28.Raghavendran K, Willson D, Notter RH. Surfactant therapy for acute lung injury and acute respiratory distress syndrome. Crit Care Clin 27: 525–559, 2011. doi: 10.1016/j.ccc.2011.04.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Roskoski R., Jr Src kinase regulation by phosphorylation and dephosphorylation. Biochem Biophys Res Commun 331: 1–14, 2005. doi: 10.1016/j.bbrc.2005.03.012. [DOI] [PubMed] [Google Scholar]
- 30.Salerno T, Peca D, Menchini L, Schiavino A, Boldrini R, Esposito F, Danhaive O, Cutrera R. Surfactant Protein C-associated interstitial lung disease; three different phenotypes of the same SFTPC mutation. Ital J Pediatr 42: 23, 2016. doi: 10.1186/s13052-016-0235-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Shetty SK, Bhandary YP, Marudamuthu AS, Abernathy D, Velusamy T, Starcher B, Shetty S. Regulation of airway and alveolar epithelial cell apoptosis by p53-Induced plasminogen activator inhibitor-1 during cigarette smoke exposure injury. Am J Respir Cell Mol Biol 47: 474–483, 2012. doi: 10.1165/rcmb.2011-0390OC. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Shetty S, Shetty P, Idell S, Velusamy T, Bhandary YP, Shetty RS. Regulation of plasminogen activator inhibitor-1 expression by tumor suppressor protein p53. J Biol Chem 283: 19570–19580, 2008. doi: 10.1074/jbc.M710268200. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Sinha SK, Lacaze-Masmonteil T, Valls i Soler A, Wiswell TE, Gadzinowski J, Hajdu J, Bernstein G, Sanchez-Luna M, Segal R, Schaber CJ, Massaro J, d’Agostino R; Surfaxin Therapy Against Respiratory Distress Syndrome Collaborative Group . A multicenter, randomized, controlled trial of lucinactant versus poractant alfa among very premature infants at high risk for respiratory distress syndrome. Pediatrics 115: 1030–1038, 2005. doi: 10.1542/peds.2004-2231. [DOI] [PubMed] [Google Scholar]
- 34.Spragg RG, Lewis JF, Walmrath H-D, Johannigman J, Bellingan G, Laterre P-F, Witte MC, Richards GA, Rippin G, Rathgeb F, Häfner D, Taut FJH, Seeger W. Effect of recombinant surfactant protein C-based surfactant on the acute respiratory distress syndrome. N Engl J Med 351: 884–892, 2004. doi: 10.1056/NEJMoa033181. [DOI] [PubMed] [Google Scholar]
- 35.Thomas AQ, Lane K, Phillips J III, Prince M, Markin C, Speer M, Schwartz DA, Gaddipati R, Marney A, Johnson J, Roberts R, Haines J, Stahlman M, Loyd JE. Heterozygosity for a surfactant protein C gene mutation associated with usual interstitial pneumonitis and cellular nonspecific interstitial pneumonitis in one kindred. Am J Respir Crit Care Med 165: 1322–1328, 2002. doi: 10.1164/rccm.200112-123OC. [DOI] [PubMed] [Google Scholar]
- 36.Tiwari N, Marudamuthu AS, Tsukasaki Y, Ikebe M, Fu J, Shetty S. p53- and PAI-1-mediated induction of C-X-C chemokines and CXCR2: importance in pulmonary inflammation due to cigarette smoke exposure. Am J Physiol Lung Cell Mol Physiol 310: L496–L506, 2016. doi: 10.1152/ajplung.00290.2015. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Tredano M, Griese M, Brasch F, Schumacher S, de Blic J, Marque S, Houdayer C, Elion J, Couderc R, Bahuau M. Mutation of SFTPC in infantile pulmonary alveolar proteinosis with or without fibrosing lung disease. Am J Med Genet A 126A: 18–26, 2004. doi: 10.1002/ajmg.a.20670. [DOI] [PubMed] [Google Scholar]
- 38.Volonte D, Kahkonen B, Shapiro S, Di Y, Galbiati F. Caveolin-1 expression is required for the development of pulmonary emphysema through activation of the ATM-p53-p21 pathway. J Biol Chem 284: 5462–5466, 2009. doi: 10.1074/jbc.C800225200. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Wambach JA, Yang P, Wegner DJ, An P, Hackett BP, Cole FS, Hamvas A. Surfactant protein-C promoter variants associated with neonatal respiratory distress syndrome reduce transcription. Pediatr Res 68: 216–220, 2010. doi: 10.1203/PDR.0b013e3181eb5d68. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Wang D, Morales JE, Calame DG, Alcorn JL, Wetsel RA. Transplantation of human embryonic stem cell-derived alveolar epithelial type II cells abrogates acute lung injury in mice. Mol Ther 18: 625–634, 2010. doi: 10.1038/mt.2009.317. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Wang R, Ibarra-Sunga O, Verlinski L, Pick R, Uhal BD. Abrogation of bleomycin-induced epithelial apoptosis and lung fibrosis by captopril or by a caspase inhibitor. Am J Physiol Lung Cell Mol Physiol 279: L143–L151, 2000. [DOI] [PubMed] [Google Scholar]
- 42.Willson DF, Chess PR, Notter RH. Surfactant for pediatric acute lung injury. Pediatr Clin North Am 55: 545–575, 2008. doi: 10.1016/j.pcl.2008.02.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Yamamoto T, Yokozeki H, Nishioka K. Fas- and FasL-deficient mice are resistant to the induction of bleomycin-induced scleroderma. Arch Dermatol Res 298: 465–468, 2007. doi: 10.1007/s00403-006-0712-y. [DOI] [PubMed] [Google Scholar]
- 44.Zuluaga S, Álvarez-Barrientos A, Gutiérrez-Uzquiza A, Benito M, Nebreda AR, Porras A. Negative regulation of Akt activity by p38α MAP kinase in cardiomyocytes involves membrane localization of PP2A through interaction with caveolin-1. Cell Signal 19: 62–74, 2007. doi: 10.1016/j.cellsig.2006.05.032. [DOI] [PubMed] [Google Scholar]






