Abstract
Leptospira interrogans is a spirochaete responsible for leptospirosis in mammals. The molecular mechanisms of the Leptospira virulence remain mostly unknown. Recently, it has been demonstrated that an AAA+ chaperone ClpB (a member of the Hsp100 family) from L. interrogans (ClpBLi) is not only essential for survival of Leptospira under the thermal and oxidative stresses, but also during infection of a host. The aim of this study was to provide further insight into the role of ClpB in the pathogenic spirochaetes and explore its biochemical properties. We found that a non-hydrolysable ATP analogue, ATPγS, but not AMP-PNP induces the formation of ClpBLi hexamers and stabilizes the associated form of the chaperone. ADP also induces structural changes in ClpBLi and promotes its self-assembly, but does not produce full association into the hexamers. We also demonstrated that ClpBLi exhibits a weak ATPase activity that is stimulated by κ-casein and poly-lysine, and may mediate protein disaggregation independently from the DnaK chaperone system. Unexpectedly, the presence of E. coli DnaK/DnaJ/GrpE did not significantly affect the disaggregation activity of ClpBLi and ClpBLi did not substitute for the ClpBEc function in the clpB-null E. coli strain. This result underscores the species-specificity of the ClpB cooperation with the co-chaperones and is most likely due to a loss of interactions between the ClpBLi middle domain and the E. coli DnaK. We also found that ClpBLi interacts more efficiently with the aggregated G6PDH in the presence of ATPγS rather than ATP. Our results indicate that ClpB’s importance during infection might be due to its role as a molecular chaperone involved in reactivation of protein aggregates.
Introduction
Bacterial ClpB is a molecular chaperone belonging to the Hsp100 subfamily of AAA+ ATPases (ATPases associated with a variety of cellular activities) that cooperates with the DnaK chaperone system in solubilization and reactivation of aggregated proteins [1–4]. There are a number of observations indicating that the cooperation of ClpB and DnaK in protein disaggregation is species-specific [5–8].
Like other Hsp100 chaperones, ClpB forms barrel-shaped hexamers in the presence of nucleotides [9]. Each ClpB protomer is composed of an N-terminal domain (ND), two AAA+ ATP-binding modules (NBD1, NBD2), and a coiled-coil middle domain (MD) inserted at the end of NBD1 (Fig 1A). ND of ClpB is important for binding and recognition of protein substrates [10], whereas MD determines functional interactions with the DnaK chaperone system (including the apparent species-specificity of ClpB/DnaK) required for an efficient protein disaggregation in vivo and in vitro [6,7]. The mechanism of the ClpB-mediated protein disaggregation couples the ATP hydrolysis with the translocation of substrate polypeptides through the central channel of the hexameric ring [11].
Fig 1. Structural characteristics of ClpBLi used in this study.

(A) Comparison of the domain organization of ClpB from L. interrogans and E. coli. Bacterial ClpB proteins are composed of the following domains: N-terminal domain (ND), nucleotide binding domain 1 (NBD1), middle coiled-coil domain (MD), and nucleotide binding domain 2 (NBD2). The functions of the domains are indicated at the top. The amino acid residue numbers are shown for each chaperone and the amino acid sequence identity between ClpBEc and ClpBLi is indicated for each domain. (B) CD spectra of ClpBLi at 20°C (folded form) and 75°C (unfolded form) are shown. The CD signal was expressed as mean molar residue ellipticity (θ). (C) Temperature-induced changes in the CD signal at 222 nm for ClpBLi.
ClpB plays a crucial role in survival of bacteria under stressful conditions [12,13] and is also involved in supporting virulence of some bacterial pathogens [14–17], including a pathogenic spirochaete Leptospira interrogans [18] responsible for leptospirosis in mammals. Leptospirosis is considered the most widespread bacterial zoonosis of global importance. More than 1 million human cases of severe leptospirosis occur worldwide each year, with up to 20% mortality rate [19]. The sources of pathogenic leptospires are mainly infected and sick animals (or asymptomatic carriers), which excrete the bacteria with urine into the environment where they can survive even for several months. Thus, water and soil contaminated with infected urine may facilitate the spread of pathogenic Leptospira. In moderate-climate countries, the environment is a strong risk factor for Leptospira infections. In many regions, including the EU, there are significant economic losses due to reproductive disorders in cattle, sheep, pigs and horses linked to leptospirosis. The disease in these species often has a latent, chronic nature. Reproductive disorders and ocular inflammation in horses are the only symptoms of the disease, which hampers diagnosis and proper treatment and generates economic losses. Many serological and microbiological studies indicate a high rate of infections in domestic animals [20–23]. Despite a severity of leptospirosis and its global importance, the molecular mechanisms of the disease pathogenesis are not well understood. Thus, identification of the Leptospira virulence factors and characterization of their activity is particularly important for understanding the mechanisms of the disease.
A molecular chaperone ClpB is among the few known leptospiral virulence factors [18]. However, its role in pathogenic leptospires and biochemical activity have not been investigated so far. In this study, we explored for the first time structural and biochemical properties of ClpB from L. interrogans (ClpBLi). As reported earlier [24], ClpBLi shows a multi-domain organization similar to that of the well-characterized ClpB from Escherichia coli (ClpBEc) (Fig 1A) and the total sequence identity between ClpBLi and ClpBEc is 52%. In this study, we found that the recombinant ClpBLi can assemble into hexamers in a nucleotide-dependent manner, like other well-characterized bacterial ClpBs, and shows the aggregate-reactivation activity that may support the survival of L. interrogans under the host-induced stresses. Interestingly, ClpBLi may mediate disaggregation of some aggregated proteins without the assistance of the DnaK system. Furthermore, the E. coli DnaK chaperone system does not potentiate the ClpBLi activity and ClpBLi does not rescue the survival of E. coli ΔclpB mutant under heat shock. The apparent lack of cooperation between ClpBLi and the E. coli DnaK chaperone system during aggregate reactivation in vivo and in vitro demonstrates species-specificity among the chaperones, which could have evolved to address different types of stress affecting survival of different microorganisms.
Materials and methods
Proteins
ClpBLi was successfully overproduced as an N-terminal hexahistidine fusion protein in E. coli BL21(DE3) strain (Novagen) and then purified by immobilized metal affinity chromatography (IMAC) using Co-NTA agarose (Qiagen) and gel filtration chromatography (Superdex 200, Sigma-Aldrich) as previously reported [24]. After purification, the protein was extensively dialyzed against appropriate buffers (as described below in Materials and methods). The N-terminal histidine tag was removed by proteolytic digestion using the Thrombin Cleavage Capture Kit (Novagen) according to the manufacturer’s protocol.
E. coli chaperones (ClpBEc, DnaKEc, DnaJEc) were produced as previously described [25–27]. GrpE from E. coli (GrpEEc) was obtained from K. Liberek (Intercollegiate Faculty of Biotechnology of UG and MUG, Gdańsk, Poland). A Zn2+-dependent E. coli fructose-1,6-bisphosphate aldolase (Fda) was overproduced in XL1-Blue [pKEN8 (fda+, ampR)] cells purchased from the American Type Culture Collection (ATCC 77472) and purified as described earlier [28]. Glucose-6-phosphate dehydrogenase (G6PDH) from Leuconostoc mesenteroides, κ-casein and poly-lysine were obtained from Sigma. Protein concentrations were estimated by the Bradford method [29] with bovine serum albumin (BSA) as a standard or from absorption at 280 nm using the extinction coefficient of ClpBLi ɛ0.1% = 0.445 (mg/ml)-1cm-1 calculated from the amino acid composition by ProtParam [30].
Circular dichroism (CD) spectroscopy
The far-UV CD spectra (200–250 nm) of ClpBLi at a concentration of 0.15 mg/ml were recorded in a 50 mM Tris-HCl pH 7.5, 1 mM EDTA, 1 mM DTT, 20 mM MgCl2, 200 mM KCl, 10% glycerol buffer, in 1-mm path-length cells, using a Jasco J-815 spectropolarimeter (Japan) equipped with Jasco Peltier element for temperature control. The mean residue ellipticity was calculated according to [31]. To assess the thermal stability of ClpBLi, far-UV CD signals at 222 nm were recorded between 20 and 75°C with a scan rate of 0.5°C/min. A transition mid-point temperature (Tm) was calculated by fitting the sigmoidal Boltzman curve to the ellipticity data using the program OriginPro 9.1 (OriginLab Corp., USA, www.originlab.com).
Sedimentation velocity analytical ultracentrifugation
Analytical ultracentrifugation was performed at 20°C with Beckman Optima XL-I analytical ultracentrifuge equipped with a four- or eight-position An-Ti rotor and UV absorption detection at 290 nm in double-sector 1.2 cm cells with charcoal-filled epon centerpieces and sapphire windows. ClpBLi was dialyzed twice against 50 mM Tris-HCl pH 7.5 buffer containing 0.2 M (or 30 mM) KCl, 20 mM MgCl2, 1 mM EDTA, 2 mM β-mercaptoethanol, 5% glycerol, and 400 μl of the dialysate was loaded into reference sectors of the cells. Samples (390 μl) contained ClpBLi (at concentrations of 1.2 or 3 mg/ml) alone or with 2 mM nucleotide: ATPγS (adenosine-5’-(γ-thio)-triphosphate); Sigma), AMP-PNP (adenosine 5′-(β,γ-imido)-triphosphate; Sigma) or ADP (Sigma). ATP analogues at the same concentrations were also added to the reference sectors. Sedimentation velocity experiments were performed at 50,000 rpm and radial absorption scans of protein-concentration profiles were measured at 4.5- or 5-min intervals. The data were analyzed using the SEDFIT program with continuous sedimentation coefficient distribution c(s) model based on Lamm equation [32]. Integration of the c(s) peaks provided the signal-weighted average sedimentation coefficients (s) and the corresponding standard sedimentation coefficients s20,w (referring to water solvent at 20°C). Partial specific volume of ClpBLi (from the amino acid composition) as well as density and viscosity of the buffer were calculated using Sednterp program [33].
Proteolytic sensitivity assay
ClpBLi or ClpBEc (1 μM) was preincubated in 50 mM Tris-HCl pH 7.5 buffer containing 200 mM KCl, 20 mM MgCl2, 1 mM EDTA, 1 mM DTT and 10% glycerol for 10 min on ice without or with 5 mM nucleotides: ATP, ATPγS, ADP, AMP-PNP. Trypsin (Sigma) prepared in 1 mM HCl (at a concentration of 1 mg/ml) was then added to the reaction mixtures to a final concentration of 0.2 ng/μl, and the samples were incubated at 37°C for the indicated periods (from 0 to 60 min). The reactions were quenched by the addition of Laemmli SDS-PAGE buffer and samples were analyzed by 0.1%SDS-12.5%PAGE. The gels were stained with Coomassie blue dye.
ClpB ATPase assay
ClpBLi and ClpBEc were incubated in assay buffer (100 mM Tris-HCl, pH 8.0, 1 mM DTT, 1 mM EDTA, 10 mM MgCl2 and 5 mM ATP) at 37°C for 30 min without or with 0.1 mg/ml κ-casein or 0.04 mg/ml poly-lysine, or 2.1 μM aggregated G6PDH. The concentration of ClpB was 0.05 mg/ml for determination of the basal activity and in the presence of κ-casein, and G6PDH or 0.005 mg/ml in the presence of poly-lysine. Inorganic phosphate concentration was determined using the malachite green dye-based colorimetric assay [34] and detection at A640.
All absorbance measurements in this study were performed using a model U-1900 Hitachi UV-VIS spectrophotometer.
Aggregate reactivation assays
The purified Fda (2 μM, in buffer A: 100 mM Tris-HCl pH 7.5, 10 mM MgCl2 and 0.3 mM ZnCl2) was incubated at 55°C for 10 min. Subsequently, ATP (5 mM) and chaperones: ClpBLi or ClpBEc (0.65 μM), DnaKEc (1 μM), DnaJEc (0.2 μM) and GrpEEc (0.1 μM) were added. The total volume of a reaction mixture was 50 μl. The Fda activity was determined as described by Sigma Quality Test Procedure [35], and the decrease in A340 was measured after 60- and 120-minute incubation at 25°C using a spectrophotometer. The aggregated Fda in buffer A with 5 mM ATP, but without the chaperones was used as control.
Aggregates of G6PDH were prepared as described earlier [36]. The stock protein (420 μM) was diluted 2-fold with the unfolding buffer (10 mM urea, 16% glycerol, 40 mM DTT) and incubated at 47°C for 5 min. Subsequently, the mixture was diluted 10-fold by the addition of refolding buffer B (50 mM Tris-HCl pH 7.5, 20 mM Mg(OAc)2, 30 mM KCl, 1 mM EDTA, and 1 mM β-mercaptoethanol), incubated at 47°C for 15 min and then on ice for 2 min (stabilization of aggregates). Aggregated G6PDH (21 μM) was further diluted 10-fold with refolding buffer B. Subsequently, chaperones: ClpBLi or ClpBEc (0.65 μM), DnaKEc (1 μM), DnaJEc (0.2 μM), GrpEEc (0.1 μM) and 5 mM ATP were added. The G6PDH activity was determined as described before [36], and A340 was measured after 30-, 60-, and 80-minute incubation at 30°C using a spectrophotometer. Aggregates diluted with the refolding buffer B without the chaperones were used as control.
The chaperone-mediated reactivation of aggregated G6PDH and Fda was monitored in the absence of an ATP regenerating system. Therefore, to avoid significant ATP depletion and ADP accumulation, we limited the measurements to an initial stage of the reaction.
The inclusion bodies (IBs) of β-galactosidase (VP1LAC protein; E. coli β-galactosidase fused to the aggregation-prone VP1 capsid protein of the foot-and-mouth disease virus) overproduced from pJVP1LAC [37] in E. coli strains MC4100ΔclpB::kan or MC4100clpB+ (used as wild-type control; wt) and purified as described before [38] were resuspended in Z buffer (60 mM Na2HPO4, 40 mM NaH2PO4, 10 mM KCl, 1 mM MgSO4, 50 mM β-mercaptoethanol, pH 7.0), mixed and pipetted up and down. Subsequently, 5 mM ATP and, in the case of IBs isolated from ΔclpB mutant, also 1 μM ClpBLi or ClpBEc were added. The β-galactosidase activity was determined after 60-minute incubation at 30°C according to Miller’s method [39]. For the calculation of units of β-galactosidase, A420 was measured using a spectrophotometer and the enzyme activity was calculated as follows: β-galactosidase (Units/ml) = (A420)/(0.0045) x (1) x (15) [40], where 0.0045, 1 and 15 indicate, the molecular extinction coefficient of o-nitrophenol, cuvette pathlength (cm), and the reaction time (min), respectively.
E. coli strain MC4100 (SG20250) (araD139, Δ(argF-lac)U169, rpsL150, relA1, deoC1, ptsF25, rpsR, flbB53010) was obtained from S. Gottesman (National Cancer Institute, Bethesda, MD), and its derivative MC4100ΔclpB::kan was supplied by A. Toussaint (Université Libre de Bruxelles, Brussels, Belgium). Plasmid pJVP1LAC was kindly provided by García-Fruitós (Universitat Autonòma de Barcelona, Spain).
ClpB-aggregate interaction assay
The filtration assay was performed as reported earlier [36]. Aggregated G6PDH (21 μM) was diluted 10-fold by the addition of the refolding buffer B containing ClpBLi (0.65 μM) and 5 mM nucleotide: ADP, ATP, ATPγS, or AMP-PNP. The mixtures were incubated with shaking at 30°C for 10 min and then applied to the filter devices (Millipore Ultrafree-MC Centrifugal Filter Unit with the membrane pore size 0.1 μm). After 5 min incubation at room temperature, the filter devices were centrifuged at 7,500 g for 5 min to get the flow-through fractions, then washed with the refolding buffer containing an appropriate nucleotide at 30°C for 5 min and re-centrifuged. Next, SDS-loading buffer (2x) was added to the filter devices and they were incubated at 50°C for 5 min with shaking. Then, the filter devices were centrifuged to obtain the eluate fractions, which were separated by 0.1%SDS-10%PAGE and stained with Coomassie blue dye. The stained gels were scanned and analyzed with 1Dscan EX, Scananalytics Inc. Sigma program.
Heat-shock survival assay
The clpBLi gene was cloned into a low-copy pGB2 plasmid together with the native E. coli clpB heat-shock promoter (i.e. the σ32- dependent promoter). The nucleotide sequence of clpBLi was amplified from genomic DNA of L. interrogans by PCR using AccuTaq LA polymerase MIX (Sigma) with the following PCR primers: CATATGAAATTAATAAA CTTACATCCAAATT with the NdeI restriction site underlined, and AAGCTTTTAAA CTACAACAACTACCTTTCCCT with the HindIII restriction site underlined. The E. coli σ32 promoter was amplified from pGB2-ClpBEc [41] using the following primers: CCCGGGTTCTCGCCTGGTTAGGGC with the XmaI site underlined, and CATATG AACTCCTCCCATAACGGATC with the NdeI site underlined. First, the PCR products were cloned into pJET1.2 blunt vector (Fermentas), then digested with NdeI, HindIII, and XmaI, and ligated with the linearized pGB2/XmaI-HindIII vector to produce pGB2-ClpBLi. The E. coli MC4100ΔclpB cells were transformed with the empty pGB2, pGB2-ClpBEc [41], or pGB2-ClpBLi and bacterial survival during heat-shock was determined as described earlier [41]. To detect ClpB in E. coli cultures, Western blotting was performed according to [42] using anti-ClpBLi158-334 serum [18], that recognized both ClpBLi and ClpBEc, a peroxidase-coupled goat anti-rabbit secondary antibody (Sigma), and visualized with the substrate chromogen, 3,3’-diaminobenzidine tetrachloride (DAB, Sigma) and 30% H2O2.
Results
Secondary structure and thermal stability of ClpBLi
First, we estimated the secondary structure of the recombinant ClpBLi and its thermal stability by performing CD spectroscopy, which was a prerequisite for further characterization of the chaperone. As shown in Fig 1B, the CD spectrum recorded at 20°C showed local minima at 208 and 222 nm, which indicates that the recombinant ClpBLi is folded into a structure that is dominated by α-helices. This result is in agreement with the secondary structure of ClpBEc obtained from spectroscopic measurements [25] and that observed in the crystal structure of ClpB from T. thermophilus [3]. Furthermore, the structure of ClpBLi is thermodynamically stable at the assay temperatures used in this study, as shown by a cooperative unfolding transition (Fig 1C), with Tm of approx. 67°C. The thermal unfolding of ClpBLi is accompanied by a loss of the α-helical structure (see dotted line in Fig 1B).
Nucleotide-induced oligomerization of ClpBLi
It has been shown that the self-association of ClpB from E. coli (ClpBEc) into hexameric ring-shaped structures is tightly regulated by protein concentration and enhanced by the presence of nucleotides [9,43]. It has been also shown that hexamerization of ClpBEc is necessary for its ATPase activity and the biological function [25]. Therefore, we decided to study the self-assembly of the recombinant ClpBLi and answer the question whether it forms nucleotide-induced oligomers. For this purpose, we carried out sedimentation velocity experiments (Figs 2 and 3).
Fig 2. Sedimentation velocity experiments of ClpBLi.
Radial absorption profiles at 290 nm (•) with the best fits of SEDFIT c(s) model (―) are shown for 1.2 mg/ml (A) and 3 mg/ml ClpBLi (E) without nucleotides, and for 1.2 mg/ml ClpBLi with 2 mM nucleotide: ATPγS (B), ADP (C) or AMP-PNP (D). Ultracentrifugation was performed at 50,000 rpm and 20°C. Radial profiles were measured at 4.5-min (A, B, C, E) or 5-min (D) intervals in 50 mM Tris-HCl buffer pH 7.5 containing 20 mM MgCl2, 2 mM β-mercaptoethanol, 1 mM EDTA, 5% glycerol and 200 mM (A-D) or 30 mM KCl (E). For (A) every second profile is shown for clarity. Bottom panels present the fitting residuals. The time evolution of radial distributions was plotted as colored curves in the order of purple-blue-green-yellow-red.
Fig 3. Nucleotide-induced oligomerization of ClpBLi.
Shown are the sedimentation coefficient distributions c(s20,w) for 1.2 mg/ml ClpBLi in the absence of nucleotides (A), in the presence of the indicated nucleotide at 2 mM concentration (B-D), and in the low-salt buffer without nucleotides for 3 mg/ml ClpBLi (E). Sedimentation velocity data presented in Fig 2 were analyzed with a continuous sedimentation coefficient distribution c(s) model. The distributions were transformed to standard conditions.
As shown in Fig 3A, ClpBLi in the absence of nucleotides sedimented as a single predominant species with the standard sedimentation coefficient s20,w = 4.5 S, which agreed with the previously determined sedimentation coefficient of the monomeric ClpBEc [25]. The addition of a weakly hydrolyzed ATP analogue, ATPγS (Fig 3B), but not AMP-PNP (Fig 3D) induced efficient self-association of ClpBLi, manifested by the presence of a major peak at 14.1 S in the sedimentation coefficient distribution. The maxima of the distribution are broad, indicating that several types of oligomers are in rapid equilibrium in the presence of ATPγS. In such cases, the peaks appear at intermediate positions, which do not correspond to the s-values of the sedimenting species [44]. The value of 14.1 S is lower but close to the sedimentation coefficient of the hexameric ClpBEc [9]. Thus, we conclude, that in the presence of ATPγS, the hexamer of ClpBLi is most likely the largest oligomeric species. As shown in Fig 3C, in the presence of ADP, two major components are observed with sedimentation coefficients ~4.6 S and ~12.1 S. However, the position of the fastest sedimenting peak is about 2 S lower than for the distribution in the presence of ATPγS. This result suggests that ADP does not support full association of ClpBLi. Since a high salt concentration is known to promote dissociation of subunits in oligomeric proteins, we tested whether a low salt concentration may stabilize ClpB hexamers without nucleotides present. Fig 3E shows the sedimentation velocity result obtained for ClpBLi (at a concentration of 3 mg/ml) in a buffer with 30 mM KCl (vs. 200 mM KCl in panels A-D). We found that low salt concentration and an increased ClpBLi concentration did not result in efficient self-association of the chaperone, because ClpBLi sedimented primarily at 5.6 S.
Taken together, our observations (Fig 3 and Table 1) indicate that the ATP analogue, ATPγS, but not ADP, induces an efficient self-association of ClpBLi into hexamers. ADP does induce oligomerization of ClpBLi, but less efficiently than ATPγS.
Table 1. Summary of sedimentation coefficients for ClpBLi.
| ATP analogue [2 mM] |
ClpBLi [mg/ml] |
s20,w [S] (population %) | |||
|---|---|---|---|---|---|
| peak 1 | peak 2 | peak 3 | peak 4 | ||
| – | 1.2 | 4.5 ± 0.3 (86%) | 10.2 ± 0.7 (2%) | – | 16.9 ± 1.0 (<1%) |
| – | 3a | 5.6 ± 0.2 (74%) | 9.5 ± 0.4 (9%) | 11.6 ± 0.6 (10%) | 13.7 ± 0.4 (7%) |
| γ-S | 1.2 | 4.1 ± 0.8 (33%) | 8.8 ± 1.0 (8%) | – | 14.1 ± 1.4 (55%) |
| ADP | 1.2 | 4.6 ± 0.4 (41%) | 8.4 ± 0.7 (9%) | 12.1 ± 0.5 (50%) | – |
| AMP-PNP | 1.2 | 5.1 ± 0.2 (61%) | 9.5 ± 0.5 (19%) | – | 13.7 ± 1.0 (8%) |
The s20,w-values (mean ± S.E.) were determined from the data shown in Figs 2 and 3. Signal-weighted average sedimentation coefficients obtained by integration of the c(s) distribution peaks were corrected to standard conditions to provide the standard sedimentation coefficients s20,w (corresponding to the density and viscosity of water at 20°C).
a, The values determined for the low concentration of KCl (30 mM instead of 200 mM) in 50 mM Tris-HCl buffer pH 7.5 containing 20 mM MgCl2, 2 mM β-mercaptoethanol, 1 mM EDTA, 5% glycerol.
We also investigated the effect of nucleotides on the structure of ClpBLi by monitoring changes in its proteolytic degradation (Fig 4A). We compared the proteolytic pattern obtained for ClpBLi with that found for ClpBEc (Fig 4B). The ClpB proteins were digested with trypsin in the absence of nucleotides and in the presence of ATP, ATPγS, ADP and AMP-PNP. Subsequently, the degradation products were separated by SDS-polyacrylamide gel electrophoresis and stained with Coomassie blue dye (Fig 4A and 4B). We found that in the absence of nucleotides, ClpBLi was digested into several fragments in the ~25- to ~60-kDa range with a complete loss of the intact ~100-kDa ClpBLi after 20 min of incubation with trypsin. In the presence of nucleotides, ClpBLi showed varying degrees of protection against trypsin digestion, which indicates that ClpBLi undergoes structural changes upon binding of all tested nucleotides. Interestingly, ClpBLi in the presence of either ATPγS or ADP was more resistant to proteolysis than ClpBEc, (compare Fig 4A and 4B), as shown by a lack of prominent digestion fragments in ClpBLi with ATPγS and ADP and their presence in ClpBEc.
Fig 4. Proteolytic sensitivity of ClpBLi and ClpBEc in the absence and presence of nucleotides.
ClpB (1 μM) was incubated at 37°C for the indicated periods with 5 ng of trypsin in the absence or presence of 5 mM nucleotides. The degradation products were resolved by 0.1%SDS-12.5%PAGE and visualized by Coomassie-blue staining. Representative results from three experiments are shown. The positions of standard molecular mass markers (M) (in kDa), PageRuler prestained Protein Ladder (ThermoScientific), are shown on the left.
A protective effect of nucleotides on ClpBLi was weaker in the presence of ATP or AMP-PNP than with ATPγS or ADP, as shown by low-molecular weight fragments appearing after 10–20 min of incubation with trypsin. A partial loss of protection against trypsin for ClpBLi with ATP, as compared to the ATPγS-bound state, can be due to a fraction of nucleotide-free ClpBLi populated during the ATP turnover. ADP does induce oligomerization of ClpBLi, but not as efficiently as ATPγS (Fig 3B and 3C). Apparently, an incomplete oligomerization induced by ADP provides ClpBLi with a significant protection against trypsin, comparable to that of ATPγS. As for AMP-PNP, a lower extent of the ClpBLi protection can be explained by a low population of the ClpBLi oligomers induced by that ATP analogue (Fig 3D). Overall, the extent of the ClpBLi protection against trypsin in the presence of different nucleotides (Fig 4) correlates with the capability of those nucleotides to stabilize the ClpBLi oligomers (Fig 3).
ATPase activity of ClpBLi
We determined the ATPase activity of ClpBLi under the same conditions as the previously tested ClpBEc [25,36] using a malachite green phosphate-detection assay. As shown in Fig 5, ClpBLi exhibits a slightly lower basal ATPase activity than ClpBEc. The presence of unstructured polypeptides: κ-casein or poly-lysine, which are known to enhance the ATPase activity of ClpBEc up to 5- and 25-fold, respectively [45], caused an increase in the ATPase activity of ClpBLi. Thus, the ATPase of ClpBLi resembles in this respect the ATPase of ClpBEc. Aggregated glucose-6-phosphate dehydrogenase (G6PDH) did not significantly affect the ATPases of ClpBLi and ClpBEc.
Fig 5. ATPase activity of ClpBLi and ClpBEc.
The rate of ATP hydrolysis was determined at 37°C in the absence of other proteins (basal activity), in the presence of κ-casein (0.1 mg/ml), poly-lysine (0.04 mg/ml) (polyLys), or aggregated G6PDH (2.1 μM) (aggG6PDH). The average values from three independent experiments are shown with the standard deviations.
Chaperone activity of ClpBLi
It is known that ClpBEc efficiently reactivates aggregated proteins in cooperation with DnaK/DnaJ/GrpE [1,25]. Therefore, we tested the ability of ClpBLi to reactivate aggregated protein substrates in the presence of the E. coli DnaK chaperone system. In the reactivation assays, we used chemically denatured G6PDH that was previously tested in vitro as a ClpB substrate [4,36] and two new model substrates: thermally aggregated FBP aldolase (Fda) and inclusion bodies (IBs) of VP1-β-galactosidase (VP1LAC). Using the pull-down strategy coupled with the mass spectrometry (MS) analysis, we identified Fda as a putative substrate for ClpBLi (unpublished data). As we reported earlier, ClpBEc significantly increased the reactivation yield of β-galactosidase aggregated in the form of IBs [38,46].
The reactivation yield for the aggregated G6PDH (Fig 6A) in the presence of ClpBLi was significantly higher than for ClpBEc or the E. coli DnaK/DnaJ/GrpE system. In the case of reactivation of the aggregated Fda (Fig 6B), ClpBLi was again more effective than ClpBEc and equally potent as DnaK/DnaJ/GrpE. These results demonstrate an intrinsic disaggregase activity of ClpBLi, which, for the selected substrates, exceeds that of ClpBEc. However, the aggregate reactivation yields in Fig 6A and 6B obtained with ClpBLi in the presence of the E. coli DnaK/DnaJ/GrpE were similar to those obtained with ClpBLi alone. This result suggests that ClpBLi does not interact with the E. coli DnaK chaperone system during aggregate reactivation in vitro. The reactivation of β-galactosidase from IBs produced in E. coli (Fig 6C) occurred more efficiently with ClpBLi than in the absence of ClpB, but did not reach the efficiency of ClpBEc. This observation, again, suggests that ClpBLi is capable of reactivating protein aggregates, but does not cooperate with the E. coli co-chaperones. Altogether, these properties of ClpBLi are similar to the previously investigated ClpB from a zoonotic bacterium Ehrlichia chaffeensis [36].
Fig 6. Reactivation of the aggregated substrates in the presence of ClpBLi and ClpBEc.

The reactivation of aggregated enzymes, G6PDH (A) and Fda (B) in the presence of DnaK/DnaJ/GrpE (KJE) from E. coli without ClpB and with ClpBEc or ClpBLi. The native activity of G6PDH or Fda determined before the chemical denaturation or the heat treatment at 55°C, respectively, corresponds to 100%; the fraction of the enzyme activity remaining after the denaturation and also corresponding to the reactivation extent in the absence of chaperones (control) is marked by the broken line. (C) The effect of ClpBLi and ClpBEc on the reactivation of β-galactosidase sequestered into IBs (VP1LAC) isolated from E. coliΔclpB mutant cells. A statistically significant difference in the β-galactosidase activity regain in the absence and presence of ClpBLi assessed by the paired t-test (using GraphPad Prism software) is indicated as **, p<0.01. The results are presented as the average of three (A, C) or four (B) independent experiments with the standard deviations indicated.
Interaction of ClpBLi with aggregated protein substrates
Previous studies demonstrated that nucleotides regulate interactions of bacterial ClpBs with the aggregated substrates. It has been shown that only ATPγS promotes significant binding of ClpBEc to the aggregates [13,36], while ClpB from E. chaffeensis interacts more efficiently with aggregates in the presence of the hydrolysable ATP [36]. Other nucleotides, such as ADP and AMP-PNP did not induce significant binding of ClpBEc to protein aggregates. We tested whether binding of ClpBLi to the aggregates is more efficiently stimulated by ATPγS (which induces a “frozen” ATP-like ClpB state) or by the hydrolysable ATP. We incubated ClpBLi with the aggregated G6PDH in the absence and presence of the tested nucleotides and then determined the amount of ClpBLi bound to aggregates (Fig 7) by performing a filtration assay (see Materials and methods). Only background amounts of ClpBLi were detected in the absence of the aggregates. We found that interactions of ClpBLi with the aggregated G6PDH were more effective in the presence of ATPγS than in the presence of ATP, similar to ClpBEc. Under the conditions of ATP turnover, ClpBLi appears to lose the capability of binding stably to protein aggregates.
Fig 7. Interaction of ClpBLi with the aggregated G6PDH.
(A) ClpBLi was incubated with aggregates of G6PDH (Agg) in the presence of 5 mM ATP or ATPγS and without nucleotides. The solutions were passed through a 0.1-μm filter. Subsequently, the fractions retained on the filters were solubilized with an SDS buffer and analyzed by the Coomassie blue-stained 0.1%SDS-10%PAGE gel. A representative result from three independent experiments is shown. (B) Bands corresponding to ClpBLi were analyzed with Sigma Gel software. Results are presented as the average of three independent experiments with standard deviations indicated. The amount of ClpBLi detected in the absence of the aggregates is indicated with the broken line.
Heat-shock survival of the clpB-null E. coli in the presence of ClpBLi
In E. coli, ClpB is necessary for bacterial survival under heat shock [12]. It was demonstrated that the lack of a functional ClpB decreased the growth rate of E. coli at 45°C and inhibited cell survival at 50°C. We investigated whether ClpBLi can function in the E. coli cells and substitute for ClpBEc. We cloned the clpBLi gene into a low-copy pGB2 plasmid together with the native E. coli σ32-dependent clpB heat shock promoter. Next, the resulting plasmid pGB2-ClpBLi and the control plasmids, pGB2 and pGB2-ClpBEc were introduced into the E. coli ΔclpB mutant and a heat-shock survival assay was performed (see Materials and methods). As shown in Fig 8A, the heat-inducible expression of pGB2-ClpBLi produced a in the ~100-kD protein detectable by Western blotting using anti-ClpBLi158-334 serum [18]. We observed, however, that ClpBLi was unable to functionally substitute for ClpBEc and consequently, it did not rescue E. coli ΔclpB mutant under heat shock conditions (Fig 8B and 8C). In contrast, the expression of the clpBEc gene from pGB2 complemented the effect of the ΔclpB mutation. With ClpBEc, ~80% of the bacteria survived a severe heat shock at 50°C for 90 minutes, which is consistent with the previous results [12].
Fig 8. Effect of the clpBLi gene expression on the growth and survival of E. coli ΔclpB mutant under heat shock.
(A) Immunodetection of ClpBLi with specific antibodies in E. coliΔclpB cells grown at 30°C and after 2h of heat shock at 45°C. An asterisk indicates ClpBLi. The position of ClpBEc (control of heat-inducible expression) was marked by a circle. (B) Growth curves of E. coliΔclpB cells carrying empty pGB2 (control 1), pGB2-ClpBEc (control 2) or pGB2-ClpBLi exposed to a mild heat shock at 45°C for the indicated times. (C) Survival of the same bacterial strains as in (B) after exposure to a severe heat shock at 50°C for the indicated times. The average values from three independent experiments are shown in (B) and (C).
Discussion
To date, little is known about the structure and biological role of molecular chaperones from Leptospira spp., including ClpB. It has been demonstrated that the L. interrogans ClpB is essential for the pathogen survival under stress conditions and also during infection of the host [18]. Moreover, a recently reported immunoreactivity of ClpBLi with the sera collected from Leptospira-infected animals [24] and the fact that clpBLi is up-regulated in leptospiral cells [18] suggest that the ClpB activity may be important for pathogenicity of Leptospira. In this work, we described the biochemical and structural properties of ClpB from L. interrogans.
As demonstrated by the sedimentation velocity experiments (Figs 2 and 3), ClpBLi forms hexamers in the presence of the ATP analogue, ATPγS (Fig 3B), while it exists as a monomeric protein in the absence of nucleotides (Fig 3A). In contrast to ATPγS, ADP induces partial self-association of ClpBLi (Fig 3C). Insofar as ATPγS-induced hexamerization is rather typical for bacterial ClpB homologues, the effect of ADP on their oligomerization in vitro appears species-dependent. Specifically, ADP stabilized the hexameric forms of the yeast ClpB orthologue, Hsp104 [47,48] or ClpB from the halophilic lactic acid bacterium Tetragenococcus halophilus [49], whereas ClpBEc [43] and the T. thermophilus ClpB [50] did not fully assemble into hexamers in the presence of ADP, similar to our results for ClpBLi. Unexpectedly, another ATP analogue, AMP-PNP, did not induce an effective assembly of oligomeric ClpBLi (Fig 3D). This result indicates that AMP-PNP binding inhibits self-association of ClpBLi or that the affinity of AMP-PNP towards ClpBLi is low. A similar effect, where AMP-PNP did not induce oligomerization was observed for ClpB from Tetragenococcus halophilus [49]. We also tested the effect of a low salt concentration on the ClpBLi oligomerization in the absence of nucleotide and at an increased concentration of the chaperone (Fig 3E). In contrast to ClpBEc [51], a decreased salt concentration did not stabilize the ClpBLi oligomers. The results presented in Fig 4A show a protective effect of nucleotides on ClpBLi during trypsin digestion with the strongest effect for ATPγS and ADP and a weaker one with AMP-PNP, which correlates with the extent of oligomerization induced by these nucleotides (see Fig 3).
Like other previously characterized ClpB proteins, ClpB from L. interrogans catalyzes the hydrolysis of ATP (Fig 5), stably binds to aggregated substrates in the presence of an ATP analogue (Fig 7), and shows a disaggregase activity towards aggregated proteins: G6PDH, Fda and β-galactosidase trapped in IBs (Fig 6). It is worth noting that the reactivation yield of Fda (see Fig 6B) in the presence of ClpBLi alone was similar to that obtained with the E. coli DnaK chaperone system, but ClpBLi was significantly more efficient in mediating the aggregate reactivation than ClpBEc. It has been previously shown that the DnaK chaperone system can disaggregate some substrates, specifically small-size and low-complexity aggregates [28,52,53]. Thus, the intrinsic disaggregase activity of ClpBLi in Fig 6A and 6B manifesting in the absence of the co-chaperones and exceeding that of ClpBEc suggests that the range of potential aggregated substrates of ClpBLi may be broader than for ClpBEc and may overlap with that of DnaK.
Furthermore, the DnaK chaperone system from E. coli increased the efficiency of aggregate reactivation mediated by ClpBEc, but not ClpBLi (see Fig 6A and 6B). A similar effect was observed before for ClpB from a parasite Plasmodium falciparum [8]. The apparent lack of cooperation between ClpBLi and the E. coli co-chaperones in vitro (Fig 6) is consistent with the result of an in vivo assay presented in Fig 8 (see panels B and C), which shows that ClpBLi is unable to restore the viability of E. coli ΔclpB cells after heat shock. This property of ClpBLi resembles ClpB from E. chaffeensis, for which, however, the E. coli DnaK system potentiated the chaperone activity during reactivation of aggregated proteins in vitro [36]. The apparent lack of an efficient cooperation of ClpBLi with E. coli co-chaperones during protein disaggregation both in vivo and in vitro is likely due to the species-specificity of multi-chaperone networks, as reported before [5,6,8]. As has been previously shown, the middle domain of ClpB is responsible for the species-specific cooperation among the chaperones [6]. The sequence identity between ClpBLi and ClpBEc within the middle domain is only ~45% (Fig 1A), which is apparently insufficient to support a cooperation between ClpBLi and the E. coli DnaK system. The lack of cooperation between ClpBLi and the E. coli co-chaperones also possibly explains an inability of ClpBLi to rescue the survival of E. coli under heat shock (Fig 8, panels B and C). However, the results in Fig 8 could be also explained by a lower potency of ClpBLi towards proteins aggregated in heat-shocked E. coli vs. those accumulating in the chaperone’s native environment of Leptospira during infection of the host.
Conclusions
Our studies revealed several crucial structural and biochemical properties of the molecular chaperone ClpB from Leptospira, which may support its role in pathogenicity of spirochaetes. We showed that ClpBLi forms hexameric assemblies that are stabilized and interact with protein aggregates in the ATP-bound state. Moreover, ClpBLi exhibits a protein disaggregase activity that may contribute to the survival of L. interrogans under the host-induced proteotoxic stress. Our studies make a novel contribution to the largely uncharacterized biology of Leptospira and suggest that the L. interrogans and E. coli chaperones evolved differently to respond to the different nature of stress that the proteomes of either bacteria can be exposed to.
Acknowledgments
We are very grateful to E. García-Fruitós and A. Villaverde (Universitat Autònoma de Barcelona) for pJVP1LAC, M. Picardeau (Institut Pasteur, Unité de Biologie des Spirochètes) for the generous gift of ClpBLi antiserum, K. Liberek (Intercollegiate Faculty of Biotechnology of UG and MUG) for the purified GrpEEc and J. Skórko-Glonek for Superdex 200 resin (University of Gdańsk). We also thank M. Manicki and T. Chamera for excellent technical assistance with the French pressure cell press (Intercollegiate Faculty of Biotechnology UG and MUG).
Data Availability
All relevant data are within the paper.
Funding Statement
This work was supported by the Preludium Grant number 2015/17/N/NZ6/03493 (to JK) from the National Science Center (Poland) and UG grants for Young Scientists numbers 538-L130-B588-14 and 538-L130-B929-15 (to JK). The analytical ultracentrifugation experiments were performed in the NanoFun laboratories co-financed by the European Regional Development Fund within the Innovation Economy Operational Program, project no. POIG.02.02.00-00-025/09. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1.Zolkiewski M. ClpB cooperates with DnaK, DnaJ, and GrpE in suppressing protein aggregation. J Biol Chem. 1999;274: 28083–28086. [DOI] [PubMed] [Google Scholar]
- 2.Mogk A, Tomoyasu T, Goloubinoff P, Rűdiger S, Röder D, Langen H, et al. Identification of thermolabile Escherichia coli proteins: prevention and reversion of aggregation by DnaK and ClpB. EMBO J. 1999;18: 6934–6949. doi: 10.1093/emboj/18.24.6934 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Lee S, Sowa ME, Watanabe Y, Sigler PB, Chiu W, Yoshida M, et al. The structure of ClpB: a molecular chaperone that rescues proteins from an aggregated state. Cell. 2003;115: 229–240. [DOI] [PubMed] [Google Scholar]
- 4.Barnett ME, Nagy M, Kedzierska S and Zolkiewski M. The amino-terminal domain of ClpB supports binding to strongly aggregated proteins, J Biol Chem. 2005;280: 34940–34945. doi: 10.1074/jbc.M505653200 [DOI] [PubMed] [Google Scholar]
- 5.Schlee S, Beinker P, Akhrymuk A, Reinstein J. A chaperone network for the resolubilization of protein aggregates: direct interaction of ClpB and DnaK. J Mol Biol. 2004;336: 275–285. [DOI] [PubMed] [Google Scholar]
- 6.Miot M, Reidy M, Doyle SM, Hoskins JR, Johnston DM, Genest D, et al. Species-specific collaboration of heat shock proteins (Hsp) 70 and 100 in thermotolerance and protein disaggregation. Proc Natl Acad Sci USA. 2011;108: 6915–6920. doi: 10.1073/pnas.1102828108 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.DeSantis ME, Shorter J. The elusive middle domain of Hsp104 and ClpB: location and function. Biochim Biophys Acta. 2012;1823: 29–39. doi: 10.1016/j.bbamcr.2011.07.014 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Ngansop F, Li H, Zolkiewska A, Zolkiewski M. Biochemical characterization of the apicoplast-targeted AAA+ ATPase ClpB from Plasodium falciparum. Biochem Biophys Res Commun. 2013;439: 191–195. doi: 10.1016/j.bbrc.2013.08.064 [DOI] [PubMed] [Google Scholar]
- 9.Akoev V, Gogol EP, Barnett ME, Zolkiewski M. Nucleotide-induced switch in oligomerization of the AAA+ ATPase ClpB. Protein Sci. 2004;13: 567–74. doi: 10.1110/ps.03422604 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Rosenzweig R, Farber P, Velvis A, Rennella E, Latham MP, Kay LE. ClpB N-terminal domain plays a regulatory role in protein disaggregation. Proc Natl Sci USA. 2015;112: E6872–81. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Weibezahn J, Tessarz P, Schlieker C, Zahn R, Maglica Z, Lee S, et al. Thermotolerance requires refolding of aggregated proteins by substrate translocation through the central pore of ClpB. Cell. 2004;119: 653–665. doi: 10.1016/j.cell.2004.11.027 [DOI] [PubMed] [Google Scholar]
- 12.Squires CL, Pedersen S, Ross BM, Squires C. ClpB is the Escherichia coli heat shock protein F84.1. J Bacteriol. 1991;173: 4254–4262. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Nagy N, Guenther I, Akoyev V, Barnett ME, Zavodszky MI, Kedzierska-Mieszkowska S, et al. Synergistic cooperation between two ClpB isoforms in aggregate reactivation. J Mol Biol. 2010;396: 697–707. doi: 10.1016/j.jmb.2009.11.059 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Kannan TR, Musatovova O, Gowda P, Baseman JB. Characterization of a unique ClpB protein of Mycoplasma pneumoniae and its impact on growth. Infect Immun. 2008;76: 5082–5092. doi: 10.1128/IAI.00698-08 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Capestany CA, Tribble GD, Maeda K, Demuth DR, Lament RJ. Role of the Clp system in stress tolerance, biofilm formation, and intracellular invasion in Porphyromonas gingivalis. J Bacteriol. 2008;190: 1436–1446. doi: 10.1128/JB.01632-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Chastanet A, Derre I, Nair S, Msadek T. ClpB, a novel number of the Listeria monocytogenes CtsR regulon, is involved in virulence but not in general stress tolerance. J Bacteriol, 2004;186: 1165–1174. doi: 10.1128/JB.186.4.1165-1174.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Meibom KL, Dubail I, Dupuis M, et al. The heat-shock protein ClpB of Francisella tularensis is involved in stress tolerance and is required for multiplication in target organs of infected mice. Mol Microbiol. 2008;67: 1384–1401. doi: 10.1111/j.1365-2958.2008.06139.x [DOI] [PubMed] [Google Scholar]
- 18.Lourdault K, Cerqueira GM, Wunder EA Jr, Picardeau M. Inactivation of clpB in the pathogen Leptospira interrogans reduces virulence and resistance to stress conditions. Infect Immun. 2011;79: 3711–3717. doi: 10.1128/IAI.05168-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Adler B, Lo M, Seemann T, Murray GL. Pathogenesis of leptospirosis: the influence of genomics. Vet Mirobiol. 2011;153: 73–81. [DOI] [PubMed] [Google Scholar]
- 20.Ryan EG, Nola L, O’Grady L, More SJ, Doherty LM. Seroprevalence of Leptospira Hardjo in the Irish suckler cattle population. Ir Vet J. 2012;65: 8 doi: 10.1186/2046-0481-65-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Arent Z, Kędzierska-Mieszkowska S. Seroprevalence study of leptospirosis in horses in northern Poland. Vet Rec. 2013;172: 269. [DOI] [PubMed] [Google Scholar]
- 22.Arent Z, Frizzell C, Gilmore C, Mackie D, Ellis WA. Isolation of leptospires from genital tract of sheep. Vet Rec. 2013;173: 582. [DOI] [PubMed] [Google Scholar]
- 23.Arent ZJ, Andrews S, Adamama-Moraitou K, Gilmore C, Pardali D, Ellis WA. Emergence of novel Leptospira serovars: a need for adjusting vaccination policies for dogs? Epidemiol Infect. 2013;141: 1148–1153. doi: 10.1017/S0950268812002087 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Krajewska J, Arent Z, Więckowski D, Zolkiewski M, Kędzierska-Mieszkowska S. Immunoreactivity of the AAA+ chaperone ClpB from Leptospira interrogans with sera from Leptospira-infected animals. BMC Microbiol. 2016;16: 151–158. doi: 10.1186/s12866-016-0774-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Barnett ME, Zolkiewska A, Zolkiewski M. Structure and Activity of ClpB from Escherichia coli: Role of the Amino- and Carboxy-terminal Domains. J Biol Chem. 2000; 275: 37565–37571. doi: 10.1074/jbc.M005211200 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Żmijewski M, Macario AJ, Lipińska B. Functional similarities and differences of an archaeal Hsp70(DnaK) stress protein with the homologue from the bacterium Escherichia coli. J Mol Biol. 2004;336: 539–54. [DOI] [PubMed] [Google Scholar]
- 27.Żylicz M, Yamamoto T, McKittrick N, Sell S, Georgopoulos C. Purification and properties of the dnaJ replication protein of Escherichia coli. J Biol Chem. 1985;260: 7591–7598. [PubMed] [Google Scholar]
- 28.Kędzierska S, Jezierski G, Taylor A. DnaK/DnaJ chaperones system reactivates endogenous E. coli thermostable FBP aldolase in vivo and in vitro; the effect is enhanced by GroE heat shock proteins. Cell Stress Chaperones. 2001;6: 29–37. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Bradford MM. A rapid and sensitive method for quantition of proteins utilizing the principles of protein-dye binding. Anal Biochem. 1976;72: 248–254. [DOI] [PubMed] [Google Scholar]
- 30.Gasteiger E, Hoogland C, Gattiker A, Duvaud S, Wilkins MR, Appel RD, et al. Protein Identification and Analysis Tools on the ExPASy Server In: Walker JM editor. The proteomics protocols handbook. Humana Press; 2005. pp. 571–607. [Google Scholar]
- 31.Kelly SM, Jess TJ, Price NC. How to study proteins by circular dichroism. Biochim Biophys Acta. 2005;1751: 119–139. doi: 10.1016/j.bbapap.2005.06.005 [DOI] [PubMed] [Google Scholar]
- 32.Schuck P. Size-distribution analysis of macromolecules by sedimentation velocity ultracentrifugation and lamm equation modeling. Biophys J. 2000;78: 1606–1619. doi: 10.1016/S0006-3495(00)76713-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Laue TM, Shah BD, Ridgeway TM, Pelletier SL. Computer-aided interpretation of analytical sedimentation data for proteins In: Harding SE, Rowe AJ, Horton JC, editors. Analytical Ultracentrifugation in Biochemistry and Polymer Science. The Royal Society of Chemistry, U.K; 1992. pp. 90–125. doi: 10.1007/s00249-009-0425-1 [Google Scholar]
- 34.Schacherl M, Waltersperger S, Baumann U. Structural characterization of the ribonuclease H-like type ASKHA superfamily kinase MK0840 from Methanopyrus kandleri. Acta Crystallogr D Biol Crystallogr. 2013;69: 2440–2450. doi: 10.1107/S0907444913022683 [DOI] [PubMed] [Google Scholar]
- 35.Bergmeyer HU. Methods of Enzymatic Analysis, vol. 4 Verlag Chemie, Weinheim; 1992. [Google Scholar]
- 36.Zhang I, Kedzierska-Mieszkowska S, Liu H, Cheng C, Ganta RR, Zolkiewski M Aggregate-reactivation activity of the molecular chaperone ClpB from Ehrlichia chaffeensis. PloSOne. 2013;8: e62454 doi: 10.1371/journal.pone.0062454 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Corchero JL, Viaplana E, Benito A, Villaverde A. The position of the heterologuos domain can influence the solubility and proteolysis of β-galactosidase fusion proteins in E. coli. J Biotechnol. 1996;48: 191–200. [DOI] [PubMed] [Google Scholar]
- 38.Guenther I, Zolkiewski M, Kędzierska-Mieszkowska S. Cooperation between two ClpB isoforms enhances the recovery of the recombinant β-galactosidase from inclusion bodies. Biochem Biophys Res Commun. 2012;426: 596–600. doi: 10.1016/j.bbrc.2012.08.135 [DOI] [PubMed] [Google Scholar]
- 39.Miller JH. Experiments in Molecular Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York; 1972. [Google Scholar]
- 40.Kyung-Hwan J. Enhanced enzyme activites of inclusion bodies of recombinant β-galactosidase via the addition of inducer analog after L-arabinose induction in the araBAD promoter system of Escherichia coli. J Microbiol Biotechnol. 2008;18: 434–442. [PubMed] [Google Scholar]
- 41.Kędzierska S, Akoev V, Barnett ME, Zolkiewski M. Structure and function of the middle domain of ClpB from Escherichia coli. Biochemistry. 2003;42: 4242–4248. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Harlow E, Lane D. Antibodies: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York; 1988. [Google Scholar]
- 43.Zolkiewski M, Kessel M, Ginsburg A, Maurizi MR. Nucleotide-dependent oligomerization of ClpB from Escherichia coli. Protein Sci. 1999;8: 1899–1903. doi: 10.1110/ps.8.9.1899 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44.Schuck P. On the analysis of protein self-association by sedimentation velocity analytical ultracentrifugation. Anal Biochem. 2003;320: 104–124. [DOI] [PubMed] [Google Scholar]
- 45.Strub C, Schlieker C, Bukau B, Mogk A. Poly-L-lysine enhances the protein disaggregation activity of ClpB. FEBS Lett. 2003;553: 125–130. [DOI] [PubMed] [Google Scholar]
- 46.Zblewska K, Krajewska J, Zolkiewski M, Kędzierska-Mieszkowska S. Role of the disaggregase ClpB in processing of proteins aggregated as inclusion bodies. Arch Biochem Biophys. 2014;555–556: 23–7. doi: 10.1016/j.abb.2014.05.012 [DOI] [PubMed] [Google Scholar]
- 47.Parsell DA, Kowal AS, Lindquist S. Sacchromyces cerevisiae Hsp104 protein. Purification and characterization of ATP-induced structural changes. J Biol Chem. 1994;269: 4480–4487. [PubMed] [Google Scholar]
- 48.Schrimer EC, Queitsch C, Kowal AS, Parsell DA, Lindquist S. The ATPase activity of Hsp104, effect of environmental conditions and mutations. J Biol Chem. 1998;273: 15546–15552. [DOI] [PubMed] [Google Scholar]
- 49.Sugimoto S, Yoshida H, Mizunoe Y, Tsuruno K, Nakayama J, Sonomoto K. Structural and functional conversion of molecular chaperone ClpB from the Gram-positive halophilic lactic acid bacterium Tetragenococcus halophilus mediated by ATP and stress. J Bacteriol, 2006;188: 8070–8078. doi: 10.1128/JB.00404-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50.Watanabe Y, Motohashi K, Yoshida M. Roles of the two ATP binding sites of ClpB from Thermus thermophilus. J Biol Chem. 2002;277: 5804–5809. doi: 10.1074/jbc.M109349200 [DOI] [PubMed] [Google Scholar]
- 51.Lin J, Lucius AL. Examination of the dynamic assembly equilibrium for E. coli ClpB. Proteins. 2015;83: 2008–2024. doi: 10.1002/prot.24914 [DOI] [PubMed] [Google Scholar]
- 52.Skowyra D, Georgopoulos C, Zylicz M. The Escherichia coli dnaK gene product, the Hsp70 homologue, can reactivate heat-inactivated RNA polymerase in an ATP hydrolysis-dependent manner. Cell. 1990;62: 939–944. [DOI] [PubMed] [Google Scholar]
- 53.Diamant S, Ben-Zvi AP, Bukau B, Goloubinoff P. Size-dependent disaggregation of stable protein aggregates by DnaK chaperone machinery. J Biol Chem. 2000;275: 21107–21113. doi: 10.1074/jbc.M001293200 [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
All relevant data are within the paper.






