Current progress in orchid flowering/flower development research

ABSTRACT

Genetic pathways relevant to flowering of Arabidopsis are under the control of environmental cues such as day length and temperatures, and endogenous signals including phytohormones and developmental aging. However, genes and even regulatory pathways for flowering identified in crops show divergence from those of Arabidopsis and often do not have functional equivalents to Arabidopsis and/or existing species- or genus-specific regulators and show modified or novel pathways.

Orchids are the largest, most highly evolved flowering plants, and form an extremely peculiar group of plants. Here, we briefly summarize the flowering pathways of Arabidopsis, rice and wheat and present them alongside recent discoveries/progress in orchid flowering and flower developmental processes including our transgenic Phalaenopsis orchids for LEAFY overexpression. Potential biotechnological applications in flowering/flower development of orchids with potential target genes are also discussed from an interactional and/or comparative viewpoint.

Importance of floral transition in orchid breeding

Orchids are a valuable floricultural crop and some wild species are under constant threat of extinction due to over-collection for commercial trade.¹ Large and complex polyploid genomes, low transformation efficiency, slow growth and long life cycles mean that it is challenging to overcome the risk of extinction or generate new varieties containing desirable traits with commercial value by either traditional breeding or genetic engineering techniques.^2,3 For example, it takes more than 2 y for popular orchid cultivars with high commercial value (e.g., Phalaenopsis orchids) to switch from the vegetative to the reproductive phase.^3,4

The structure of orchid flowers has unique diversification among flowering plants. Moreover, most orchids have defined favorable seasons for floral induction as well as inflorescence and flower development. Although several genes affecting flower development have been identified in orchids, the function of the genes during orchid floral transition still remains to be studied through the establishment of reliable protocols to induce alterations in flowering time of orchids.^5,6,7 Molecular and genetic studies of orchid flowering are invaluable not only for understanding the molecular mechanisms of flower development including evolutionary trends but also for assisting molecular breeding to produce orchids with desirable traits.

Floral transition in a long-day model plant, Arabidopsis

In Arabidopsis, photoperiodic information for floral transition is specified through the interaction of the circadian clock and light. Both of these factors converge to regulate the expression and the activity of the CONSTANS (CO) transcription factor.⁸ CO activates SUPPRESSOR OF CONSTANS OVEREXPRESSION1 (SOC1) and APETALA1 (AP1) through FLOWERING LOCUS T (FT) to promote flowering. FT encoding a small protein that belongs to the phosphatidyl-ethanolamine binding protein (PEBP) family is expressed in the leaves and the polypeptide moves to the shoot apical meristem and forms a complex with a bZIP transcription factor, FD.^9,10 Subsequently, the floral meristem identity genes such as AP1, LEAFY (LFY), FRUITFULL (FUL) and CAULIFLOWER (CAL) are induced in the floral meristems emerging on the flanks of the shoot apex.^10,11

A MADS-domain protein, FLOWERING LOCUS C (FLC) represses flowering by preventing the transcription of FT in leaves and SOC1 and FD in the shoot apex. FRIGIDA (FRI) is a positive regulator of FLC. However, the mechanisms of cold-mediated repression including epigenetic modifications and antisense transcriptions of FLC are not yet fully understood.^12,13 Other MADS proteins, AGAMOUS-like19 (AGL19) and AGL24, closely related to SOC1 and SHORT VEGETATIVE PHASE (SVP), respectively, have positive effects on flowering. Of note, their transcripts are accumulated during vernalization and this process is likely to be FLC-independent.^14,15 Summer annual Arabidopsis can flower without vernalization but an active repression of flowering takes place at lower ambient temperatures. FLOWERING LOCUS M (FLM) and SVP are central to repression of flowering under the low ambient temperature. In particular, FLM-β, an alternatively spliced form of the flowering repressor FLM, interacts with SVP to respond to ambient temperature changes and SVP delays flowering by repressing FT and SOC1 transcription.¹⁶ Therefore, the decrease of SVP-FLM-β repressor complexes at higher temperatures leads to flowering.¹⁷ The distribution of flowering time genes in Arabidopsis is shown in Fig. 1A.

Figure 1.

Major flowering genes in the photoperiodic and temperature network in Arabidopsis, rice, wheat and orchids. (A) Flowering of Arabidopsis is promoted by long days (LDs). The photoperiod signaling cascade involves GI and CO with modulation by EARLY FLOWERING4 (ELF4). ELF4 negatively regulates CO expression by sequestering GI from the CO promoter. CO positively regulates expression of floral integrator FT that mediates SOC1activation. The vernalization response in Arabidopsis through VERNALIZATION INSENSITIVE3 (VIN3) family proteins represses FLC gene family members, which represses FT and SOC1. In addition, AGL24 participates in the FLC–independent vernalization response to regulate LFY expression. The ambient temperature affects flowering time in Arabidopsis through SVP-FLM-β repressor complexes that delay flowering by repressing FT and SOC1 transcription at low ambient temperature. (B) In rice, a short day plant, the OsGI -Hd1 (CO in Arabidopsis)-Hd3a (FT in Arabidopsis) cascade is well conserved. Hd1 and Ehd1 positively regulate Hd3a and promote flowering under inductive short days (SDs). However, under LDs, Ghd7 is a major flowering suppressor that represses Ehd1 and Hd1 also represses Hd3a expression. Instead, RFT1 is activated through OsMADS50 and Ehd1 for eventual flowering under LDs. OsMADS50 and OsMADS56 function antagonistically to affect flowering under LDs by controlling expression of Ehd1. Rice AP1 homologs such as OsMADS14 and OsMADS15 are activated by florigens (e.g., Hd3a and RFT1) in the SAM. (C) In wheat, the TaFT1/VRN3 gene integrates photoperiod (via PPD1–WCO) and vernalization (via VRN1–VRN2). The photoperiodic signals involving PPD1 are transmitted to negative regulator WCO1 and positive regulator TaHd1 to control TaFT1/VRN3 expression under SD. VRN2 prevents flowering before vernalization but later, vernalization induces VRN1, which is followed by the downregulation of VRN2, thereby releasing TaFT1/VRN3 which leads to flowering. ODDSOC2 (TmOS2/TaAGL33) functions as a vernalization-regulated flowering repressor. It is downregulated by cold independently of VRN1. (D) In orchids, Phalaenopsis PhalCOL and PaFT1 were regulated by photoperiod and low ambient temperature, respectively. Doritaenopsis DhEFL2, 3 and 4, as floral repressors, coordinate floral transition in the photoperiodic flowering pathway. DnVRN1 and DnFT from Dendrobium nobile are linked to low temperature (10°C)-induced floral transition. Dendrobium Chao Praya Smile DOSOC1 is expressed specifically in floral meristemsduring the transition from the vegetative to the reproductive phase and coupled with the upregulation of its LFY. DnAGL19 expression of D. nobile repressed by polycomb-group complexes is activated after vernalization reminiscent of Arabidopsis AGL19 pathway to activate LFY and AP1 for flowering. Arrows and T-shaped bars are regulatory links for the promotion and repression of gene transcription, respectively. The numbers next to the arrows and T-shaped bars are references to related studies and the dashed lines indicate predictions of the flowering regulation networks. Prediction of orchids flowering networks should be confirmed by more extensive studies.

Floral transition in a short-day model plant, rice

As shown in Fig. 1B, in rice, Heading date 3a (Hd3a) and RICE FLOWERING LOCUS T1 (RFT1) are responsible for floral induction under short-day (SD) and long-day (LD) conditions, respectively.¹⁸ The basic leucine-zipper (bZIP) domain transcription factor, OsFD1 interacts with Hd3a through 14–3–3 proteins to form a florigen activation complex (FAC) acting on the induction of OsMADS15, a rice AP1 ortholog in the shoot apex during floral induction.^19,20 Early heading date 1 (Ehd1) acts as a flowering activator by upregulating Hd3a and RFT1 and also controls the inflorescence architecture irrespective of photoperiod.²¹ Interestingly, Heading date 1 (Hd1), a rice ortholog of Arabidopsis CO has a dual function: it acts as floral activator by activating Hd3a under inductive SD conditions but is converted to a repressor of Hd3a under long days (LDs).^18,22 Grain number, Plant height and Heading date 7 (Ghd7) and Oryza sativa CONSTANS-LIKE4 (OsCOL4) are upstream suppressors of Ehd1 whereas Oryza sativa INDETERMINATE1 (OsID1)/Ehd2/Rice INDETERMINATE1 (RID1) and OsMADS50, a homolog of Arabidopsis SOC1 are activators of Ehd1 (Fig. 1B).²³ Another MADS-box gene, OsMADS51 functioning downstream of Oryza sativa GIGANTEA (OsGI) under short days (SDs) promotes flowering by inducing Ehd1 expression. Moreover, Hd16/EARLY FLOWERING1 (EL1) acts as a flowering repressor by phosphorylating Ghd7 resulting in the reduction of Ehd1 expression. Rice Ehd3 and Early flowering3 (ELF3) were also identified as repressors of Ghd7.²²

Floral transition in a seasonal flowering plant, wheat

In wheat, MADS-domain transcription factor VERNALIZATION1 (VRN1), a wheat ortholog of Arabidopsis AP1, is a central regulator of vernalization-induced flowering.²⁴ The grass-specific MADS-box gene ODDSOC2 (TmOS2/TaAGL33) and its splice variant TaAGL22, the FLC orthologs, are downregulated by cold independently of VRN1, but VRN1represses ODDSOC2 during the developmental stage under LDs and normal temperature.^25,26 The VRN2 containing a zinc-finger motif and a CCT (CONSTANS, CO-like, TOC1) - domain is a flowering repressor downregulated by both vernalization and SDs.²⁷ Cold signals coordinately activate VRN1 and repress VRN2 expression during vernalization. Also, VRN1 down-regulates VRN2 to control the activity of the photoperiodic flowering pathway (Fig. 1C). VRN2 represses flowering under SDs, and confers the downregulation of VRN2 and the upregulation of VRN1 and VRN3 after the LDs of spring. VRN3, an ortholog of Arabidopsis FT, is a flowering activator and also encodes a mobile protein that is transported from the leaves to the shoot apical meristem (SAM).²⁸ Pseudo-response regulator (PRR) family PHOTOPERIOD1 (PPD1) encodes a CCT-domain protein domain that influences day length sensitivity by altering expression of CO-like genes: Wheat CO (WCO1) negatively regulates and Triticum aestivum HEADING DATE 1 (TaHd1) positively regulates VRN3 expression associated with late flowering under SD conditions.²⁹

Genes that control flowering in orchids

Not so many functional studies of orchid flowering/flower developmental genes have been reported. Recently, it was reported that expression of Doritaenopsis hybrid EARLY FLOWERING4-like4 (DhEFL4) is regulated by photoperiod and overexpression in Arabidopsis delays flowering.³⁰ Ectopic expression of Phalaenopsis CO-like (PhalCOL) encoding a protein with 2 B-box zinc finger motifs and a CCT domain in Phalaenopsis hybrida (cv. Wedding Promenade) caused an early-flowering phenotype in tobacco³¹ and Phalaenopsis aphrodite FLOWERING LOCUS T1 (PaFT1) that is upregulated under inductive low ambient temperature but is not subject to photoperiodic control showed precocious flowering in Arabidopsis and rice when it was ectopically expressed.³² Moreover, phloem-specific expression of PaFT1 in Arabidopsis suppresses the late flowering effect by an active FRI allele and SVP overexpression. SVP forms a complex with FLM, a floral repressor of FT, by ambient temperature in Arabidopsis.¹⁷ A bZIP domain transcription factor PaFD has been isolated as a PaFT1-interacting protein and was able to partially complement the late flowering phenotype of Arabidopsis fd-3.³² Oncidium Gower Ramsey FLOWERING LOCUS T (OnFT) and TERMINAL FLOWER 1 (OnTFL1) encoding floral activator FT and repressor TERMINAL FLOWER1 (TFL1) homologs, respectively were shown to play opposite roles in Arabidopsis flowering.³³ Recently, Dendrobium nobile FLOWERING LOCUS T (DnFT) and MOTHER OF FT (DnMFT) expressed preferentially in the auxiliary buds and leaves have been reported. Of note, the expression of the 2 genes in the leaves responded to temperature in an opposite manner. The low temperature (10°C) required for flowering of D. nobile Lindl: increased DnFT expression but decreased DnMFT expression.³⁴

The transcript of floral meristem identity gene Phalaenopsis aphrodite LEAFY (PhapLFY) is accumulated in the floral meristem primordia to stimulate flower initiation. It is also believed that PhapLFY acts in the early stages of floral organ development.³⁵ Expression of DENDROBIUM ORCHID HOMEOBOX1 (DOH1) from D. Madame Thong-In is detected in leaf primordia and downregulated in the shoot apex during floral transition as a possible upstream regulator of DOMADS1 expressed in the transitional shoot apical meristem, advancing the floral transition and flower development (Fig. 1D).³⁶ No homologs of FLC have been reported but homologs of Arabidopsis AGL19 were identified in D. nobile. In addition, expression of OncidiumMADS1 (OMADS1) belonging to the AP1/AGL9 group of MADS-box genes is detected in the apical meristem and in the lip and carpel of flowers and OMADS1 also interacts with OMADS3 associated with floral initiation of Oncidium Gower Ramsey.³⁷ Table 1 provides a summary of the current understanding of orchid flowering genes which are either functional orthologs /homologs of Arabidopsis, rice and wheat genes.

Table 1.

Key flowering genes in orchids.

Orchids	Gene Name	Accession No.	Homologa	Refsb
Phalaenopsis	PaFT1	KJ609179	The PaFT1 protein showed 70%, 76% and 89% identity to Arabidopsis FT (BAA77838), rice Hd3a (BAB61030), and Oncidium orchid OnFT (ACC59806), respectively.	32
Oncidium	OnFT	KJ909968	OnFT cDNA encodes a 176 amino acid protein that shows 70% and 79% identity to Arabidopsis FT (AT1G65480) and rice Hd3a (Os06g0157700), respectively.	33
Cymbidium	CgFT	HM120863	The CgFT protein was 94% with OnFT (EU583502) from Oncidium Gower Ramsey, 79% with Hd3a (BAB61028.1) from Oryza sativa, and 74% with FT (BAA77838.1) from Arabidopsis thaliana.	42
Cypripedium	CfFT	CFTC014733	The partial CfFT align 155 amino acids and showed 82.58% identity to wheat TaFT (ABK32205).	Orch
Phalaenopsis	PaFD	KJ609180	PaFD protein shows 34.7% identity to Arabidopsis FD (AT4G35900).	32
Dendrobium	DnFD	DNTC011756	The partial DnFD align 169 amino acids and showed 65.1% and 32.2% identity to Phalaenopsis FD (KJ609180) and Arabidopsis FD (AT4G35900), respectively.	Vect
Phalaenopsis	PhalCOL	FJ469986	The PhalCOL protein showed 46% and 45% identity to Arabidopsis COL4 (Q940T9.2) and rice Hd1 (ABB17664), respectively.	31
Cymbidium	CeCOL	CETC010739	The CeCOL protein showed 84.5%, 34.9%, and 36.3% identity to Phalaenopsis COL (FJ469986), Arabidopsis CO (AT5G15840) and rice Hd1 (Os06g0275000), respectively.	Vect
Cypripedium	CfFLC	CFTC002458	The partial CfFLC align 145 amino acids and showed 45.5% identity to Arabidopsis FLC (AT5G10140) and 41.2% with wheat TaAGL33 (ABF57950).	Orch Vect
Oncidium	OgFLC	OGTC046040	The partial OgFLC align 145 amino acids and showed 44.8% identity to Arabidopsis FLC (AT5G10140) and 38.6% with wheat TaAGL33 (ABF57950)..	Orch Vect
Cypripedium	CfVRN2	CFTC009002	The partial CfVRN2 align 106 amino acids and showed 50% identity to wheat VRN2 (AAS58481).	Orch
Phalaenopsis	PmVRN2	PMTC002168	The partial PmVRN2 align 142 amino acids and showed 41.55% identity to wheat VRN2 (AAS58481).	Orch
Dendrobium	DOSOC1	KC121576	DOSOC1 shared 52% sequence identity with Arabidopsis SOC1 (AT2G45660), and 57% identity to Oryza sativa OsSOC1 (Os03g0122600).	39
Phalaenopsis	PlSOC1	PLTC039163	PlSOC1 shared 87.9%, 48.4%, and 54.3% identity to Dendrobium (KC121576), Arabidopsis (AT2G45660) and rice (Os03g0122600), respectively.	Vect
Dendrobium	DnAGL19	KU373056	DnAGL19 protein shows 48% identity to Arabidopsis AGL19 (AT4G22950).	4
Oncidium	OnTFL1	KM233713	OnTFL1 encodes a 173 amino acid protein that shows 71% and 79% identity to Arabidopsis TFL1 (AT5G03840) and rice OsFDR1 (AF159883), respectively.	33
Vanilloideae	VpTFL1	VPTC023176	The partial VpTFL1 align 160 amino acids and showed 81.8%, 69.9%, and 83.6% identity to Oncidium TFL1 (KM233713), Arabidopsis TFL1 (AT5G03840) and rice FDR1 (AF159883), respectively.	Vect
Cymbidium	CfAPl1	JQ031272.1	CfAPl1 shared 45% sequence identity with Arabidopsis AP1 (AT1G69120), and 52% identity to Oryza sativa OsMADS14 (Os03g0752800).	43
Phalaenopsis	PsAP1	PSTC034274	The PsAP1 protein showed 55.8%, 47.6% and 58.3% identity to Cymbidium AP11 (JQ031272.1), Arabidopsis AP1 (AT1G69120) and rice MADS14 (Os03g0752800), respectively.	Vect
Doritaenopsis	DnVRN1	DNTC013820	The partial DnVRN1 align 251 amino acids and showed 61.75% identity to wheat VRN1 (AAZ76881).	Orch
Phalaenopsis	PaVRN1	PATC201550	The partial PaVRN1 align 250 amino acids and showed 60.4% identity to wheat VRN1 (AAZ76881).	Orch
Cymbidium	ChLFY	AGE45851	The ChLFY protein showed 51% and 48% identity to Arabidopsis LFY (AT5G61850) and rice RFL (Os04g0598300), respectively.	Vect
Phalaenopsis	PhalLFY	FJ469985	PhalLFY protein has 60% identity to rice RFL (BAA21547), 54% identity to Arabidopsis LFY (NP_200993), and a high identity with LFY (68% and 67%) from Anacamptis (BAC55081) and Orchis (BAC54955), respectively.	44
Phalaenopsis	PhapLFY	KP893636	PhapLFY protein has 78.5% identity to ChLFY (AGE45851), a Cymbidium orchid LFY homolog, 53.2% identity to RFL (BAA21547), a rice LFY homolog, and 47.0% identity to Arabidopsis LFY (AAM27941).	35
Doritaenopsis	DhEFL2	KP728997	DhEFL homologs showed that DhEFL4 (KP010003) and DhEFL2 (KP728997) are similar with 72% identical amino acids, whereas DhEFL3 (KP728998) is divergent with 72% similarity with DhEFL2 and 68% similarity with DhEFL4.	45
Doritaenopsis	DhEFL3	KP728998	The DhEFL3 protein showed 31.4% identity to Arabidopsis ELF4 (AT2G40080).	Vect
Doritaenopsis	DhEFL4	KP010003	The DhEFL4 protein showed 37% identity to Arabidopsis ELF4(AT2G40080).	Vect
Phalaenopsis	PsEhd1	PSTC018079	The partial PsEhd1 align 266 amino acids and showed 40% identity to rice Ehd1 (Os10g0463400).	Orch
Cymbidium	CsEhd1	CSTC008880	The partial CsEhd1 align 263 amino acids and showed 49.5% identity to rice Ehd1 (Os10g0463400).	Orch

^aThe homology is based on each reference and Orchidstra 2.0, a transcriptome database of orchid species (http://orchidstra2.abrc.sinica.edu.tw/orchidstra2/orchid_blast.php). Amino acid sequences of flowering in Arabidopsis, rice and wheat were obtained from GenBank (http://www.ncbi.nlm.nih.gov/) and Orchidstra 2.0.

^bOrch, homology gained through Orchidstra 2.0; Vect, homology gained by analysis using Vector NTI program.

Orchid breeding strategies

Generally, orchids grow slowly and have long life cycles. Consequently, it requires a long period of time to generate new cultivars using the traditional breeding process. Transformation technology has been developed for orchids and recently, a few successful methods^38,39 that use virus-induced gene-silencing (VIGS) approaches have been demonstrated as efficient strategies for functional studies of genes in orchids.⁴⁰ Thus, we may now speed up the orchid breeding process by suppressing the expression of floral repressors resulting in early flowering. Also, virus-induced flowering (VIF) approaches to accelerate the transition to reproductive growth may facilitate research and/or breeding in orchids.⁴¹ For example, either gain of function of FT or loss of function of TFL1 using transient methods such as VIGS/VIF may contribute to a faster orchid breeding process. Using inducible gene expression systems, we may expect to control flowering of orchids with transgenic lines regardless of the ambient environment.³² Specific alleles can be selected for breeding and/or modified by induced mutation (genome editing) to acquire orchid cultivars containing desirable traits when current transformation procedures are stabilized.¹¹ In our recent reports, we have shown that the VIGS of PaFT1 exhibits delayed spiking of P. aphrodite subsp. formosana and the VIGS-PhapLFY flowers displayed increased chlorophyll content with the aberrant epidermal cell shape.^32,35 Furthermore, we successfully produced transgenic Phalaenopsis for PhapLFY overexpression (Fig. 2).

Figure 2.

Overexpression of PhapLFY in Phalaenopsis. (A) Plasmid construction for PhapLFY overexpression in Phalaenopsis orchids. pUbiq means maize ubiquitin promoter and T indicates nos terminator. RB and LB indicate right and left T-DNA borders. The hygromycin phosphotransferase II (hptII) expressing cassette was used for hygromycin resistance in selection of transgenic orchids. (B) Transgenic Phalaenopsis orchids overexpressing PhapLFY gene. Each transgenic orchid seedling used for analyses in C (left) and young orchid plantlets. Bar = 2cm. (C) Verification of transgenic Phalaenopsis orchids by genomic PCR and RT-PCR. Expression of PhapLFY and hygromycin resistance gene (hptII) was examined by RT-PCR together with 18s rRNA in leaves of each plant. The location of primers used for genomic PCR is parked in (A). P indicates plasmid DNA used for transformation as a positive control for PCR and WT indicates a non-transgenic Phalaenopsis orchid in the same developmental stage with transgenic orchids. JIT6: 5′TTGTCGATGCTCACCCTG3′, JIT841: 5′CTAGCCGCTCCTCTCTGTCTCCGAC3′, PhapLFY-F: 5′GAGGAGGAGGTGGACGATATGATG3′, PhapLFY-R: 5′GCTTGTTTATGTAGCTTGCTCCTAC3′, hptII-F: 5′GATTCCGGAAGTGCTTGACATTG3′, hptII-R: 5′GCATCAGCTCATCGAGAGCCTG3′, 18S rRNA-F: 5′TTAGGCCACGGAAGTTTGAGG3′, 18S rRNA-R: 5′ACACTTCACCGGACCATTCAA3′.

Conclusion and future directions

The Orchidaceae is the largest and the most diverse family of flowering plants and most orchids have their own flowering seasons: D. nobile requires vernalization for flowering whereas D. phalaenopsis flowers at high temperatures. Spiking of P. aphrodite subsp formosana is significantly inhibited under warm conditions while the natural flowering period of P. sanderiana is through the summer in the Philippines. The molecular mechanisms underlying flowering among various orchid species largely remain elusive. Research on flowering to induce early flowering in orchids has been aimed not only at a better understanding molecular and genetic mechanisms of orchid flowering but also at assisting orchid breeding programs.¹ In vitro flowering or floral transition in orchids is affected by various plant growth regulators (PGRs) although the molecular working mechanisms of those PGRs underlying orchid floral induction are unclear. Molecular genetic approaches are required to shed some light on the roles of putative key flowering genes of orchids and will also provide a platform for application of genetic resources to the orchid industry.

Disclosure of potential conflicts of interest

No potential conflicts of interest were disclosed.

Acknowledgment

We thank Ms. Miranda Loney for help with English editing.

Funding

This work was supported in part by a core grant from BCST of ABRC, Academia Sinica, Taiwan.