Skip to main content
PLOS One logoLink to PLOS One
. 2017 Jul 5;12(7):e0180335. doi: 10.1371/journal.pone.0180335

Characterization of clinical Vibrio parahaemolyticus strains in Zhoushan, China, from 2013 to 2014

Hongling Wang 1,2,*,#, Xiaoyang Tang 3,#, Yi-Cheng Su 4, Jiabei Chen 1,2, Jianbo Yan 1,2
Editor: Patrick Butaye5
PMCID: PMC5498046  PMID: 28678810

Abstract

Vibrio parahaemolyticus is recognized as major cause of foodborne illness of global public health concern. This study collected 107 strains of V. parahaemolyticus during active surveillance of diarrheal diseases in hospitals in Zhoushan during 2013 to 2014 and investigated their serotypes, virulence genes (tdh, trh, and orf8), antimicrobial resistance, and genotypes. The dominant serotypes of the 107 clinical strains were O3:K6, O4:K8, and O4:KUT with 87.9% and 3.7% of the strains carrying the virulence genes tdh and trh, respectively. Molecular typing by pulsed-field gel electrophoresis indicated divergence among the clinical strains. Most isolates were sensitive to the common antimicrobial agents used against the Vibrio species except ampicillin. We conclude that continuous surveillance of V. parahaemolyticus in diarrhea patients is a public health priority and is useful for conducting risk assessment of foodborne illnesses caused by V. parahaemolyticus.

Introduction

Vibrio parahaemolyticus is a gram-negative halophilic human pathogen that naturally occurs in marine or estuarine environments, which is frequently isolated from a variety of seafood, such as shrimp, oyster, and fish [1–3]. Infections caused by V. parahaemolyticus can cause acute human gastroenteritis with major symptoms of headache, abdominal pain, and diarrhea, and in some cases, wound infection and septicemia [4–6]. This foodborne pathogen is considered the leading cause of seafood-derived illness in many countries around the world, including the United States, Thailand, Malaysia, Japan, Korea, and China [6–9]. In China, a total of 322 gastroenteritis outbreaks involving 9,041 illnesses and 3,948 hospitalizations due to V. parahaemolyticus infection were reported from 2003 to 2008 [10].

Zhoushan Fishery is the largest fishery in China. The output of aquatic products in Zhoushan is around 1.3 million tons annually, meanwhile, the offshore ocean fishing output account formore than one tenth of the total output in China [11]. Many citizens of Zhoushan in China regularly consume raw or undercooked seafood. Therefore, V. parahaemolyticus is a common regional pathogen, which causes more than 70% of the food-poisoning cases in Zhoushan [12]. Despite the high risk of V. parahaemolyticus, information regarding the prevalence or molecular epidemiology of this pathogen is not readily available.

The main objective of the present study was to investigate V. parahaemolyticus strains collected from stool specimens of outpatients with diarrheal disease in Zhoushan hospitals and to analyze their serotypes, virulence genes, genotypic traits, and antimicrobial resistance. The investigation will provide vital information to government agencies for performing risk assessments of V. parahaemolyticus infections.

Materials and methods

Bacterial isolates

A total of 107 clinical V. parahaemolyticus isolates were used in the present study. They were collected from the stool specimens of 107 sporadic diarrhea outpatients from the active surveillance hospital: Zhoushan hospital. All isolates were collected from 2013 (41 isolates) to 2014 (66 isolates). The 107 isolates were stored at -80°C in trypticase soy broth (TSB) containing 20% glycerol for further analysis.

Analysis of virulence genes and Kanagawa phenomenon

Vibrio parahaemolyticus can be detected by a species-specific marker (tlh) with the pathogenic strains carrying an additional tdh and/or trh gene. In addition, a distinctive eighth open reading frame of the filamentous phage f237, orf8, has been suggested as an useful genetic marker for identification of those pathogenic strains [13–15].

Determination of tlh tdh, and trh genes as well as the marker (orf8) for the V. parahaemolyticus isolates was performed using multiplex polymerase chain reaction (PCR) according to the methods of Ward and Bej [16] (Table 1). The pathogenic group was defined as tdh+ and/or trh+; all other isolates were assigned to the non-pathogenic group [15, 17].

Table 1. Oligonucleotide primers used for polymerase chain reactions [16].

Target genes Primers (Probes) Sequence (5’-3’) Amplicon
Size (bp)
tlh F-tl AAAGCGGATTATGCAGAAGCACTG 450
R-tl GCTACTTTCTAGCATTTTCTCTGC
P-tl952 AAGAACTTCATGTTGATGACACT
tdh F-tdh170DG GTAAAGGTCTCTGACTTTTGGAC 229
R-tdh403 CTACAGAATCATAGGAATGTTGAAG
P-tdh-341R ATTTTACGAACACAGCAGAATGA
trh F-trh82 CCATCAATACCTTTTCCTTCTCC 207
R-trh287c ACCGTCATATAGGCGCTTAAC
P-trh275 TATTTGTCGTTAGAAATACAACAAT
orf8 F-O3MM824 AGGACGCAGTTACGCTTGATG 369
R-O3MM1192 CTAACGCATTGTCCCTTTGTAG
P-ORFORF8-853 AAGCCATTAACAGTTGAAGGCGTTGACT

Analysis of the Kanagawa phenomenon produced by the V. parahaemolyticus isolates was conducted using Wagatsuma blood agar (OXOID, Cambridge, UK) according to China National Food Safety Standard methods, GB 4789.7–2013. Each V. parahaemolyticus isolate was cultured on a plate of tryptic soy agar (OXOID, Cambridge, UK) containing 3% NaCl for 18 h and then spotted on a Wagatsuma agar plate. The Wagatsuma agar plates were incubated for 18–24 h at 37°C and examined for Kanagawa phenomenon within 24 h.

Serotyping

Serological analysis of lipopolysaccharide (O) and capsular (K) antigens of the V. parahaemolyticus isolates was identified by performing agglutination tests using a commercial V. parahaemolyticus antiserum test kit (Denka Seiken, Tokyo, Japan) according to the manufacturer’s instructions.

Pulsed-field gel electrophoresis (PFGE)

The PFGE analysis of the V. parahaemolyticus isolates was performed according to the PulseNet protocol (http://www.pulsenetinternational.org). Briefly, using NotI enzyme to restrict the chromosomal DNA. The restriction fragments were resolved with 1% seakem gold agarose gel in 0.5% Tris-boric acid-EDTA buffer using a CHEF Mapper XA system (Bio-Rad Laboratories, Richmond, Calif., USA). The XbaI digested DNA from Salmonella enterica serotype Braenderup strain H9812 was used as a molecular size marker. The PFGE patterns were analyzed using BioNumerics software (Applied Maths, Belgium). Clustering was performed using the unweighted pair group method and the Dice correlation coefficient with a position tolerance of 1.5%. Clusters were defined on the basis of a 90% similarity cutoff [18].

Antimicrobial susceptibility testing

The antimicrobial susceptibility of the 107 clinical V. parahaemolyticus isolates was tested using the broth microdilution method. The results of antimicrobial susceptibility were interpreted as sensitive, intermediate, or resistant, according to the Clinical and Laboratory Standards Institute (CLSI) breakpoint for Vibrio species (not V. cholerae). Escherichia coli ATCC 25922 was used as a control. The results were analyzed using the CLSI breakpoints.

Results

Distribution of pathogenic and non-pathogenic strains

All of the 107 clinical isolates (100%, 107/107) were positive for the tlh gene, among which there were 94 isolates (87.9%, 94/107) carrying the tdh gene, and only 4 isolates (3.7%, 4/107) carrying the trh gene. In addition, 12 isolates (11.2%, 12/107) isolated from the diarrheal patients were non-pathogenic strains containing neither the tdh gene nor the trh gene, whereas 92 (86.0%, 92/107) of the tested isolates were classified as pathogenic strains.

28 isolates (26.2%, 28/107) carried the orf8 gene. 12 isolates (11.2%, 12/107) were determined to carry no tdh, trh, or orf8 genes. Analysis of the Kanagawa phenomenon (KP) and molecular detection of virulence genes by PCR of the 107 V. parahaemolyticus isolates revealed high percentages of clinical isolates producing KP (80/107, 74.8%) and carrying the tdh gene (87.9%, 94/107). Among them, 79 isolates (73.8%, 79/107) were positive for both KP and the tdh gene and 3 isolates (2.8%) were positive for both KP and the trh gene.

Serotyping

Serological analysis of the 107 V. parahaemolyticus isolates revealed a total of 10 serovars with O4:K8 (33.6%, 36/107) being the most common one followed by O3:K6 (29.0%, 31/107). These results indicate an increase in the occurrence of O3:K6 strains from 17.1% (7/41) in 2013 to 36.4% (24/66) in 2014 (Fig 1). However, the occurrence of the O4:K8 strains decreased from 51.2% (21/41) in 2013 to 22.7% (15/66) in 2014.

Fig 1. Serological analysis of clinical V. parahaemolyticus isolates from patients in Zhoushan in 2013 (n = 41) and 2014 (n = 66).

Fig 1

Although all of the 107 isolates were each identified for its O antigen, 40 isolates with 8 (O) serotypes could not be serotyped for K antisera [O4:KUT (20), O1:KUT (6), O3:KUT (5), O10:KUT (3), O5:KUT (2), O12:KUT (2), O2:KUT (1), and O11:KUT (1)]. Among them, only two serotypes (O3:KUT and O4:KUT) were detected in the 2013 isolates, while all of the 8 serotypes were observed in the 2014 isolates (Table 2).

Table 2. Serotypes and virulence factors of 107 clinical V. parahaemolyticus isolated from patients in Zhoushan between 2013 and 2014.

O serogroups Serovars No. of isolate (s) Virulence index
tdh trh orf8 a Kanagawa phenomenon
O1 O1:KUT 1 + + − +
1 + − − +
4 − − − −
O2 O2:KUT 1 − − − +
O3 O3:K6 18 + − + +
4 + − + −
8 + − − +
1 + − − −
O3:KUT 2 + − − +
3 − − − −
O4 O4:K8 2 + − + +
32 + − − +
2 + − − −
O4:KUT 2 + − + +
1 + − + −
10 + − − +
7 + − − −
O5 O5:KUT 2 − − − −
O10 O10:KUT 2 + + − +
1 − − − −
O11 O11:KUT 1 − + − −
O12 O12:KUT 1 + − + +
1 − − − −

a Associated with pandemic isolates.

PFGE and cluster analysis

Analysis of the genotypes of the 107 clinical V. parahaemolyticus isolates found that 4 of the isolates were non-typable due to DNA degradation during endonuclease digestion. PFGE analysis of the remaining 103 isolates yielded 23 distinguishable patterns at a 90% similarity threshold (Fig 2). Among them, 35 isolates were clustered in pattern 9, which contained isolates belonging to two different serotypes, O4:K8 and O4:KUT. Furthermore, the isolates, which were O3:K6 serotype were not all included in the same group, such as VP012 and VP029 were clustered in pattern 14 and the other O3:K6 isolates were clustered in pattern 10, 11, 12 and 13.

Fig 2. Pulsed-field gel electrophoresis of NotI-digested genomic DNA of selected clinical and foodborne V. parahaemolyticus isolates obtained in Zhoushan.

Fig 2

Strain identification number, isolation date, and seromarkers.

Antimicrobial resistance profile

The antimicrobial susceptibilities of V. parahaemolyticus are listed in Table 3. The largest proportion of V. parahaemolyticus strains was resistant to ampicillin (85.5%, 91/106). More than half of the isolates exhibited intermediate levels of susceptibility to cefazolin (54.7%, 58/106). Additionally, more than 94% of the isolates were sensitive to other antimicrobials including gentamicin, amikacin, meropenem, imipenem, cefoxitin, cefepime, ceftazidime, trimethoprim/sulfamethoxazole, chloramphenicol, amoxicillin/clavulanic acid, ciprofloxacin, levofloxacin and tetracycline.

Table 3. Antimicrobial susceptibility testing of 107 V. parahaemolyticus strains.

Antimicrobial agent Susceptible (%) Intermediate (%) Resistant (%)
Gentamicin 94.4 4.7 0.9
Amikacin 96.2 3.8 0.0
Meropenem 100.0 0.0 0.0
Imipenem 100.0 0.0 0.0
Cefoxitin 100.0 0.0 0.0
Cefepime 99.1 0.9 0.0
Ceftazidime 100.0 0.0 0.0
Cefazolin 45.3 54.7 0.0
Trimethoprim/sulfamethoxazole 100.0 0.0 0.0
Chloramphenicol 100.0 0.0 0.0
Amoxicillin/clavulanic acid 100.0 0.0 0.0
Ampicillin 0.0 14.2 85.8
Ciprofloxacin 100.0 0.0 0.0
Levofloxacin 100.0 0.0 0.0
Tetracycline 100.0 0.0 0.0

Discussion

V. parahaemolyticus has emerged as an important public health concern worldwide as a pathogen that causes gastroenteritis related to the consumption of various seafood, including crab, shrimp, lobster, fish, and oysters [19]. In the present study, 107 clinical V. parahaemolyticus strains were collected from 2013 to 2014 in Zhoushan, we identified and analyzed the virulence genes, serotypes, molecular typing by PFGE, and antimicrobial resistance profiles of these clinical strains.

As shown by epidemiological investigation, thermostable direct hemolysin (TDH) is recognized as one of the major pathogenic factors in V. parahaemolyticus, and is present in 92% to 95% clinical isolates [19, 20], and it contributes to the formation the “Kanagawa phenomenon” (KP) [19], which has been regarded as an important indicator for the identification of pathogenic and non-pathogenic strains [19]. In the present study, among 94 tdh+ clinical strains, 15 strains did not show KP, moreover, we found one clinical strain (1/107) that tested positive for KP, though it carried neither tdh nor trh. Therefore, the KP is not a reliable indicator for identifying pathogenic and non-pathogenic V. parahaemolyticus strains [19].

As shown in Table 2, 87.9% of the strains carried tdh, and only 4 strains carried trh, that is, 91.5% of the strains carried tdh and/or trh gene. This is similar to a previous study reporting 92.5% of the clinical isolates of V. parahaemolyticus collected in Shanghai as carrying the tdh and/or trh gene [20]. Furthermore, 11.2% of clinical strains from the diarrheal patients contained neither the tdh nor the trh gene, which is similar to a previous study reporting 11.8% of clinical isolates of V. parahaemolyticus collected in Jiangsu province as carrying neither the tdh gene nor the trh gene [15]. It has been reported that there were outbreaks caused by strains lacking of tdh and/or trh [21]. Although other pathogenic factors have been recognized, such as type III secretion system 1 and 2 and biofilm formation, the understanding of pathogenicityis still incomplete [21]. Meanwhile, 28 strains contained orf8. The orf8 is suggested to be a marker for detecting recent serotype O3:K6 and other pandemic group strains [16], which were considered as a good target for detection of pathogenic pandemic V. parahaemolyticus O3:K6 serotype strains. As shown in the current study, the hemolysin genes (tdh and trh) and orf8 were tested, furthermore, more pandemic markers, such as toxRS/new and type III secretion system could be analyzed to reveal comprehensive pathogenic and pandemic characteristics of clinical V. parahaemolyticus strains in Zhoushan.

Since V. parahaemolyticus was discovered 60 years ago [22], it has been considered as a major cause of foodborne illnesses all over the world with serotype O3:K6 being firstly isolated in 1996 in India and subsequently worldwide [15, 23]. In this study, 31 (29%) of 107 clinical V. parahaemolyticus isolates collected over 2 years from 2013 to 2014 were identified as O3:K6, which is lower than the previous study reporting 54%, 62% and 66% of the clinical isolates of V. parahaemolyticus collected in Guangdong, Shanghai and Jiangsu respectively [15, 20, 24]. These results demonstrate that V. parahaemolyticus strains with different serotypes can share common molecular types, therefore, the serotyping was of limited use because there was no match between serotype and PFGE cluster. PFGE has been used as the “gold standard” method to assess genetic diversity and clonal relatedness among V. parahaemolyticus isolates from different sources [18, 20, 25].

Antibiotics can be used to treat V. parahaemolyticus infection, and they should be based on the antimicrobial susceptibilities of V. parahaemolyticus. In the present study, most isolates were sensitive to the antimicrobial agents recommended by CLSI for Vibrio species (not V. cholerae) except ampicillin (85.8%). Similar findings have been reported by Chen et al (87.1%) [17]. As shown in Table 3, 100% of the clinical strains in the present study were susceptible to Meropenem, Imipenem, Cefoxitin, Ceftazidime, Trimethoprim/sulfamethoxazole, Chloramphenicol, Amoxicillin/clavulanic acid, Ciprofloxacin, Levofloxacin and Tetracycline.

To the best of our knowledge, this is the first study to investigate virulence factors, serotypes, genotypes, and antimicrobial susceptibility of the clinical strains of V. parahaemolyticus collected in Zhoushan over 2 years through a continuous surveillance of V. parahaemolyticus isolated from patients during warm months. Continuous monitoring of V. parahaemolyticus strains in Zhoushan is necessary to generate information useful for the control of foodborne illnesses caused by V. parahaemolyticus.

Conclusions

This study analyzed characteristics of V. parahaemolyticus strains in diarrheal patients in Zhoushan. Different serotypes were detected in the clinical isolates. Although the clinical V. parahaemolyticus strains isolated in Zhoushan are not resistant to most common antimicrobial agents, it will be necessary to keep a close attention to the emergence of antimicrobial resistant strains and strengthen the management of antimicrobials. Therefore, this information is useful for the control and treatment of foodborne illnesses caused by V. parahaemolyticus in Zhoushan.

Data Availability

All relevant data are within the paper.

Funding Statement

This research was supported by the grants from Bureau of Science and Technology of Zhoushan (Project NO. 2014C31073).

References

  • 1.Ludeke CH, Gonzalez-Escalona N, Fischer M, Jones JL. Examination of clinical and environmental Vibrio parahaemolyticus isolates by multi-locus sequence typing (MLST) and multiple-locus variable-number tandem-repeat analysis (MLVA). Front Microbiol. 2015;6:564 doi: 10.3389/fmicb.2015.00564 ; PubMed Central PMCID: PMC4462150. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Liao Y, Li Y, Wu S, Mou J, Xu Z, Cui R, et al. Risk Factors for Vibrio parahaemolyticus Infection in a Southern Coastal Region of China. Foodborne Pathog Dis. 2015;12(11):881–6. doi: 10.1089/fpd.2015.1988 ; PubMed Central PMCID: PMC4675456. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Zarei M, Maktabi S, Ghorbanpour M. Prevalence of Listeria monocytogenes, Vibrio parahaemolyticus, Staphylococcus aureus, and Salmonella spp. in seafood products using multiplex polymerase chain reaction. Foodborne Pathog Dis. 2012;9(2):108–12. doi: 10.1089/fpd.2011.0989 . [DOI] [PubMed] [Google Scholar]
  • 4.Broberg CA, Calder TJ, Orth K. Vibrio parahaemolyticus cell biology and pathogenicity determinants. Microbes and infection / Institut Pasteur. 2011;13(12–13):992–1001. doi: 10.1016/j.micinf.2011.06.013 ; PubMed Central PMCID: PMC3384537. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Su YC, Liu C. Vibrio parahaemolyticus: a concern of seafood safety. Food Microbiol. 2007;24(6):549–58. doi: 10.1016/j.fm.2007.01.005 . [DOI] [PubMed] [Google Scholar]
  • 6.Xie J, Sun X, Pan Y, Zhao Y. Combining basic electrolyzed water pretreatment and mild heat greatly enhanced the efficacy of acidic electrolyzed water against Vibrio parahaemolyticus on shrimp. Food Control. 2012;23(2):320–4. doi: 10.1016/j.foodcont.2011.07.019 [Google Scholar]
  • 7.Yamamoto A, Iwahori J, Vuddhakul V, Charernjiratragul W, Vose D, Osaka K, et al. Quantitative modeling for risk assessment of Vibrio parahaemolyticus in bloody clams in southern Thailand. International journal of food microbiology. 2008;124(1):70–8. doi: 10.1016/j.ijfoodmicro.2008.02.021 . [DOI] [PubMed] [Google Scholar]
  • 8.Iwahori J, Yamamoto A, Suzuki H, Yamamoto T, Tsutsui T, Motoyama K, et al. Quantitative risk assessment of Vibrio parahaemolyticus in finfish: a model of raw horse mackerel consumption in Japan. Risk Anal. 2010;30(12):1817–32. doi: 10.1111/j.1539-6924.2010.01444.x . [DOI] [PubMed] [Google Scholar]
  • 9.Yoon KS, Min KJ, Jung YJ, Kwon KY, Lee JK, Oh SW. A model of the effect of temperature on the growth of pathogenic and nonpathogenic Vibrio parahaemolyticus isolated from oysters in Korea. Food Microbiol. 2008;25(5):635–41. doi: 10.1016/j.fm.2008.04.007 . [DOI] [PubMed] [Google Scholar]
  • 10.Wu Y, Wen J, Ma Y, Ma X, Chen Y. Epidemiology of foodborne disease outbreaks caused by Vibrio parahaemolyticus, China, 2003–2008. Food Control. 2014;46:197–202. doi: 10.1016/j.foodcont.2014.05.023 [Google Scholar]
  • 11.Wang X, Zhang H, Zhang L, Zhong K, Shang X, Zhao Y, et al. Assessment on dioxin-like compounds intake from various marine fish from Zhoushan Fishery, China. Chemosphere. 2015;118(0):163–9. doi: 10.1016/j.chemosphere.2014.07.057 . [DOI] [PubMed] [Google Scholar]
  • 12.Xue C GH. Quantitative measurement of seafood Vibrio parahaemolyticus in Zhoushan city, Zhejiang province. Disease Surveillance. 2008;23(7):424–6. [Google Scholar]
  • 13.Han H, Li F, Yan W, Guo Y, Li N, Liu X, et al. Temporal and Spatial Variation in the Abundance of Total and Pathogenic Vibrio parahaemolyticus in Shellfish in China. PLoS One. 2015;10(6):e0130302 doi: 10.1371/journal.pone.0130302 ; PubMed Central PMCID: PMC4465338. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Vongxay K, Pan Z, Zhang X, Wang S, Cheng S, Mei L, et al. Occurrence of pandemic clones of Vibrio parahaemolyticus isolates from seafood and clinical samples in a Chinese coastal province. Foodborne Pathog Dis. 2008;5(2):127–34. doi: 10.1089/fpd.2007.0045 . [DOI] [PubMed] [Google Scholar]
  • 15.Chao G, Jiao X, Zhou X, Yang Z, Huang J, Pan Z, et al. Serodiversity, pandemic O3:K6 clone, molecular typing, and antibiotic susceptibility of foodborne and clinical Vibrio parahaemolyticus isolates in Jiangsu, China . Foodborne Pathog Dis. 2009;6(8):1021–8. doi: 10.1089/fpd.2009.0295 . [DOI] [PubMed] [Google Scholar]
  • 16.Ward LN, Bej AK. Detection of Vibrio parahaemolyticus in shellfish by use of multiplexed real-time PCR with TaqMan fluorescent probes. Applied and environmental microbiology. 2006;72(3):2031–42. doi: 10.1128/AEM.72.3.2031-2042.2006 ; PubMed Central PMCID: PMC1393209. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Chen Y, Chen X, Yu F, Wu M, Wang R, Zheng S, et al. Serology, virulence, antimicrobial susceptibility and molecular characteristics of clinical Vibrio parahaemolyticus strains circulating in southeastern China from 2009 to 2013. Clinical microbiology and infection: the official publication of the European Society of Clinical Microbiology and Infectious Diseases. 2016;22(3):258 e9–16. doi: 10.1016/j.cmi.2015.11.003 . [DOI] [PubMed] [Google Scholar]
  • 18.Tsai SE, Jong KJ, Tey YH, Yu WT, Chiou CS, Lee YS, et al. Molecular characterization of clinical and environmental Vibrio parahaemolyticus isolates in Taiwan. International journal of food microbiology. 2013;165(1):18–26. doi: 10.1016/j.ijfoodmicro.2013.04.017 . [DOI] [PubMed] [Google Scholar]
  • 19.Wang R, Zhong Y, Gu X, Yuan J, Saeed AF, Wang S. The pathogenesis, detection, and prevention of Vibrio parahaemolyticus. Front Microbiol. 2015;6:144 doi: 10.3389/fmicb.2015.00144 ; PubMed Central PMCID: PMC4350439. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Zhang H, Sun S, Shi W, Cui L, Gu Q. Serotype, virulence, and genetic traits of foodborne and clinical Vibrio parahaemolyticus isolates in Shanghai, China . Foodborne Pathog Dis. 2013;10(9):796–804. doi: 10.1089/fpd.2012.1378 . [DOI] [PubMed] [Google Scholar]
  • 21.Mahoney JC, Gerding MJ, Jones SH, Whistler CA. Comparison of the pathogenic potentials of environmental and clinical Vibrio parahaemolyticus strains indicates a role for temperature regulation in virulence. Applied and environmental microbiology. 2010;76(22):7459–65. doi: 10.1128/AEM.01450-10 ; PubMed Central PMCID: PMC2976215. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Shinoda S. Sixty Years from the Discovery of Vibrio parahaemolyticus and Some Recollections. Biocontrol science. 2011;16(4):129–37. . [DOI] [PubMed] [Google Scholar]
  • 23.de Jesus Hernandez-Diaz L, Leon-Sicairos N, Velazquez-Roman J, Flores-Villasenor H, Guadron-Llanos AM, Martinez-Garcia JJ, et al. A pandemic Vibrio parahaemolyticus O3:K6 clone causing most associated diarrhea cases in the Pacific Northwest coast of Mexico. Front Microbiol. 2015;6:221 doi: 10.3389/fmicb.2015.00221 ; PubMed Central PMCID: PMC4371747. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Li B, Luo J, Tan H, Ke B, He D, Ke C, et al. Phenotypic and phylogenetic analysis of Vibrio parahaemolyticus isolates recovered from diarrhea cases in Guangdong Province, China. International journal of food microbiology. 2015;200:13–7. doi: 10.1016/j.ijfoodmicro.2014.12.009 ; PubMed Central PMCID: PMC4667719. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Pazhani GP, Bhowmik SK, Ghosh S, Guin S, Dutta S, Rajendran K, et al. Trends in the epidemiology of pandemic and non-pandemic strains of Vibrio parahaemolyticus isolated from diarrheal patients in Kolkata, India. PLoS Negl Trop Dis. 2014;8(5):e2815 doi: 10.1371/journal.pntd.0002815 ; PubMed Central PMCID: PMC4006737. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

All relevant data are within the paper.


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES