Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2018 May 1.
Published in final edited form as: Placenta. 2017 Mar 16;53:23–29. doi: 10.1016/j.placenta.2017.03.011

The expression level of C19MC miRNAs in early pregnancy and in response to viral infection

Tina MF Dumont 1,2, Jean-Francois Mouillet 1,2, Avaraham Bayer 1,2, Christina L Gardner 3,4, William B Klimstra 3,4, Dana G Wolf 5, Simcha Yagel 6, Fabiola Balmir 2, Anna Binstock 2, Joseph S Sanfilippo 1,2, Carolyn B Coyne 1,4, Jacob C Larkin 1,2, Yoel Sadovsky 1,2,4
PMCID: PMC5506831  NIHMSID: NIHMS863472  PMID: 28487016

Abstract

Introduction

We have previously shown that miRNAs produced from the Chromosome 19 MiRNA Cluster (C19MC), which are expressed almost exclusively in primate trophoblasts and are released into the maternal circulation, reduce viral replication in non-placental cells and can modulate migratory behavior of extravillous trophoblast. We sought to define the expression pattern of C19MC miRNA in early pregnancy and in response to viral infection in vitro and in vivo.

Methods

We prospectively followed women undergoing in vitro fertilization (IVF) and determined their blood level of C19MC miRNA using RT-qPCR. To examine the effect of viral exposure on C19MC miRNAs expression, we used three systems: (1) a transgenic mouse overexpressing the C19MC cluster and exposed to Togaviridae during pregnancy, (2) cultured primary human trophoblasts exposed to Vesicular Stomatitis Virus in vitro, and (3) amniotic fluid from women exposed to cytomegalovirus during pregnancy.

Results

In 27 IVF pregnancies, C19MC miRNAs were detected as early as 2 weeks after implantation, and their levels increased thereafter. There was no change in C19MC miRNA expression levels in the mouse placenta in response to viral exposure. Similarly, Vesicular Stomatitis Virus infection of primary human trophoblast did not selectively increase C19MC miRNA expression. C19MC miRNA expression in the amniotic fluid was not affected by vertical transmission of cytomegalovirus.

Discussion

The expression of C19MC miRNAs in maternal circulation very early in pregnancy suggests a role in the establishment of the maternal-fetal interface. The levels of C19MC miRNA are not influenced by diverse types of viral infection.

Keywords: Pregnancy, placenta, miRNA, Chromosome 19 miRNA cluster, virus

INTRODUCTION

The placenta plays a vital role in early development of all eutherian mammals. In humans, implantation occurs at approximately day 20 to 24 after the start of the last menstrual period with most on day 23–24, which also holds for pregnancies conceived by assisted reproductive technologies [1–3]. While the embryo has access to maternal blood at implantation, arterial blood supply is not fully established until the end of the first trimester. Furthermore, extravillous trophoblast remodeling of the maternal spiral arteries is thought to continue through early second trimester. Abnormalities in trophoblast invasion and spiral artery remodeling have been associated with pregnancy complications such as preeclampsia, fetal growth restriction, and placenta accreta [4].

Viral infections can also have devastating consequences during pregnancy through direct effects on fetal development or severe maternal morbidity. Cytomegalovirus (CMV) and Zika are current examples of blood borne viruses that can evade the placental barrier and affect fetal neurological development [5,6]. Influenza is not known to have direct fetal effects, and pregnant women account for a disproportionate degree of the severe morbidity and mortality [7]. Understanding the molecular mechanisms that protect a pregnant woman and her developing fetus against viral pathogens is an important goal that may have direct clinical implications.

MicroRNAs (miRNAs) are a class of nucleic acids that modulate gene expression across a wide spectrum of organisms and physiologic processes. These 19–24 nucleotide molecules target messenger RNA (mRNA) for degradation or inhibit their translation into protein, initiating a cascade of downstream effects that influence products from multiple mRNAs [8,9]. The human placenta has both an increased average miRNA copy number compared to other tissues as well as a unique signature of miRNA expression [10] suggesting an important role for this class of molecules in placental function. A group of miRNAs encoded by the human chromosome 19, termed the Chromosome 19 miRNA Cluster (C19MC), is found only in primates and is expressed almost exclusively in the placenta. Among all human placental miRNAs, the expression level is highest for members of this cluster [11]. The trophoblast layer also releases C19MC miRNAs into maternal circulation [12–15] partly within exosomes, [11,16] making them available to affect maternal physiology through regulation of gene expression in maternal tissues [17]. C19MC miRNAs have also been detected in the amniotic fluid and the fetal circulation [17,18].

Recent investigations began to uncover the function of trophoblastic C19MC miRNAs. Members of this cluster are expressed at a very low level in extravillous trophoblast relative to non-invasive villous trophoblast, and over-expression of C19MC miRNA attenuates migration of extravillous trophoblasts [19]. Furthermore, we found that primary human villous trophoblasts are resistant to infection by diverse DNA and RNA viruses, and this effect could be conferred to other, non-placental cell types by transfecting them with C19MC miRNA, or exposing them to exosomes that contained C19MC miRNA [20,21]. This effect is specific to viruses, as C19MC miRNAs have no effect on infection by intracellular bacteria or protozoa [22]. C19MC miRNAs could, therefore, contribute to the protection of maternal and fetal tissues from viral infection. Interestingly, CMV is one exception in that trophoblasts are resistant, but C19MC miRNA enhances CMV infection of non-placental cells [20].

The level of C19MC miRNAs in maternal blood increases from the second half of the first trimester of pregnancy to term, and then rapidly declines following delivery [13,15,23]. Because of their putative in vivo role in implantation and antiviral effect during the critical period of early embryonic development, we sought to more precisely define the pattern of C19MC expression in the maternal blood in well-dated in vitro fertilization (IVF) pregnancies with a focus on early pregnancy. As trophoblasts are relatively resistant to viruses and C19MC miRNAs inhibit viral infection, we hypothesized that exposure to viruses impacts C19MC miRNA expression levels.

MATERIALS AND METHODS

Longitudinal pregnancy cohort

Women undergoing IVF were recruited from the Reproductive Endocrinology and Infertility clinic at Magee-Womens Hospital of the University of Pittsburgh Medical Center, from May 2015 through February 2016. The Institutional Review Board of the University of Pittsburgh approved the protocol, and all subjects provided a written consent for participation. Maternal blood samples were taken at the time of egg retrieval and any subsequent clinically indicated blood draws through May 2016 or delivery (2–9 samples per patient). Maternal plasma samples were collected into an EDTA-containing tube; serum samples were drawn into serum separator tubes and allowed to clot. Samples were then centrifuged at 1500 g for 10 min within 30 min of collection, and a second time at 1500 g for 10 min to remove all cells, then stored at −80°C until miRNA analysis. Pregnancy outcome data were obtained from the medical records.

Isolation of exosomes from maternal blood

Exosomes were isolated from maternal blood samples through a series of filtration, centrifugation, and density gradient ultracentrifugation as described by Ouyang et al [24].

Generation of C19MC transgenic mouse and viral infection

All mouse experiments were approved by the Institutional Animal Care and Use Committee of Magee-Womens Research Institute and the University of Pittsburgh. To develop a hemizygous transgenic (Tg) mouse line expressing the C19MC cluster, a Bacterial Artificial Chromosome (BAC) containing the entire C19MC locus was introduced into a C57Bl/6 background [17]. For timed breeding, wild type (WT) females were housed with Tg males overnight and separated the next day, considered day 0.5 of pregnancy (E0.5). Pregnancy was confirmed by a 10% weight gain by E11.5. On E12.5, pregnant dams were given a subcutaneous injection of one of three togavirus preparations: Venezuelan equine encephalitis virus (VEEV), Sindbis virus (SINV), and chikungunya virus (CHIKV). Dams were sacrificed on E14.5, and placentas were stored at −80°C in TRIzol (Thermo Fisher Scientific, Waltham, MA) until processed. Fetuses were genotyped by PCR using two sets of primer sequences from either end of the BAC transgene as follows: Set 1: F-5′GTGCGGGCCTCTTCGCTATTACGCCAGCTG, R-5′TGCAGGTCGACTCTAGAGGATCCCCGGGTA, Set 2 F-5′AGTGTCACCTAAATAGCTTGGCGTAATCAT, R 5′TGAATTACAACAGTACTGCGATGAGTGGCA.

Exposure of primary human trophoblast (PHT) to Vesicular Stomatitis Virus (VSV)

PHT cells were prepared from healthy singleton term placentas as previously described [25–27]. Cells were cultured in Dulbecco modified Eagle medium (Corning, Manassas, VA) supplemented with 10% fetal bovine serum (Sigma, St Louis, MO) and antibiotics in 6-well plates at 37°C. At 4 and 24 h, the cell medium was changed. At 48 h, the medium was replaced with equivalent medium with or without the addition of VSV at a multiplicity of infectivity (MOI) of 10–20 [20,22]. The cells were incubated for an additional 24 h. At the specified time points, cell media were collected, spun at 2500 g for 20 min to remove debris, and stored at 4°C. The cells were then washed with PBS, exposed to 1 mL TRI Reagent (Molecular Research Center, Cincinnati, OH), and the lysate was stored at −80°C.

PHT cell viability

PHT cells were cultured and infected with VSV as described above, except that cells were plated in duplicate in a 96-well plate at a density of 100,000 cells/well. At 24 h post infection, the CellTiter-Glo Luminescent Cell Viability Assay (Promega, Madison, WI) was used to measure ATP content as an indicator of cell viability according to the manufacturer’s instructions. Luminescence was read via a Gemini EM Spectra Max Fluorescence plate reader utilizing SoftMax Pro data acquisition and analysis software (Molecular Devices, Sunnyvale, CA).

Amniotic fluid (AF) samples from women with primary cytomegalovirus (CMV) infection

AF samples were obtained from 20 women during the clinical evaluation of maternal primary CMV infection at the Hadassah University Hospital in Jerusalem, Israel, between January and August 2015. The Institutional Review Board of Hadassah University Hospital approved the protocol. Primary CMV infection was diagnosed by CMV IgG sero-conversion or a combination of positive CMV IgM and a positive CMV IgG of low avidity. AF samples were obtained during the 22nd week of gestation and at least 7 weeks from the time of maternal CMV infection (if known). Twelve samples that were CMV negative in the fetal compartment served as controls. In the eight CMV-positive samples, CMV titers ranged between 2.7 – 7.7 log DNA copies/mL. DNA was extracted from AF samples using MagnaPure (Roche Life Science, Indianapolis, IN). Viral DNA load (genome copies/ml) was determined by quantitative PCR assay as previously described [28], with the use of primers and probes derived from the CMV glycoprotein B and immediate early genes. The assay demonstrated a linear quantitation over a 6-log range with a sensitivity of 50 copies/mL.

RNA isolation/Reverse transcription - quantitative PCR (RT-qPCR)

For mouse placentas, RNA was extracted utilizing TRI Reagent according to the manufacturer’s instructions. We used 500 ng of total RNA for reverse transcription (RT). PHT lysates were chloroform extracted, then ethanol precipitated before adding to EconoSpin silica spin column (Epoch Life Sciences, Missouri City, TX). The column was washed twice, and the RNA eluted with 30 μL of RNase-free water. We used 100 ng of RNA for RT. A fixed volume of 200 μL maternal plasma/serum, 150 μL PHT culture media or 280 μL amniotic fluid was used for RNA isolation. We used the same protocol as the PHT lysates with the following modifications: A mixture of glycogen, yeast tRNA, and a mimic of the C elegans-specific miRNA, miR-39-3p, were added just prior to the chloroform extraction. EconoSpin micro volume spin columns (Epoch) were used to isolate RNA. After binding, the columns underwent three washes, and RNA was eluted with 15 μL of UltraPure water. A fixed volume of 6 μL of RNA was used for RT. The RNA was either used directly for RT or stored at −80°C.

RT was performed using the miScript II RT Kit (Qiagen, Valencia, CA) utilizing the HiSpec buffer according to the manufacturer’s instructions, and qPCR reactions were performed using the miScript SYBR Green system (Qiagen) on a ViiA 7 Real-Time PCR System (Thermo Fisher). Primer sequences (Qiagen) are listed in Table 1. We chose 3–6 representative miRNAs from the C19MC cluster based on their known high expression in PHT cells [11] and/or ability to protect against viral infection [20]. For the prospective cohort, a pilot experiment identified 3 miRNA species that produced reliable results even at the low expression levels. For comparison, we chose non-C19MC miRNAs found in various locations throughout the genome. Data were analyzed by the ΔΔCt method of Livak and Schmittgen [29]. For tissue or cell lysates, RNU6 was used to normalize expression levels. For culture medium, maternal blood or AF, miRNA expression levels were normalized to the added miR-39-3p mimic. Because miRNA levels in maternal blood very early in pregnancy were at or below the level of detection, we defined an expression threshold of 40 cycles with a characteristic melting curve in duplicate runs.

Table 1.

RT-qPCR miRNA-specific primer sequences

Group Mature miRNA Primer sequence
C19MC hsa-miR-517a-3p 5′ AUCGUGCAUCCCUUUAGAGUGU
hsa-miR-516b-5p 5′ AUCUGGAGGUAAGAAGCACUUU
hsa-miR-525-5p 5′ CUCCAGAGGGAUGCACUUUCU
hsa-miR-512-3p 5′ AAGUGCUGUCAUAGCUGAGGUC
hsa-miR-518b 5′ CAAAGCGCUCCCCUUUAGAGGU
hsa-miR-1323 5′ UCAAAACUGAGGGGCAUUUUCU
Non-C19MC hsa-miR-142-3p 5′ UGUAGUGUUUCCUACUUUAUGGA
hsa-miR-27a-3p 5′ UUCACAGUGGCUAAGUUCCGC
hsa-miR-424-5p 5′ CAGCAGCAAUUCAUGUUUUGAA
hsa-miR-21-5p 5′ UAGCUUAUCAGACUGAUGUUGA
hsa-miR-29a-3p 5′ UAGCACCAUCUGAAAUCGGUUA
hsa-miR-30b-5p 5′ UGUAAACAUCCUACACUCAGCU
hsa-miR-16-5p 5′ UAGCAGCACGUAAAUAUUGGCG
hsa-miR-141-3p 5′ UAACACUGUCUGGUAAAGAUGG
hsa-miR-205-5p 5′ UCCUUCAUUCCACCGGAGUCUG
hsa-miR-335-5p 5′ UCAAGAGCAAUAACGAAAAAUGU
Reference cel-miR-39-3p 5′ UCACCGGGUGUAAAUCAGCUUG
Open in a new tab

Statistics

Data were analyzed utilizing Student t-test, ANOVA, Wilcoxon Rank Sum test, Kruskal-Wallis test, or Pearson Correlation, as noted in the figure legends. A p-value < 0.05 was considered significant, with Bonferroni correction used for multiple comparisons. Calculations were made using either Stata V.14 (Stata Corporation, College Station, TX) or Microsoft Excel functions (Microsoft Corporation, Redmond, WA).

RESULTS

C19MC miRNAs are detectable in maternal blood two weeks after implantation

To track C19MC miRNA expression in maternal blood during early human pregnancy, we sought women undergoing IVF both for their accessibility in early pregnancy and the certain timing of conception. A flow diagram depicting our recruitment strategy is shown in Figure 1. The demographics on the cohort are presented in Supplemental Table S1. During our longitudinal study, we obtained both plasma and serum samples. We examined the equivalence of these sample types using six matched pairs of plasma and serum samples from blood draws that had detectable levels of C19MC miRNAs. There were no consistent differences in miRNA levels measured in these paired samples (Supplemental Fig. S1).

Fig. 1. A diagram depicting the cohort of women undergoing IVF.

Fig. 1

Open in a new tab

1One woman opted for pregnancy termination. 2Both embryonic demises occurred at 9w3d after an appropriate rise in human chorionic gonadotropin and visualization of a fetal pole with cardiac activity. 3Two women with singleton pregnancies spontaneously conceived between IVF cycles. Their pregnancies were dated by certain menstrual period dates that were consistent with early first trimester ultrasounds. Their pregnancies only contributed data points in the second and third trimesters, and therefore they were included in the cohort.

The levels of the three representative C19MC miRNAs started to differ from the samples of the non-pregnant participants during the fifth week from the last menstrual period (Figure 2A–C, Ai–Ci). The levels rose rapidly in the subsequent week and then remained relatively stable. In contrast, the levels of two representative non-C19MC miRNAs did not significantly change over the course of pregnancy (Figure 2D–E, Di–Ei). The rise in C19MC miRNA levels was also detected in the exosomal fraction of maternal blood samples from early pregnancy (Supplemental Table S2).

Fig. 2. The expression level of C19MC miRNAs in maternal blood in early pregnancy and throughout gestation.

Fig. 2

Open in a new tab

Scatter plot panels depicting the level of representative C19MC and non-C19MC miRNAs. Data are represented as log2 for ease of display, due to the 250- to 4000-fold increase observed. The levels of miRNAs were normalized to the 2-week time point (blood draw during egg retrieval, representing the non-pregnant state) and displayed by gestational age in menstrual weeks. Green, healthy singleton pregnancies (n = 21 women, 77 samples). Blue, healthy dichorionic, diamniotic twin pregnancies (n = 4 women, 14 samples). Red, embryonic demises (n = 2 women, 6 samples). A–E, Across gestation from egg retrieval visit (representing non-pregnant comparison) to full term. Box, area expanded in inset. Ai–Ei, Expanded insets of the initial 7 weeks of gestation. The timing of embryo transfer and estimated timing of implantation [1–3] are indicated. A–C, C19MC miRNAs. D–E, Non-C19MC miRNAs.

Togaviridae infection does not effect placental C19MC miRNA expression in transgenic mice

To determine if viral infection induces expression of C19MC miRNAs in the placenta in vivo, we assessed the effect of viral infection in the mouse dam. Because the C19MC locus is only present in primates, we established a transgenic mouse model using a BAC expressing the C19MC miRNAs with their associated regulatory sequences [17]. In response to acute infection with three different Togaviridae during pregnancy, there were no significant differences in the level of representative C19MC miRNAs in the transgenic placentas (Figure 3), and there was no correlation with placental viral titers (Supplemental Figure S2).

Fig. 3. The effect of Togaviridae infection on miRNA levels in C19MC transgenic mice.

Fig. 3

Open in a new tab

Box plots representing C19MC miRNA levels in transgenic placental tissue, expressed as fold over control. Control n = 29, VEEV n = 8, CHIKV n = 20, SINV n = 17 placentas. p=NS by viral exposure status for each miRNA using Kruskal-Wallis test.

VSV exposure does not alter C19MC miRNA expression in PHT cells in vitro

To assess the effect of viral exposure on the expression of endogenous C19MC miRNA members in cultured PHT cells, we measured C19MC miRNA levels in PHT cell lysates at 4, 8 and 24 h after exposure to VSV. When compared to unexposed, control PHT cells, there was no difference in the expression levels of 6 C19MC miRNA members (Figure 4). Even with higher VSV titer, we found no significant increase in expression of any of the measured miRNAs by 24 h after infection (Supplemental Fig. S3A). Whereas viral exposure increased the release of a few of the C19MC miRNAs into the culture medium 24 h after VSV exposure, this effect was not specific to C19MC miRNA (Supplemental Fig. S3B) and likely attributable to reduced cell viability (Supplemental Fig. S3C).

Fig. 4. The effect of VSV exposure on C19MC miRNA levels in PHT cells.

Fig. 4

Open in a new tab

A time course (4 h, 8 h, 24 h) for the expression levels of C19MC and non-C19MC miRNA in cell lysates, comparing mock-exposed versus VSV-exposed (MOI 10) cells. The mean ±SD at each time point is normalized to the mean of the corresponding mock (control) -infected samples at 4h post infection for each miRNA. Data (n=3 independent experiments) were analyzed by pair-wise comparison of VSV-exposed with analogous mock-exposed samples using Student t-test. P=NS for all comparisons.

C19MC miRNA levels in the amniotic fluid (AF) do not correlate with fetal infection status in women with primary CMV infection

As C19MC miRNAs are released into the fetal compartment [17,18], we tested whether fetal infection alters the levels of C19MC miRNAs in the AF. In AF obtained for fetal CMV testing in pregnant women diagnosed with primary CMV infection, we found that the levels of representative C19MC miRNAs did not change with maternal-fetal vertical transmission of CMV (Figure 5) and did not correlate with AF viral titer (Supplemental Fig. S4).

Fig. 5. The effect of fetal CMV infection status on amniotic fluid C19MC expression levels.

Fig. 5

Open in a new tab

Expression data are displayed as fold change relative to miR-39-3p, and normalized to the mean of the negative samples by CMV PCR result in the amniotic fluid. Box plots depict CMV-negative samples (n = 12) and CMV-positive samples (n = 8). Pair-wise comparisons of negative and positive samples for each miRNA target were made using Wilcoxon Rank Sum test. P=NS for all comparisons.

DISCUSSION

Whereas placental tissue is known to express C19MC by 7 weeks of menstrual age, [30] we detected C19MC miRNAs in the maternal circulation as early as five weeks after the last menstrual period, or approximately two weeks after implantation. In the present work we did not pursue the exact distribution of C19MC miRNA among extracellular vesicles or in a protein-bound form in the plasma, as demonstrated previously [11,21,31,37–39]. Nonetheless, we confirmed the rising levels of C19MC miRNA in exosomes early in pregnancy. These data further our knowledge of the natural history of these RNA molecules during early human pregnancy, and establish that C19MC miRNA expression and release coincide with early first trimester invasion and migration of extravillous trophoblasts into the decidua and maternal spiral arteries. Our data are consistent with our recent findings that C19MC miRNAs modulate the migration of trophoblasts [19]. As several groups have examined miRNA levels with the goal of identifying biomarkers for pregnancy complications [31], our data suggest that accurate pregnancy dating and the timing of C19MC miRNA measurement is critical. Because our expression data reflect maternal systemic levels, we cannot rule out the possibility that C19MC miRNAs are expressed and released locally prior to 5 weeks.

Because C19MC miRNAs attenuate viral infection in non-trophoblastic cells, [20,22,31] we sought to determine if trophoblasts might respond to viral exposure by regulating the expression of C19MC miRNAs, as has been shown in other systems [32–36]. Using three systems, we found no support for this hypothesis. In transgenic mouse and PHT cell culture models, there were no significant time- or dose-dependent effects of different viruses on C19MC miRNA expression. Furthermore, there was no effect of fetal infection status or viral titer on C19MC miRNAs released into the AF in pregnancies complicated by maternal primary CMV infection. Therefore, while our data do not address a possible anti-viral role for C19MC in vivo, viruses or cellular response to viral exposure do not alter C19MC expression. We are currently investigating the up-stream regulatory sequences at the C19MC locus to assess the mechanisms governing C19MC miRNA expression.

Several limitations should be recognized. First, while IVF pregnancies have the advantage of precise dating, these women conceive with hormonal and mechanical manipulations, including ex vivo embryonic culture, which could theoretically affect C19MC miRNA expression. We chose members of the C19MC cluster for their higher expression levels and/or their demonstrated anti-viral activity in prior work [20, 22]; it is possible their expression patterns are not representative of the entire locus. Similarly, we have tested a limited number of viruses, and thus our results should not be extrapolated to all viruses. We acknowledge that the regulation of C19MC miRNA expression in our transgenic mouse may not fully recapitulate their endogenous expression in primates, and that the mouse may not express the molecular targets that are homologous to C19MC miRNA targets in the human. Notably, however, our data using mice was similar to the results we obtained using primary human trophoblasts. Because of ethical considerations, our analysis of the effect of maternal CMV infection did not include a control group of women unexposed to CMV. Finally, because our systems assessed only second or third trimester placental responses, first trimester trophoblast may respond differently to viral infection.

Our data provide new insights into the expression patterns of C19MC miRNAs. The early onset of expression and release into maternal circulation and their effects on trophoblast migration in vitro [19] suggest a possible role in shaping the maternal-fetal interface and/or the changes in maternal physiology required to support the pregnancy. If C19MC miRNAs confer anti-viral activity in vivo, as we have previously shown in vitro, our work suggests that this property is established early and maintained constitutively rather than responsive to viral exposure. Our consistent observation of the lack of effect of viral infection on C19MC expression using diverse and non-overlapping systems suggests that we were unlikely to have missed a significant effect. The cellular and molecular targets for C19MC miRNA within the mother and/or fetus are yet to be determined.

Supplementary Material

1

HIGHLIGHTS.

  1. C19MC miRNAs are detectable in maternal circulation as early as two weeks after implantation.

  2. Viral infections have no effect on the expression level of C19MC miRNA in vivo or in vitro.

  3. C19MC miRNAs are expressed in the amniotic fluid, but are not affected by cytomegalovirus exposure.

Acknowledgments

We would like to thank Meredith Snook, Sunita Katari, and Matrika Johnson (Department of OBGYN and Reproductive Sciences, University of Pittsburgh) for patient recruitment, Elena Sadovsky, Judy Ziegler and Stacy McGonigal (Magee-Womens Research Institute), Nicolas Garcia (University of Pittsburgh) and Orit Kaplan (Hadassah Hebrew University Medical Center) for technical assistance, and Lori Rideout (Magee-Womens Research Institute) for assistance with manuscript preparation. The study was funded by grants from the 25 Club of Magee-Womens Hospital (YS) and NIH grant R01HD075665 (CC and YS).

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  • 1.Nepomnaschy PA, Weinberg CR, Wilcox AJ, et al. Urinary hCG patterns during the week following implantation. Hum Reprod. 2008;23:271–277. doi: 10.1093/humrep/dem397. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Hsu MI, Kolm P, Leete J, et al. Analysis of implantation in assisted reproduction through the use of serial human chorionic gonadotropin measurements. J Assist Reprod Genet. 1998;15:496–503. doi: 10.1023/A:1022534521019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Hsu MI, Barroso G, Mayer J, et al. Is the timing of implantation affected by zona pellucida micromanipulation? J Assist Reprod Genet. 2000;17:34–38. doi: 10.1023/A:1009497929994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Cunningham F, Leveno KJ, Bloom SL, et al. In: Implantation and placental development. Cunningham F, Leveno KJ, Bloom SL, Spong CY, Dashe JS, Hoffman BL, Casey BM, Sheffield JS, editors. McGraw-Hill; New York, NY: 2013. [Google Scholar]
  • 5.Petersen LR, Jamieson DJ, Powers AM, et al. Zika Virus. N Engl J Med. 2016;374:1552–1563. doi: 10.1056/NEJMra1602113. [DOI] [PubMed] [Google Scholar]
  • 6.Bialas KM, Swamy GK, Permar SR. Perinatal cytomegalovirus and varicella zoster virus infections: epidemiology, prevention, and treatment. Clin Perinatol. 2015;42:61–75. viii. doi: 10.1016/j.clp.2014.10.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Beigi RH. Influenza during pregnancy: a cause of serious infection in obstetrics. Clin Obstet Gynecol. 2012;55:914–926. doi: 10.1097/GRF.0b013e31827146bd. [DOI] [PubMed] [Google Scholar]
  • 8.Baek D, Villen J, Shin C, et al. The impact of microRNAs on protein output. Nature. 2008;455:64–71. doi: 10.1038/nature07242. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Selbach M, Schwanhausser B, Thierfelder N, et al. Widespread changes in protein synthesis induced by microRNAs. Nature. 2008;455:58–63. doi: 10.1038/nature07228. [DOI] [PubMed] [Google Scholar]
  • 10.Liang Y, Ridzon D, Wong L, et al. Characterization of microRNA expression profiles in normal human tissues. BMC Genomics. 2007;8:166. doi: 10.1186/1471-2164-8-166. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Donker RB, Mouillet JF, Chu T, et al. The expression profile of C19MC microRNAs in primary human trophoblast cells and exosomes. Mol Hum Reprod. 2012;18:417–424. doi: 10.1093/molehr/gas013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Chim SS, Shing TK, Hung EC, et al. Detection and characterization of placental microRNAs in maternal plasma. Clin Chem. 2008;54:482–490. doi: 10.1373/clinchem.2007.097972. [DOI] [PubMed] [Google Scholar]
  • 13.Gilad S, Meiri E, Yogev Y, et al. Serum microRNAs are promising novel biomarkers. PLoS One. 2008;3:e3148. doi: 10.1371/journal.pone.0003148. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Luo SS, Ishibashi O, Ishikawa G, et al. Human villous trophoblasts express and secrete placenta-specific microRNAs into maternal circulation via exosomes. Biol Reprod. 2009;81:717–729. doi: 10.1095/biolreprod.108.075481. [DOI] [PubMed] [Google Scholar]
  • 15.Miura K, Miura S, Yamasaki K, et al. Identification of pregnancy-associated microRNAs in maternal plasma. Clin Chem. 2010;56:1767–1771. doi: 10.1373/clinchem.2010.147660. [DOI] [PubMed] [Google Scholar]
  • 16.Mouillet JF, Ouyang Y, Bayer A, et al. The role of trophoblastic microRNAs in placental viral infection. Int J Dev Biol. 2014;58:281–289. doi: 10.1387/ijdb.130349ys. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Chang G, Mouillet JF, Mishima T, et al. The expression and trafficking of placental microRNAs at the feto-maternal interface. FASEB J. 2017 doi: 10.1096/fj.201601146R. in press. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Weber JA, Baxter DH, Zhang S, et al. The microRNA spectrum in 12 body fluids. Clin Chem. 2010;56:1733–1741. doi: 10.1373/clinchem.2010.147405. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Xie L, Mouillet JF, Chu T, et al. C19MC microRNAs regulate the migration of human trophoblasts. Endocrinology. 2014;155:4975–4985. doi: 10.1210/en.2014-1501. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Delorme-Axford E, Donker RB, Mouillet JF, et al. Human placental trophoblasts confer viral resistance to recipient cells. Proc Natl Acad Sci USA. 2013;110:12048–12053. doi: 10.1073/pnas.1304718110. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Sadovsky Y, Mouillet JF, Ouyang Y, et al. The Function of TrophomiRs and Other MicroRNAs in the Human Placenta. Cold Spring Harb Perspect Med. 2015;5:a023036. doi: 10.1101/cshperspect.a023036. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Bayer A, Delorme-Axford E, Sleigher C, et al. Human trophoblasts confer resistance to viruses implicated in perinatal infection. Am J Obstet Gynecol. 2015;212:71 e71–78. doi: 10.1016/j.ajog.2014.07.060. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Hromadnikova I, Kotlabova K, Doucha J, et al. Absolute and relative quantification of placenta-specific micrornas in maternal circulation with placental insufficiency-related complications. J Mol Diagn. 2012;14:160–167. doi: 10.1016/j.jmoldx.2011.11.003. [DOI] [PubMed] [Google Scholar]
  • 24.Ouyang Y, Bayer A, Chu T, et al. Isolation of human trophoblastic extracellular vesicles and characterization of their cargo and antiviral activity. Placenta. 2016;47:86–95. doi: 10.1016/j.placenta.2016.09.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Kliman HJ, Nestler JE, Sermasi E, et al. Purification, characterization, and in vitro differentiation of cytotrophoblasts from human term placentae. Endocrinology. 1986;118:1567–1582. doi: 10.1210/endo-118-4-1567. [DOI] [PubMed] [Google Scholar]
  • 26.Nelson DM, Johnson RD, Smith SD, et al. Hypoxia limits differentiation and up-regulates expression and activity of prostaglandin H synthase 2 in cultured trophoblast from term human placenta. Am J Obstet Gynecol. 1999;180:896–902. doi: 10.1016/s0002-9378(99)70661-7. [DOI] [PubMed] [Google Scholar]
  • 27.Chen B, Nelson DM, Sadovsky Y. N-myc down-regulated gene 1 modulates the response of term human trophoblasts to hypoxic injury. J Biol Chem. 2006;281:2764–2772. doi: 10.1074/jbc.M507330200. [DOI] [PubMed] [Google Scholar]
  • 28.Boeckh M, Huang M, Ferrenberg J, et al. Optimization of quantitative detection of cytomegalovirus DNA in plasma by real-time PCR. J Clin Microbiol. 2004;42:1142–1148. doi: 10.1128/JCM.42.3.1142-1148.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  • 30.Zhang R, Wang YQ, Su B. Molecular evolution of a primate-specific microRNA family. Mol Biol Evol. 2008;25:1493–1502. doi: 10.1093/molbev/msn094. [DOI] [PubMed] [Google Scholar]
  • 31.Mouillet JF, Ouyang Y, Coyne CB, et al. MicroRNAs in placental health and disease. Am J Obstet Gynecol. 2015;213:S163–172. doi: 10.1016/j.ajog.2015.05.057. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Jiang X, Kanda T, Wu S, et al. Regulation of microRNA by hepatitis B virus infection and their possible association with control of innate immunity. World J Gastroenterol. 2014;20:7197–7206. doi: 10.3748/wjg.v20.i23.7197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Selvamani SP, Mishra R, Singh SK. Chikungunya virus exploits miR-146a to regulate NF-kappaB pathway in human synovial fibroblasts. PLoS One. 2014;9:e103624. doi: 10.1371/journal.pone.0103624. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Singaravelu R, Russell RS, Tyrrell DL, et al. Hepatitis C virus and microRNAs: miRed in a host of possibilities. Curr Opin Virol. 2014;7:1–10. doi: 10.1016/j.coviro.2014.03.004. [DOI] [PubMed] [Google Scholar]
  • 35.Chiantore MV, Mangino G, Iuliano M, et al. Human papillomavirus E6 and E7 oncoproteins affect the expression of cancer-related microRNAs: additional evidence in HPV-induced tumorigenesis. J Cancer Res Clin Oncol. 2016 doi: 10.1007/s00432-016-2189-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Sharma N, Kumawat KL, Rastogi M, et al. Japanese Encephalitis Virus exploits the microRNA-432 to regulate the expression of Suppressor of Cytokine Signaling (SOCS) 5. Sci Rep. 2016;6:27685. doi: 10.1038/srep27685. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Iljas JD, Guanzon D, Elfeky O, et al. Bio-compartmentalization of microRNAs in exosomes during gestational diabetes mellitus. Placenta. 2016 doi: 10.1016/j.placenta.2016.12.002. [DOI] [PubMed] [Google Scholar]
  • 38.Mitchell MD, Peiris HN, Kobayashi M, et al. Placental exosomes in normal and complicated pregnancy. Am J Obstet Gynecol. 2015;213:S173–181. doi: 10.1016/j.ajog.2015.07.001. [DOI] [PubMed] [Google Scholar]
  • 39.Kambe S, Yoshitake H, Yuge K, et al. Human exosomal placenta-associated miR-517a-3p modulates the expression of PRKG1 mRNA in Jurkat cells. Biol Reprod. 2014;91:129. doi: 10.1095/biolreprod.114.121616. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
NIHMS863472-supplement-1.pdf (950.1KB, pdf)

RESOURCES